CN114350728A - Method for preparing hyaluronic acid oligosaccharide by enzyme method - Google Patents
Method for preparing hyaluronic acid oligosaccharide by enzyme method Download PDFInfo
- Publication number
- CN114350728A CN114350728A CN202110937316.3A CN202110937316A CN114350728A CN 114350728 A CN114350728 A CN 114350728A CN 202110937316 A CN202110937316 A CN 202110937316A CN 114350728 A CN114350728 A CN 114350728A
- Authority
- CN
- China
- Prior art keywords
- hyaluronic acid
- hyaluronidase
- oligosaccharide
- lys
- glu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention provides a method for preparing hyaluronic acid oligosaccharide by an enzyme method, which comprises the following steps: preparing a hyaluronic acid solution, and adding hyaluronidase into the hyaluronic acid solution for reaction to obtain hyaluronic acid oligosaccharide, wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID No. 3. The invention has the following beneficial effects: firstly, the reducing end of the hyaluronic acid oligosaccharide obtained by the invention is N-acetylglucosamine, and lays a foundation for researching the structure-activity relationship of the hyaluronic acid oligosaccharide in academic circles; secondly, the reaction conditions of the invention are extremely simple, have no requirements on instruments and equipment, can be implemented at normal temperature and normal pressure, and have no pollution to waste; finally, the reaction system is acetic acid-sodium acetate buffer solution, and the hyaluronic acid oligosaccharide with high purity can be obtained through subsequent simple processes of deproteinization, nanofiltration desalination and spray drying, and has potential and wide application value in the fields of skin care products, health care products, oligosaccharide medicines and the like.
Description
Technical Field
The invention belongs to the technical field of bioengineering, and particularly relates to a method for preparing hyaluronic acid oligosaccharide by a high-scale enzyme method.
Background
Hyaluronic acid (HA for short), also known as hyaluronic acid, is a macromolecular viscous polysaccharide formed by alternately connecting beta (1-3) and beta (1-4) glycosidic bonds with D-glucuronic acid and N-acetylglucosamine as repeating disaccharide units, and is firstly extracted from bovine vitreous bulbils in 1934 by Meyer et al.
Literature studies have shown that the biological activity of HA depends on the size of its molecular weight, with different molecular weight ranges of HA exhibiting different physiological functions. The high molecular weight HA HAs good viscoelasticity, moisture retention, anti-inflammation, lubrication and other functions, and can be applied to cosmetics industry, ophthalmic surgery viscoelastic agents and intra-articular injection treatment. Compared with high molecular weight HA, the hyaluronic acid oligosaccharide HAs the effects of inhibiting tumor diffusion, promoting wound healing, promoting bone and angiogenesis, regulating immunity and the like, and is easy to permeate into dermis, and is an activator of immune cells and cytokines. Therefore, the hyaluronic acid oligosaccharide has wide application prospects in the fields of food health care, cosmetics and clinical medical treatment.
Hyaluronidase is a class of glycosidases that degrade hyaluronic acid and some glycosaminoglycans. Hyaluronidase is classified into three categories according to its origin, catalytic mechanism and substrate specificity: the first type is hyaluronic acid lyase of microbial origin, and the hyaluronidase (EC 4.2.2.1) cleaves beta-1, 4 glycosidic bond of hyaluronic acid through beta racemization reaction to generate oligosaccharide with unsaturated N-acetylglucosamine structure at reducing end; a second representative group of hyaluronidases (EC 3.2.1.36) is mainly derived from the salivary glands of leeches, belongs to endo- β -glucuronidase, and is capable of hydrolyzing β -1, 3 glycosidic bonds of hyaluronic acid, and the reducing end of the produced oligosaccharide is a glucuronic acid structure; the third type of hyaluronidase is endo-beta-N-acetylglucosaminidase (EC3.2.1.35), mainly derived from testis of mammal and venom of animal, and can hydrolyze beta-1, 4 glycosidic bond of hyaluronic acid to generate oligosaccharide with saturated N-acetylglucosamine structure at its reducing end, and the enzyme has wide substrate spectrum and certain catalytic activity on chondroitin sulfate and dermatan sulfate structures.
The currently disclosed enzymatic methods for preparing hyaluronic acid oligosaccharides mainly focus on the first class of hyaluronidase (patent publication No. CN 105055440B, CN 109517012B) and the second class of leech hyaluronidase (patent publication No. CN 106399428B, CN 104178539B). Because the current commercialized third type hyaluronidase (endo-beta-N-acetylglucosaminidase) is mainly BTH extracted from bovine testis and human PH20 enzyme partially expressed by CHO cells in a recombinant mode, the production cost is very high, and the hyaluronidase cannot be used for industrially preparing hyaluronic acid oligosaccharide. Therefore, no report on the use of this enzyme for the preparation of hyaluronic acid oligosaccharides has been reported.
Disclosure of Invention
Aiming at the problems in the prior art, the invention provides an enzymatic method for preparing hyaluronic acid oligosaccharide.
Specifically, the present invention relates to the following aspects:
1. a method for preparing hyaluronic acid oligosaccharide by an enzymatic method, which is characterized by comprising the following steps:
preparing a hyaluronic acid solution,
adding hyaluronidase into the hyaluronic acid solution for reaction to obtain hyaluronic acid oligosaccharide,
wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID NO. 3.
2. The method according to item 1, wherein the initial concentration of the hyaluronic acid in the reaction system comprising the hyaluronidase and the hyaluronic acid solution is 20 to 80 g/L.
3. The method according to item 1, wherein the reaction system comprising the hyaluronidase and the hyaluronic acid solution is a reaction systemThe molecular weight of the hyaluronic acid is greater than or equal to 1 x 106Da。
4. The method according to item 1, wherein the concentration of the hyaluronidase is 1.5X 10 in the reaction system comprising the hyaluronidase and the hyaluronic acid solution3-1×105U/mL。
5. The method according to item 1, wherein the reaction temperature is 20 to 65 ℃ and the reaction time is 0.5 to 8 hours.
6. The method according to item 1, wherein the hyaluronic acid solution is prepared using an acetate-sodium acetate buffer solution of 20 to 100mM, pH 4.0 to 6.5.
7. The method of item 1, wherein the hyaluronan oligosaccharide comprises a hyaluronan oligosaccharide having a saturated N-acetylglucosamine at the reducing end.
8. The method of claim 1, wherein the hyaluronic acid oligosaccharide comprises hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide and hyaluronic acid decasaccharide.
9. A hyaluronic acid oligosaccharide composition, wherein the hyaluronic acid oligosaccharide composition comprises hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide and hyaluronic acid decasaccharide.
10. The composition of claim 9, which is prepared by the method of any one of items 1 to 8.
The hyaluronic acid oligosaccharide is prepared by directly degrading hyaluronic acid by using the recombinant hyaluronidase for hydrolyzing hyaluronic acid beta-1, 4 glycosidic bonds, and has direct purpose. Firstly, the reducing end of the hyaluronic acid oligosaccharide obtained by the invention is N-acetylglucosamine, so that a hyaluronic acid oligosaccharide library prepared by bacterial source hyaluronic acid lyase and leech source hyaluronic acid hydrolase is perfected, and a foundation is laid for researching the structure-activity relationship of the hyaluronic acid oligosaccharide in academic circles; secondly, the reaction conditions of the invention are extremely simple, no requirements are made on instruments and equipment, the invention can be implemented at normal temperature and normal pressure, and the enzymolysis process does not need to add any organic reagent and does not generate any pollution waste; finally, the reaction system is acetic acid-sodium acetate buffer solution, and the hyaluronic acid oligosaccharide with high purity can be obtained through subsequent simple processes of deproteinization, nanofiltration desalination and spray drying, and has potential and wide application value in the fields of skin care products, health care products, oligosaccharide medicines and the like.
Drawings
FIG. 1 is a LCMS-IT-TOF mass spectrum total ion current peak diagram of hyaluronic acid hydrolysis product.
Figure 2 is a graph of the ionic strength of hyaluronic acid tetrasaccharide (HA 4).
Fig. 3 is a graph of the ionic strength of hyaluronic acid hexasaccharide (HA 6).
Fig. 4 is a graph of the ionic strength of hyaluronic acid octasaccharide (HA 8).
Figure 5 is a graph of the ionic strength of hyaluronic acid decasaccharide (HA 10).
Detailed Description
The present invention is further illustrated by the following examples, which are intended to be purely exemplary of the invention and are not intended to be limiting.
Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. Although methods and materials similar or equivalent to those described herein can be used in experimental or practical applications, the materials and methods are described below. In case of conflict, the present specification, including definitions, will control, and the materials, methods, and examples are illustrative only and not intended to be limiting. The present invention is further illustrated by the following examples, which are not intended to limit the scope of the invention.
Hyaluronic acid oligosaccharides (oligosaccharaides of HA, abbreviated as oligo-HA) having a molecular weight of 104An HA molecule fragment having a monosaccharide residue number of 2 to 25 (generally 4 to 16) below Da. oligo-HA belongs to a small molecule polysaccharide, and its properties are very different from those of ordinary HA. Research shows that Oligo-HA HAs biological activities of resisting oxidation, regulating immunity, resisting inflammation, promoting wound healing, promoting angiogenesis, resisting tumor, etc. More importantly, the small molecular size of the plant extract can permeate into the horny layer of the skin to play the effects of deep moisturizing and nourishing,can be widely applied to cosmetics.
The invention provides a method for preparing hyaluronic acid oligosaccharide by an enzyme method, which comprises the following steps: preparing a hyaluronic acid solution, and adding hyaluronidase into the hyaluronic acid solution for reaction to obtain hyaluronic acid oligosaccharide, wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID No. 3.
The hyaluronidase used in the invention is a hyaluronidase from Hydnocarpus dentatus, belongs to a third class of hyaluronidase, is endo-beta-N-acetylglucosaminidase, can hydrolyze beta-1, 4 glycosidic bonds of hyaluronic acid, and the reducing end of the generated final product is N-acetylglucosamine. In addition, compared with a second type of leech hyaluronic acid hydrolase, the enzyme has a wider substrate spectrum and has certain catalytic activity on chondroitin sulfate and dermatan sulfate structures. The Hymenaeus deltoides Hymenopterus hyaluronidase can enrich the variety of hyaluronic acid products, and can have a wider application range except for the catalysis of hyaluronidase.
The nucleotide sequence of the hyaluronidase is shown as SEQ ID NO.3, and the protein sequence coded by the hyaluronidase is shown as SEQ ID NO. 4. The nucleotide sequence shown in SEQ ID No.3 can be used in Pichia pastoris for the production of hyaluronidase. In a specific embodiment, the method of producing hyaluronidase using pichia pastoris comprises fermentative production of hyaluronidase using BMMY medium, methanol induction. Wherein the BMMY culture medium comprises yeast extract 10g/L, peptone 20g/L, and K2HPO43g/L，KH2PO4 11.8g/L，YNB 3.4g/L，(NH4)2SO410g/L, biotin 4X 10-4g/L and 10mL/L of methanol. In a preferred embodiment, the shake flask fermentation conditions are: the fermentation temperature is 25-30 ℃, 0.5-1% (v/v) methanol is supplemented every 24h in the fermentation process, and the induction expression is carried out for 96 h. The hyaluronidase of the invention has high expression level, and the activity of the hyaluronidase in the fermentation supernatant can reach 67970.04U/mL at the end of fermentation.
In a specific embodiment, the initial concentration of hyaluronic acid in the reaction system comprising the hyaluronidase and the hyaluronic acid solution is 20-80g/L, and may be, for example, 20g/L, 30g/L, 40g/L, 50g/L, 60g/L, 70g/L, or 80 g/L. For example, the reaction system formed by adding hyaluronidase to a solution of hyaluronic acid is 1L, with an initial content of hyaluronic acid of 20-80g, i.e., 20-80g when no hydrolysis occurs.
The hyaluronic acid solution may be formulated using various aqueous solutions. In a preferred embodiment, the hyaluronic acid solution is formulated with 20-100mM, pH 4.0-6.5 acetate-sodium acetate buffer. The subsequent purification process of the hyaluronic acid oligosaccharide can be simplified by preparing hyaluronic acid by using 20-100mM acetic acid-sodium acetate buffer solution with pH of 4.0-6.5.
In a specific embodiment, the molecular weight of hyaluronic acid is greater than or equal to 1 × 10 in the reaction system consisting of the hyaluronidase and the hyaluronic acid solution6Da may be, for example, 1X 106Da、1.5×106Da、2×106Da、2.5×106Da、3×106Da, etc. The molecular weight herein means a weight average molecular weight.
In a specific embodiment, the concentration of the hyaluronidase in the reaction system comprising the hyaluronidase and the hyaluronic acid solution is 3 × 103-1×105U/mL, for example, may be 3X 103U/mL、4×103U/mL、5×103U/mL、6×103U/mL、8×103U/mL、104U/mL、2×104U/mL、4×104U/mL、6×104U/mL、8×104U/mL、105U/mL. Wherein the definition of the activity unit of the hyaluronidase (U) is as follows: the amount of enzyme required to release 1. mu.g of glucose-reducing equivalent of reducing sugar from the hyaluronic acid sugar chains per hour under the conditions of pH 5.5 and 38 ℃.
In one embodiment, the reaction temperature is 20-65 ℃ and the reaction time is 0.5-8 h.
In a specific embodiment, the hyaluronic acid oligosaccharides comprise hyaluronic acid oligosaccharides with saturated N-acetylglucosamine at the reducing end. In a preferred embodiment, the hyaluronic acid oligosaccharides with a saturated N-acetylglucosamine at the reducing end include hyaluronic acid tetrasaccharides, hyaluronic acid hexasaccharides, hyaluronic acid octasaccharides and hyaluronic acid decasaccharides.
Wherein, the detection of the hyaluronic acid oligosaccharide product adopts a hydrolysate structure analysis method. The concrete conditions are as follows: product analysis was performed by LCMS-IT-TOF LC-MS of Shimadzu, using C18And (3) carrying out a chromatographic column, wherein mobile phases are acetonitrile and water, the flow rate is 0.2mL/min, the acetonitrile concentration is linearly increased to 12 percent and is reduced to 0 in 10 min. Mass spectroscopy was performed in negative ion mode, scanning every 10s, with m/z ranging from 100 to 1500. Multiple mass spectrometry analyses were performed under the same operating conditions.
The invention also provides a hyaluronic acid oligosaccharide composition, which comprises hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide and hyaluronic acid decasaccharide.
Examples
Example 1 Hyaluronidase Gene (Δ N24HYAL _ OM)opt) Construction of expression System
Chemically synthesized codon optimized hyaluronan hydrolase gene sequence (HYAL _ OM)opt) The sequence is shown in SEQ ID NO.1, and the coded amino acid sequence is shown in SEQ ID NO. 2. Will HYAL _ OMoptCloning to the position between EcoRI and NotI enzyme cutting sites of Pichia pastoris expression vector pPIC9K to obtain recombinant expression vector pPIC9K-HYAL _ OMopt. Recombinant expression plasmid pPIC9K-HYAL _ OMoptAfter being linearized by SalI fast-cutting enzyme, the recombinant gene is electrically transferred into a P.pastoris GS115 expression host cell, and the recombinant transformant is screened by geneticin G418 to obtain high-copy recombinant Pichia pastoris P.pastoris GS115/pPIC9K-HYAL _ OMopt。
With pPIC9K-HYAL _ OMoptThe recombinant expression vector is used as a template, a primer is designed, and a hyaluronidase gene sequence (HYAL _ OM) is cut offopt) Obtaining a section of signal peptide sequence at the N end to obtain a high-expression hyaluronidase gene (delta N24HYAL _ OM)opt) The sequence of the fragment is shown as SEQ ID NO.3, and the coded amino acid sequence is shown as SEQ ID NO. 4.
Wherein the primer sequences are as follows:
an upstream primer F: 5'-CCGGAATTCATGAAGACACTACGCGGCTC-3' (SEQ ID NO. 5);
a downstream primer R: 5'-ATTTGCGGCCGCTCAATGATGATGATGGTGGTGATGAAGGGTGAACTTCTT-3' (SEQ ID NO. 6);
it should be noted that the GAATTC sequence in the upstream primer is the introduced EcoRI restriction site, the GCGGCCGC sequence in the downstream primer is the introduced NotI restriction site, and the reverse complement of the ATGATGATGATGGTGGTG sequence in the downstream primer encodes the 6 XHis-tag.
Carrying out EcoRI and NotI double enzyme digestion on the gene fragment of the genetically engineered hyaluronic acid hydrolase obtained by amplification, cloning the gene fragment to a linear expression vector pPIC9K subjected to the same enzyme digestion treatment, transforming the gene fragment into E.coil TOP10, and obtaining a recombinant expression plasmid pPIC 9K-delta N24HYAL _ OM on the premise of ensuring that a reading frame does not shift framesoptAnd DNA sequencing comparison shows that the recombination sequence is correct. The recombinant plasmid is linearized by restriction endonuclease SalI and then electrically transferred into a P.pastoris GS115 cell, and the recombinant transformant is screened by geneticin G418 to obtain a recombinant strain P.pastoris GS115/pPIC 9K-delta N24HYAL _ OM with high-copy hyaluronidase geneopt。
Example 2 expression of hyaluronidase
The obtained recombinant engineering bacterium P.pastoris GS115/pPIC9K-HYAL _ OMoptAnd P.pastoris GS115/pPIC9K- Δ N24HYAL _ OMoptAnd respectively carrying out shake flask fermentation culture. The fermentation steps are as follows: a single clone was selected and inoculated into 40mL YPD medium (yeast extract 10g/L, peptone 20g/L, glucose 20g/L) and cultured at 30 ℃ and 200rpm for 24 hours. Transfer to 40mL of initial expression Medium BMGY (Yeast extract 10g/L, peptone 20g/L, K) at an inoculum size of 10%2HPO43g/L，KH2PO411.8g/L，YNB 3.4g/L，(NH4)2SO410g/L, biotin 4X 10-4g/L, glycerol 10mL/L), at 30 ℃ and 200rpm for 24 h. The cells were collected by centrifugation, washed with physiological saline and then replaced with 40mL of an inducible expression medium BMMY (yeast extract 10g/L, peptone 20g/L, K)2HPO4 3g/L，KH2PO4 11.8g/L，YNB 3.4g/L，(NH4)2SO410g/L, biotin 4X 10-4g/L, 10mL/L of methanol), culturing at 30 ℃ and 200rpm, adding pure methanol into the culture medium every 24h until the final concentration is 1.0% (v/v) for induction expression, and performing induction expression for 96 h.
And (3) after the fermentation is finished, determining the equivalent weight of reducing sugar generated by hydrolyzing hyaluronic acid by adopting a DNS method, and calculating the activity of the hyaluronic acid enzyme by taking analytically pure glucose as a standard curve. The reaction system is 1 mL: an appropriate amount of the fermentation supernatant (blank inactivated by boiling in an equal volume) was added to 800. mu.L of a 2mg/mL hyaluronic acid substrate solution, 1mL was made up with 50mM citric acid buffer (pH 5.5), incubated at 38 ℃ for 15min, and immediately after the reaction was completed, placed in a boiling water bath for 2min to inactivate the enzyme to terminate the reaction. Adding 1mL of the treated reaction solution into 2mL of DNS (potassium sodium tartrate tetrahydrate 248g/L, 3, 5-dinitrosalicylic acid 6.3g/L, 2M sodium hydroxide 250mL/L, phenol 5.136g/L and sodium sulfite 5g/L) solution, shaking and uniformly mixing, and carrying out boiling water bath with a glucose standard sample for 10 min; and cooling the mixture to room temperature in an ice water bath, adding 7mL of deionized water, oscillating and uniformly mixing, measuring absorbance at 540nm, converting the absorbance into the amount of reducing sugar generated by the reaction, and calculating the crude enzyme activity of the fermentation supernatant of the recombinant engineering bacteria according to a glucose standard curve.
The result shows that the recombinant strain P.pastoris GS115/pPIC9K-HYAL _ OMoptThe enzyme activity of the fermentation supernatant is 3547.88U/mL, and the recombinant strain PoptThe enzyme activity of the fermentation supernatant reaches 67970.04U/mL. This indicates that the hyaluronidase gene (DELTA N24HYAL _ OM) is highly expressedopt) Hyaluronidase gene (HYAL _ OM) optimized with respect to codonsopt) The expression capacity is improved by nearly 20 times, which is possible for the industrialized production of oligosaccharide by using an enzyme method.
Example 3 high Density expression of Hyaluronidase
The recombinant strain P.pastoris GS115/pPIC 9K-delta N24HYAL _ OMoptPerforming high-density culture in a 5-L fermenter. Inoculating a single colony on a YPD plate to 50mL of YPD liquid medium (yeast extract 10g/L, peptone 20g/L, glucose 20g/L),culturing at 30 deg.C and 220rpm for 24h, inoculating 10% culture solution into 200mL BMGY medium (yeast extract 10g/L, peptone 20g/L, K)2HPO4 3g/L，KH2PO4 11.8g/L，YNB 3.4g/L，(NH4)2SO410g/L, biotin 4X 10-4g/L, 10g/L of glycerol), and culturing at 30 ℃ and 220rpm for 24 hours; inoculating 200mL seed liquid cultured for 24h into fermentation medium containing 2L BSM (glycerol 40g/L, K)2SO4 18g/L，KOH 4.13g/L，85％H3PO4 26.7mL/L，CaSO4·2H2O 0.93g/L，MgSO4·7H2O14.9 g/L, 4.4mL/L filter-sterilized PTM 1; PTM1 formulation: CuSO4·5H2O 6g/L，KI 0.09g/L，MnSO4·H2O 3g/L，H3BO3 0.02g/L，MoNa2O4·2H2O 0.2g/L，CoCl2·6H2O 0.92g/L，ZnCl2 20g/L，FeSO4·7H2O65 g/L, biotin 0.2g/L, H2SO45.0mL) in a 5-L fermentor. Initial fermentation parameters are set as temperature 30 ℃, pH 5.5, ventilation 2.0vvm and rotation speed 500 rpm; controlling the pH value to be 5.5 by automatically adding ammonia water in the fermentation process; after the glycerol in the BSM medium is exhausted, the fed-batch phase is started, 50% (v/v) glycerol (containing 12mL/LPTM1) is added in an exponential feeding mode, meanwhile, the rotating speed is set to be coupled with dissolved oxygen DO, the feeding rate is respectively 13.5, 16.2, 19.2, 22.8, 27.2 and 32.4mL/h/L in the first 6h, and then the feeding rate of 6h is set to be 30 mL/h/L; after the material feeding is finished, entering a starvation culture stage, and carrying out starvation culture for 2-3h until the residual glycerol is exhausted; and (3) entering a methanol induction stage, feeding pure methanol containing 12mL/L PTM1 in a fed-batch manner, maintaining the final concentration at 1.8% (v/v), adjusting the fermentation temperature to 25 ℃, increasing the rotating speed to 1000rpm, and inducing for 88h, wherein the feeding rate of the methanol and the final concentration of the methanol in the culture medium are controlled by a methanol detector in real time on line.
The result shows that the hyaluronidase activity of the fermentation supernatant reaches 4.7 multiplied by 10 when the methanol is induced for 88 hours5U/mL, the expression level of enzyme activity or protein obtained by high-density fermentation is 6.97 times of that of shake flask fermentation, and the expression of hyaluronidase is further improvedAmount of the compound (A). The high hyaluronidase expression level provides a foundation for the industrial production of hyaluronic acid oligosaccharide.
Example 4 purification preparation of hyaluronidase
After the fermentation process of example 3 was completed, the fermentation broth was centrifuged under the following conditions: 11000rpm, 10min, 4 ℃. Collecting the supernatant, filtering with 0.22 μm filter membrane to remove particulate impurities, and ultrafiltering the obtained filtrate at low temperature. The molecular weight cut-off of the organic ultrafiltration membrane is 10kDa, the product enzyme molecules are in the cut-off liquid, and micromolecular impurities such as high-valence salt ions and the like are discharged along with the permeate liquid. And cooling the system by using circulating cooling water in the ultrafiltration process. Ultrafiltration tracking detection is carried out on the conductivity change of the trapped fluid, and when the conductivity of the trapped concentrated solution is not changed and the flow rate of the permeate is reduced, purified water with the same volume is added for dilution so as to facilitate permeation; repeatedly diluting for several times, stopping ultrafiltration when the electric conductivity of the trapped concentrate is lower than 500 μ s/cm, collecting trapped enzyme solution, and refrigerating in refrigerator for use. The activity of the purified hyaluronidase is 2.8 multiplied by 10 by the activity determination of the hyaluronidase ultrafiltration concentrated solution by a DNS method5U/mL。
Example 5 preparation of hyaluronic acid oligosaccharide
Hyaluronic acid oligosaccharide was prepared by hydrolyzing hyaluronic acid with the hyaluronidase ultrafiltration concentrate prepared in example 4.
The hyaluronidase ultrafiltration concentrate was added to 40g/L hyaluronidase solution to a final concentration of 6000U/mL. The reaction was carried out at 37 ℃ and 300rpm for 8 h.
After pretreatment of the sample obtained after 8h reaction, LCMS-IT-TOF analysis is carried out, and the types and molecular weights of negative ions of HA oligosaccharide after electrospray ionization (ESI) are shown in Table 1. The mass spectrum detection result is shown in FIG. 1, and mass spectrum peaks appearing at 3.75min and 4.05min on the total ion current peak diagram of the mass spectrum are in an anion mode [ M-H [ ]]-775.22, identified as hyaluronic acid tetrasaccharide (fig. 2); mass spectrum peaks appearing at 5.15min and 5.40min on the mass spectrum total ion current peak plot in the anionic mode [ M-H]-Is 1154.33, [ M-H ]]2-576.66, identified as hyaluronan hexasaccharide (FIG. 3); mass spectrum peak at anion appearing at 6.30min on the mass spectrum total ion current peak plotIn mode [ M-H]2-766.21, identified as hyaluronic acid octasaccharide (fig. 4); mass spectrum peaks appearing at 6.80min on the Mass Spectrometry Total ion Peak plot in anionic mode [ M-H]2-955.77, was analytically identified as hyaluronic acid decasaccharides (fig. 5).
TABLE 1 ESI anion species and molecular weight of HA oligosaccharides
Sequence listing
SEQ ID NO.1：
SEQ ID NO.2：
SEQ ID NO.3
SEQ ID NO.4：
SEQ ID NO.5：
CCGGAATTCATGAAGACACTACGCGGCTC
SEQ ID NO.6：
ATTTGCGGCCGCTCAATGATGATGATGGTGGTGATGAAGGGTGAACTTCTT
Sequence listing
<110> Huaxi Biotechnology Ltd
<120> method for preparing hyaluronic acid oligosaccharide by enzyme method
<130> TPE01628
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 1074
<212> DNA
<213> Artificial sequence
<220>
<223> artificially synthesized
<400> 1
atgatcccac ccgcacgtga ctcgcttatg tttgtctttg cgactgcggt aatcgctagt 60
tttttcggta gcgcaaagac actacgcggc tcttccccac agcaattcga cgtatactgg 120
aatgtgccaa ctttcatgtg tcacaagcac ggtatgaaat ttgaagagct gaaagatttc 180
ggtatacacc agaacgcaat ggatatgttt cgcggcgaag aaattgcgat tctttatgac 240
cctggcatgt ttcccgccct tctagtagat aaagatggat acgtcactaa acggaacggt 300
ggggtgccgc aagaggggaa cctcaaggaa catttagaaa cctttagaaa gcatctgacg 360
acacaaattc cggacgagag ctttagcggg ataggaatca tagactttga gagttggaga 420
ccgattttca ggcagaactg ggcgtcactc gagccctata aaactttgtc cataaagttg 480
gagagggaaa aacacccatt ttggtcggag gcagctgtga agaaggaggc caaacgtcga 540
ttcgagaaat ccgggcgaat atttatggag gaaaccctca aaatggccaa aaaactaaga 600
ccgaaagcaa agtggggcta ttatgggtat ccccactgtt tcaatcaaac ccctggacag 660
cagtcggttc actgcaatcg gcaaacgatg atggaaaatg acggtatgag ttggctgttt 720
acactcgaag acgttcatgc tcccagcgtt tacctacgat tggaaatcaa ggaggatgac 780
cggccttcat tcgtgaaagg ccgggtttcc gaggccttaa ggttagccgc taaatcgtct 840
tcaaaacaac gtatcctacc ttactactgg ttcatttatc aggataagaa ggatgagttc 900
ttaacggaaa aggatacaca aaacactata aatatgatcg ctaatctggg atctaatggt 960
ttcataattt ggggatctag tgacgatgtc aacacggaac gcaaatgcaa ggatttacag 1020
caatacgtaa aggaagtctt gggcccagcg attaagaagt tcacccttca ttga 1074
<210> 2
<211> 357
<212> PRT
<213> Artificial sequence
<220>
<223> artificially synthesized
<400> 2
Met Ile Pro Pro Ala Arg Asp Ser Leu Met Phe Val Phe Ala Thr Ala
1 5 10 15
Val Ile Ala Ser Phe Phe Gly Ser Ala Lys Thr Leu Arg Gly Ser Ser
20 25 30
Pro Gln Gln Phe Asp Val Tyr Trp Asn Val Pro Thr Phe Met Cys His
35 40 45
Lys His Gly Met Lys Phe Glu Glu Leu Lys Asp Phe Gly Ile His Gln
50 55 60
Asn Ala Met Asp Met Phe Arg Gly Glu Glu Ile Ala Ile Leu Tyr Asp
65 70 75 80
Pro Gly Met Phe Pro Ala Leu Leu Val Asp Lys Asp Gly Tyr Val Thr
85 90 95
Lys Arg Asn Gly Gly Val Pro Gln Glu Gly Asn Leu Lys Glu His Leu
100 105 110
Glu Thr Phe Arg Lys His Leu Thr Thr Gln Ile Pro Asp Glu Ser Phe
115 120 125
Ser Gly Ile Gly Ile Ile Asp Phe Glu Ser Trp Arg Pro Ile Phe Arg
130 135 140
Gln Asn Trp Ala Ser Leu Glu Pro Tyr Lys Thr Leu Ser Ile Lys Leu
145 150 155 160
Glu Arg Glu Lys His Pro Phe Trp Ser Glu Ala Ala Val Lys Lys Glu
165 170 175
Ala Lys Arg Arg Phe Glu Lys Ser Gly Arg Ile Phe Met Glu Glu Thr
180 185 190
Leu Lys Met Ala Lys Lys Leu Arg Pro Lys Ala Lys Trp Gly Tyr Tyr
195 200 205
Gly Tyr Pro His Cys Phe Asn Gln Thr Pro Gly Gln Gln Ser Val His
210 215 220
Cys Asn Arg Gln Thr Met Met Glu Asn Asp Gly Met Ser Trp Leu Phe
225 230 235 240
Thr Leu Glu Asp Val His Ala Pro Ser Val Tyr Leu Arg Leu Glu Ile
245 250 255
Lys Glu Asp Asp Arg Pro Ser Phe Val Lys Gly Arg Val Ser Glu Ala
260 265 270
Leu Arg Leu Ala Ala Lys Ser Ser Ser Lys Gln Arg Ile Leu Pro Tyr
275 280 285
Tyr Trp Phe Ile Tyr Gln Asp Lys Lys Asp Glu Phe Leu Thr Glu Lys
290 295 300
Asp Thr Gln Asn Thr Ile Asn Met Ile Ala Asn Leu Gly Ser Asn Gly
305 310 315 320
Phe Ile Ile Trp Gly Ser Ser Asp Asp Val Asn Thr Glu Arg Lys Cys
325 330 335
Lys Asp Leu Gln Gln Tyr Val Lys Glu Val Leu Gly Pro Ala Ile Lys
340 345 350
Lys Phe Thr Leu His
355
<210> 3
<211> 1020
<212> DNA
<213> Artificial sequence
<220>
<223> artificially synthesized
<400> 3
atgaagacac tacgcggctc ttccccacag caattcgacg tatactggaa tgtgccaact 60
ttcatgtgtc acaagcacgg tatgaaattt gaagagctga aagatttcgg tatacaccag 120
aacgcaatgg atatgtttcg cggcgaagaa attgcgattc tttatgaccc tggcatgttt 180
cccgcccttc tagtagataa agatggatac gtcactaaac ggaacggtgg ggtgccgcaa 240
gaggggaacc tcaaggaaca tttagaaacc tttagaaagc atctgacgac acaaattccg 300
gacgagagct ttagcgggat aggaatcata gactttgaga gttggagacc gattttcagg 360
cagaactggg cgtcactcga gccctataaa actttgtcca taaagttgga gagggaaaaa 420
cacccatttt ggtcggaggc agctgtgaag aaggaggcca aacgtcgatt cgagaaatcc 480
gggcgaatat ttatggagga aaccctcaaa atggccaaaa aactaagacc gaaagcaaag 540
tggggctatt atgggtatcc ccactgtttc aatcaaaccc ctggacagca gtcggttcac 600
tgcaatcggc aaacgatgat ggaaaatgac ggtatgagtt ggctgtttac actcgaagac 660
gttcatgctc ccagcgttta cctacgattg gaaatcaagg aggatgaccg gccttcattc 720
gtgaaaggcc gggtttccga ggccttaagg ttagccgcta aatcgtcttc aaaacaacgt 780
atcctacctt actactggtt catttatcag gataagaagg atgagttctt aacggaaaag 840
gatacacaaa acactataaa tatgatcgct aatctgggat ctaatggttt cataatttgg 900
ggatctagtg acgatgtcaa cacggaacgc aaatgcaagg atttacagca atacgtaaag 960
gaagtcttgg gcccagcgat taagaagttc acccttcatc accaccatca tcatcattga 1020
<210> 4
<211> 339
<212> PRT
<213> Artificial sequence
<220>
<223> artificially synthesized
<400> 4
Met Lys Thr Leu Arg Gly Ser Ser Pro Gln Gln Phe Asp Val Tyr Trp
1 5 10 15
Asn Val Pro Thr Phe Met Cys His Lys His Gly Met Lys Phe Glu Glu
20 25 30
Leu Lys Asp Phe Gly Ile His Gln Asn Ala Met Asp Met Phe Arg Gly
35 40 45
Glu Glu Ile Ala Ile Leu Tyr Asp Pro Gly Met Phe Pro Ala Leu Leu
50 55 60
Val Asp Lys Asp Gly Tyr Val Thr Lys Arg Asn Gly Gly Val Pro Gln
65 70 75 80
Glu Gly Asn Leu Lys Glu His Leu Glu Thr Phe Arg Lys His Leu Thr
85 90 95
Thr Gln Ile Pro Asp Glu Ser Phe Ser Gly Ile Gly Ile Ile Asp Phe
100 105 110
Glu Ser Trp Arg Pro Ile Phe Arg Gln Asn Trp Ala Ser Leu Glu Pro
115 120 125
Tyr Lys Thr Leu Ser Ile Lys Leu Glu Arg Glu Lys His Pro Phe Trp
130 135 140
Ser Glu Ala Ala Val Lys Lys Glu Ala Lys Arg Arg Phe Glu Lys Ser
145 150 155 160
Gly Arg Ile Phe Met Glu Glu Thr Leu Lys Met Ala Lys Lys Leu Arg
165 170 175
Pro Lys Ala Lys Trp Gly Tyr Tyr Gly Tyr Pro His Cys Phe Asn Gln
180 185 190
Thr Pro Gly Gln Gln Ser Val His Cys Asn Arg Gln Thr Met Met Glu
195 200 205
Asn Asp Gly Met Ser Trp Leu Phe Thr Leu Glu Asp Val His Ala Pro
210 215 220
Ser Val Tyr Leu Arg Leu Glu Ile Lys Glu Asp Asp Arg Pro Ser Phe
225 230 235 240
Val Lys Gly Arg Val Ser Glu Ala Leu Arg Leu Ala Ala Lys Ser Ser
245 250 255
Ser Lys Gln Arg Ile Leu Pro Tyr Tyr Trp Phe Ile Tyr Gln Asp Lys
260 265 270
Lys Asp Glu Phe Leu Thr Glu Lys Asp Thr Gln Asn Thr Ile Asn Met
275 280 285
Ile Ala Asn Leu Gly Ser Asn Gly Phe Ile Ile Trp Gly Ser Ser Asp
290 295 300
Asp Val Asn Thr Glu Arg Lys Cys Lys Asp Leu Gln Gln Tyr Val Lys
305 310 315 320
Glu Val Leu Gly Pro Ala Ile Lys Lys Phe Thr Leu His His His His
325 330 335
His His His
<210> 5
<211> 29
<212> DNA
<213> Artificial sequence
<220>
<223> artificially synthesized
<400> 5
ccggaattca tgaagacact acgcggctc 29
<210> 6
<211> 51
<212> DNA
<213> Artificial sequence
<220>
<223> artificially synthesized
<400> 6
atttgcggcc gctcaatgat gatgatggtg gtgatgaagg gtgaacttct t 51
Claims (10)
1. A method for preparing hyaluronic acid oligosaccharide by an enzymatic method, which is characterized by comprising the following steps:
preparing a hyaluronic acid solution,
adding hyaluronidase into the hyaluronic acid solution for reaction to obtain hyaluronic acid oligosaccharide,
wherein the nucleotide sequence of the hyaluronidase is shown as SEQ ID NO. 3.
2. The method according to claim 1, wherein the initial concentration of hyaluronic acid in the reaction system of hyaluronidase and hyaluronic acid solution is 20-80 g/L.
3. The method according to claim 1, wherein the molecular weight of the hyaluronic acid is 1 x 10 or more in the reaction system comprising the hyaluronidase and the hyaluronic acid solution6Da。
4. The method according to claim 1, wherein the concentration of the hyaluronidase is 1.5 x 10 in the reaction system comprising the hyaluronidase and the hyaluronic acid solution3-1×105U/mL。
5. The process according to claim 1, wherein the reaction temperature is 20-65 ℃ and the reaction time is 0.5-8 h.
6. The method according to claim 1, wherein the hyaluronic acid solution is formulated with 20-100mM acetate-sodium acetate buffer at pH 4.0-6.5.
7. The method of claim 1, wherein the hyaluronan oligosaccharide comprises a hyaluronan oligosaccharide having a saturated N-acetylglucosamine at the reducing end thereof.
8. The method of claim 1, wherein the hyaluronic acid oligosaccharides comprise hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide and hyaluronic acid decasaccharide.
9. A hyaluronic acid oligosaccharide composition, wherein the hyaluronic acid oligosaccharide composition comprises hyaluronic acid tetrasaccharide, hyaluronic acid hexasaccharide, hyaluronic acid octasaccharide and hyaluronic acid decasaccharide.
10. The composition of claim 9, which is prepared by the method of any one of claims 1 to 8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110937316.3A CN114350728B (en) | 2021-08-16 | 2021-08-16 | Method for preparing hyaluronic acid oligosaccharide by using enzyme method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110937316.3A CN114350728B (en) | 2021-08-16 | 2021-08-16 | Method for preparing hyaluronic acid oligosaccharide by using enzyme method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114350728A true CN114350728A (en) | 2022-04-15 |
| CN114350728B CN114350728B (en) | 2023-10-20 |
Family
ID=81095634
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110937316.3A Active CN114350728B (en) | 2021-08-16 | 2021-08-16 | Method for preparing hyaluronic acid oligosaccharide by using enzyme method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114350728B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115944549A (en) * | 2022-12-26 | 2023-04-11 | 华熙生物科技股份有限公司 | Hyaluronic acid oligosaccharide composition and preparation method and application thereof |
| WO2023056891A1 (en) * | 2021-10-09 | 2023-04-13 | 华熙生物科技股份有限公司 | Engineering yeast strain for producing hyaluronidase at high yield and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008174642A (en) * | 2007-01-18 | 2008-07-31 | Denki Kagaku Kogyo Kk | 4-sulfated hyaluronic acid |
| JP2011252115A (en) * | 2010-06-03 | 2011-12-15 | Hirosaki Univ | Manufacturing method of hybrid sugar chain |
| CN103484513A (en) * | 2013-10-22 | 2014-01-01 | 江南大学 | Method for preparing small-molecule oligomeric hyaluronic acid through enzyme method |
-
2021
- 2021-08-16 CN CN202110937316.3A patent/CN114350728B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008174642A (en) * | 2007-01-18 | 2008-07-31 | Denki Kagaku Kogyo Kk | 4-sulfated hyaluronic acid |
| JP2011252115A (en) * | 2010-06-03 | 2011-12-15 | Hirosaki Univ | Manufacturing method of hybrid sugar chain |
| CN103484513A (en) * | 2013-10-22 | 2014-01-01 | 江南大学 | Method for preparing small-molecule oligomeric hyaluronic acid through enzyme method |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2023056891A1 (en) * | 2021-10-09 | 2023-04-13 | 华熙生物科技股份有限公司 | Engineering yeast strain for producing hyaluronidase at high yield and use thereof |
| CN115944549A (en) * | 2022-12-26 | 2023-04-11 | 华熙生物科技股份有限公司 | Hyaluronic acid oligosaccharide composition and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114350728B (en) | 2023-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109295043B (en) | Alginate lyase, and preparation method and application thereof | |
| CN114350728B (en) | Method for preparing hyaluronic acid oligosaccharide by using enzyme method | |
| CN109897876B (en) | Method for preparing small molecular hyaluronic acid or salt thereof | |
| CN114901701A (en) | Ultra-low molecular weight hyaluronic acid and preparation method thereof | |
| CN106995811B (en) | A kind of algin catenase, preparation method and application | |
| CN107893061B (en) | Beta-1, 3-glucanase derived from rhizomucor miehei and application thereof | |
| RU2564566C2 (en) | K5 heparosan fermentation and purification | |
| US8614070B2 (en) | Process for the co-production of chitin, its derivatives and polymers containing glucose, mannose and/or galactose, by the fermentation of the yeast Pichia pastoris | |
| CN103484513A (en) | Method for preparing small-molecule oligomeric hyaluronic acid through enzyme method | |
| CN114350691B (en) | Gene for efficiently expressing hyaluronic acid hydrolase and expression method thereof | |
| CN110331178A (en) | A kind of enzyme cutting method prepares the method for micromolecule hyaluronic acid and gained micromolecule hyaluronic acid is applied with it | |
| CN114350639A (en) | Codon-optimized hyaluronidase gene and expression thereof | |
| CN110951714B (en) | Hyaluronic acid hydrolase, coding sequence thereof and method for preparing oligomeric hyaluronate by using same | |
| CN114350535A (en) | Engineering yeast strain for high yield of hyaluronidase and application thereof | |
| CN104178539B (en) | A kind of method of prepare with scale specified molecular weight micromolecule hyaluronic acid | |
| CN101294179A (en) | Method for preparing small-molecular weight hyaluronic acid by adding hyaluronate lyase in course of fermentation | |
| Hashimoto et al. | Polysaccharide lyase: molecular cloning, sequencing, and overexpression of the xanthan lyase gene of Bacillus sp. strain GL1 | |
| CN113603732B (en) | Non-animal chondroitin sulfate oligosaccharide and preparation method thereof | |
| CN100345868C (en) | Dermatan sulfate with low molecule and its preparing method | |
| CN113999830B (en) | Ocean-derived externally-tangent chondroitin sulfate sulfatase, and coding gene and application thereof | |
| CN115820766A (en) | Method for preparing chondroitin oligosaccharide by enzyme method and chondroitin oligosaccharide composition | |
| KR20150063057A (en) | Enzyme hyaluronan-lyase, method of production thereof, use thereof and method of preparation of low-molecular hyaluronan | |
| KR100551585B1 (en) | Method for preparing water-soluble oligosaccharide of glucuronic acid using gluconacetobacter hansenii pjk | |
| CN114807094B (en) | Chitosan SvChiAJ54 and encoding gene and application thereof | |
| CN114107248B (en) | Marine-derived endo-chondroitin sulfate sulfatase, and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |