CN114350686A

CN114350686A - Strawberry SL gene and application thereof

Info

Publication number: CN114350686A
Application number: CN202210171775.XA
Authority: CN
Inventors: 康春颖; 皮梦婷
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2022-02-24
Filing date: 2022-02-24
Publication date: 2022-04-15
Anticipated expiration: 2042-02-24
Also published as: CN114350686B

Abstract

The invention provides a strawberry SL gene and application thereof, wherein the strawberry SL gene can change strawberries from multiple leaves to single leaves, and increase variety and ornamental value. The SL gene function deletion can enable strawberries to have excellent properties of more blossoms, easy pollination, premature fruit and the like, and is beneficial to improving the yield.

Description

Strawberry SL gene and application thereof

Technical Field

The invention relates to the technical field of plant genes, in particular to a strawberry SL gene and application thereof.

Background

Strawberry is a perennial herb of the genus strawberry of the family Rosaceae. The strawberry has beautiful appearance, sweet and delicious taste, rich nutrition and the beauty of fruit queen. The modern cultivated strawberries all belong to the octaploid species Fragaria x ananassa, and are named as pineapple strawberries in Chinese. The strawberry genus contains more than 20 wild species, and the diploid wild species forest strawberry (Fragaria viscosa) is one of the ancestral species of the modern cultivated strawberry, and is often used as model material for gene function research.

The leaves are the main sites for photosynthesis of plants, and the growth and development of the leaves are directly related to the yield of crops, so the leaves are important nutritional organs. The natural leaves have various shapes, and are divided into two categories, i.e., single leaves and compound leaves according to whether the lobules are born. Most of the strawberry plants have three compound leaves, or 2 small leaves are grown on the petioles of the three compound leaves, namely five leaves. Nature has strawberries that produce single leaves, which later were found to be a variety of forest strawberries, named f. Although strawberry plants have single or multiple leaf divisions, our regulatory genes are still unclear.

Disclosure of Invention

Based on the above, a strawberry SL gene and application thereof are needed, wherein the SL gene can regulate and control the formation of single compound leaves of strawberries.

The invention adopts the following technical scheme:

the invention provides a strawberry SL gene, which can encode MYB-Like transcription factors of a GT-1 structural domain and a PKc conserved structural domain, and a CDS sequence of the MYB-Like transcription factor is shown IN SEQ IN NO. 1.

The invention also provides a protein coded by the strawberry SL gene, and the amino acid sequence of the protein is shown as SEQ IN NO. 2.

The present invention can also provide an expression vector containing the strawberry SL gene.

The strawberry SL gene, the protein coded by the strawberry SL gene and the expression vector containing the strawberry SL gene can be applied to the aspect of regulating and controlling single and multiple leaves of crops.

The strawberry SL gene, the protein coded by the strawberry SL gene and the expression vector containing the strawberry SL gene can be applied to the aspect of regulating and controlling the flowering quantity of crops.

The strawberry SL gene, the protein coded by the strawberry SL gene and the expression vector containing the strawberry SL gene can be applied to the aspect of regulating and controlling the premature ripening of the crop fruits.

The beneficial technical effects of the invention are as follows:

according to the invention, a single-leaf mutant simple leaf (sl1-1) of a gingko background (Yellow Wonder) and a single-leaf mutant simple leaf (sl1-2) of a red fruit background (Ruegen) are obtained through EMS artificial mutagenesis and screening, and the two mutants also have favorable properties of inflorescence increase, early flowering, strong pollination capability, fruit enlargement, early maturation, plant division increase and the like. Through fine gene mapping, the inventor group finds out mutant mutagenic gene SIMPLE LEAF (SL), and verifies that the single-leaf phenotype in the natural mutant population and the EMS artificial mutagenesis library is caused by the same gene and is recessive inheritance controlled by a single gene through an allele test experiment. These researches show that the SL gene is a key gene for regulating and controlling the formation of single and multiple leaves of the strawberry, and multiple favorable phenotypes are generated after the SL gene is knocked out, so that the SL gene has a good application prospect.

Drawings

FIG. 1 shows the leaf phenotypes of strawberry wild type YW and sl1-1, sl1-2, and the monophylla mutant; wherein, A: wild type YW and sl1-1, sl1-2 and the monopolylla mutant leaf, upper scale: 5 cm; a lower row of scales: 0.5 cm; b: carrying out statistics on the ratio of single and multiple leaves of wild type YW, sl1-1, sl1-2 and monophyllla mutant mature leaves; c: the development process of wild type YW and sl1-1 mutant leaves at different stages is observed by scanning electron microscopy, St represents a leaf-supporting, LP represents a lobular primordium, LL represents a lateral lobule, TL represents an apical lobule, Tr represents an epidermal hair, P1 represents the latest starting phyllo primordium, P2 represents the second latest starting phyllo primordium, and the scale: 50 μm.

FIG. 2 shows the flower and fruit phenotypes of strawberry sl1-1 mutant; wherein, A: wild type YW and sl1-1 mutant plants, side elevation, scale: 5 cm; b: counting the number of flowers in different periods (60d, 90d, 120d and 150d) after the wild YW and the sl1-1 mutant are transplanted into soil; c: floral organ phenotypic differences for wild-type YW and sl1-1 mutants, scale: 0.5 cm; d: statistics of the number of wild type YW and sl1-1 mutant floral organs (flower organ); e: observing the wild YW and sl1-1 mutant strains; f: counting the number of flowering plants of the wild YW and sl1-1 mutant; g: fruit ripening phenotype observation for wild type YW and sl1-1 mutant, scale: 0.5 cm; h: and counting the width of the receptacle of the wild YW and sl1-1 mutant fruits.

FIG. 3 shows the representative observation and background identification of the hybrid F1 of each mutant of strawberry; wherein, A: the sl1-1 mutant hybridized with the sl1-2 mutant and the mophylla mutant, respectively, for the F1 phenotype, scale: 5 cm; b: the sl1-1 mutant hybridized with the sl1-2 mutant and the mophylla mutant, respectively, for the F1 generation mature leaf dorsoventral phenotype, scale: 0.5 cm; c: the ratio statistics of the sl1-1 mutant, the sl1-2 mutant and the mophyllla mutant which are hybridized with F1 generation single and multiple leaves are respectively carried out; d: the sl1-1 mutant was identified by crossing the sl1-2 mutant and the mophyllla mutant, respectively, with F1 background.

FIG. 4 shows the genetic mapping of strawberry sl1-1, sl1-2, and the monopolylla mutant; wherein, A: mutant mutation sites of SL gene, B: SL gene amino acid structural analysis, C: SL gene evolutionary tree analysis.

FIG. 5 depicts the 35S SL transgenic T0 plant phenotype of strawberry; wherein, A: the expression level of SL gene in wild type and SL1-1, SL1-2, mophyllla, SL1-1SL1-2 and SL1-2SL1-1 mutants, B: SL-FLAG transgenic material molecular identification condition, C: SL-FLAG transgenic material transcription level identification condition, D: SL-FLAG transgenic material plant and leaf phenotype, E: 35S phenotype of SL-GFP transgenic material.

FIG. 6 is a map of strawberry 35S: SL-GFP expression vector.

Detailed Description

The present invention is further described in detail below with reference to specific examples so that those skilled in the art can more clearly understand the present invention.

The following examples are provided only for illustrating the present invention and are not intended to limit the scope of the present invention. All other embodiments obtained by a person skilled in the art based on the specific embodiments of the present invention without any inventive step are within the scope of the present invention.

In the examples of the present invention, all the raw material components are commercially available products well known to those skilled in the art, unless otherwise specified; in the examples of the present invention, unless otherwise specified, all technical means used are conventional means well known to those skilled in the art.

Sources of test materials:

diploid forest strawberry material is:

yellow Wonder (YW, gingko, no stolon, three-fold compound leaves, wild type, National Germplasma reproduction ID PI641092, reference Slovin, J.P., Schmitt, K., and Folta, K.M (2009). An incorporated line of the differential strain Fragaria vesca f.simplerflorens for genetic and molecular genetic students in the Rosaceae. plants EMS 5:15) and single-leaf mutant sl1-1 obtained by mutagenesis in the background thereof.

Ruegen (red fruit, no stolon, three compound leaves, wild type, purchased from The Strawberry Store (http:// The Strawberry system. com.) reference Sun J, Liu X, Yang T, Slovin J, Chen P.Profile polyphenols of two differential strand rows (Fragaria vesca) incorporated lines using UHPLC-HRMS (n.). Food chem.2014Mar 1; 146:289-98.doi:10.1016/J. foodchem.2013.08.089.) and EMS mutant sl1-2 obtained in The background thereof.

Hawaii4(YW, Ginkgo biloba, with stolons, three-leaf complex, wild type, National Germplasm reproduction ID PI551572) this material was used for stable genetic transformation of strawberries.

The forest strawberry natural mutant population, monophyllla (see figure 1A, B, ginkgo biloba, with stolons, single leaves, which was found in the 18 th century 60 s, duschen in the versalles plantations and named the newly discovered single-leaf strawberries as Versailles strawberries in the name of plantations, later discovered the Versailles strawberries as a variety of forest strawberries, eventually named f.vesca monophyllla, reference George m.darrow.the stre stberry.canada, Holt, riehart and Winston of canada.66-12155), was obtained from the university of maryland, university of lium.

Hybrid F1 generations of the single-lobe variant sl1-1 in the YW background and of the single-lobe variant sl1-2 in the Ruegen background.

The hybrid of the single-lobe mutant sl1-1 and the naturally mutated population, Monophylla, in the YW background, generation F1, was obtained from professor Liu Ji university of Maryland, USA.

The growth environment of all plant materials is illumination intensity of 100 μmol m^-2s^-1The photoperiod is 16h of light/8 h of dark, and the ambient temperature is 22 ℃.

Example 1 morphological analysis

In the embodiment, a single compound leaf phenotype with obvious characteristics is taken as an entry point, the main period of difference occurrence and the morphological difference of leaves between the sl1-1 mutant and the wild type single compound leaf are deeply researched by using experimental technologies such as a Scanning Electron Microscope (SEM) and the like on the leaves of the sl1-1 mutant and the wild type at different development periods. At the same time, the sl1-1 mutant and the wild type are observed to have phenotypic differences of flowers, fruits, inflorescences, flowering time and maturation time. Compared with the phenotype of the wild type three-Leaf complex, the leaves of the sl1-1 mutant and the sl1-2 mutant mostly show the phenotype of a single Leaf, and the phenotype of a few three-Leaf (Trifoliolate Leaf) or Fused complex Leaf (Fused Compound Leaf) (FIG. 1A). Counting the single-multiple leaf ratio of mature leaves of plants transplanted to soil in three months, wherein all mature leaves in the wild type show three multiple leaves, 10.6 percent of leaves in the sl1-1 mutant show three leaves or fused leaves, and the others show single leaves; in the sl1-2 mutant, the proportion of three leaves or fused compound leaves is only 2.9%. Whereas in the natural variant of monophyllla, the leaves all appear as a single leaf (FIG. 1B). There was no significant difference in the number of serrations at the leaf edges compared to the wild type.

In order to further analyze the generation period of the single and multiple leaf difference of the forest strawberry, the morphological analysis of the scanning electron microscope is carried out on each development period of the strawberry leaves. Leaf development mainly involves three stages: stage I, Initiation of leaf primordia (I), where the Shoot Apical Meristem (SAM) is functionally divided into two regions, the Central region (CZ) maintains the ability of Meristem to divide continuously, and lateral organ leaf primordia are initiated from a single cell mass in the Peripheral region (PZ) of SAM; stage II, Primary Morphology (PM) of the leaves is established, the leaf primordium extends outwards, the back-abdomen, middle-edge and base-top polarities are established, the most basic leaf shape is determined, and shallow sawteeth are formed along the leaf edges; stage III, Secondary Morphogenesis (SM), cell division growth, differentiation, generation of stomata, leaf epidermal hair and other characteristics typical of mature leaves. The results show that both the wild type and sl1-1 mutant leaf primordia are normally initiated in the SAM peripheral region during stage I of leaf development. In the second stage, the two leaflet primordia at the polar symmetric positions of the margin Marparent Blastone of the wild type leaves start to generate two symmetric lateral leaflets, and finally a basic leaf shape of three complex leaves is formed; whereas in the sl1-1 mutant the initiation of the leaflet primordium at the leaf margin was restricted, resulting in a structure with only apical leaflets. With the division and differentiation of leaf cells, both wild type and sl1-1 mutant can saw teeth at stage III, and epidermal hair is generated on the dorsoventral surface of the leaf to form a mature leaf. Carefully observing the development of epidermal hair, finding that leaf epidermal hair appears when the paraxial surface of the wild type leaf begins to differentiate, and then forming sawteeth at the edge of the leaf; while the sl1-1 mutant first jagged the leaf edges before the coat was produced in the paraxial plane, indicating that coat development was delayed in the sl1-1 mutant (FIG. 1C).

To explore the effect of delaying the development of epidermal hair, the developmental stages of cotyledons from wild type and sl1-1 mutant to mature leaves were analyzed in comparison. Wild type chinese strawberry leaf development goes through three processes: in the cotyledon period, two cotyledons germinate, the edges of the leaves are smooth, and no sawtooth is generated; in the young leaf period, true leaves germinate to generate 3-5 young leaves, the phenotype is single leaf, and 5-7 sawteeth appear on the edge of the leaf; in the mature leaf period, the conversion from young leaves to mature leaves is mainly shown as three compound leaves, a large amount of epidermal hairs appear on the epidermis of the leaves, the number of sawteeth is increased, and 10-18 sawteeth appear on the edges of the leaves. While two cotyledons can be normally formed in the cotyledon period of the sl1-1 mutant, the number of young leaves is increased to 4-6 in the young leaf period, and the young leaves are mainly shown as single leaves in the mature leaf period. The above results indicate that single-compound leaf differences occur during the primary morpho-genetic build-up period, without altering the morphology of individual leaves, leading to the production of single leaves by preventing the initiation of leaf-edge leaflet primordia.

Transplanting the wild material into soil for three months, starting to convert from vegetative growth stage to reproductive growth stage, growing inflorescence structure, wherein the inflorescence is a metamorphosis leaf, starting from clustered cells around stem tip Meristem (SAM), then further differentiating the inflorescence Meristem to generate Flower Meristem (FM), and finally developing into four-wheel Floral organs of flowers under the common regulation and control of external environment signals and organ characteristic genes.

Under the same growth environment and at the same growth period of 5 months, the inflorescence and the flower number of 15 wild-type YW and 15 sl1-1 mutants are counted respectively, and statistical analysis shows that the inflorescence and the flower number of the sl1-1 mutant are obviously higher than those of the wild-type at different periods (FIG. 2B). Wild-type strawberry flowers include typical four-flower organs: comprises 5 sepals, 5 petals, 20 stamens and a large number of unfused carpels attached to a domed receptacle from outside to inside. Statistics of the number of organs of the wild-type and mutant four rounds of flowers revealed that the number of petals II was significantly increased, whereas the number of stamens of round III was differentially decreased, while the number of sepals and carpels did not change significantly (FIGS. 2C, D), indicating that the SL gene regulates the transformation between homology and heterogeneity between organs of flowers of rounds II and III.

In YW strawberry (gingko, without stolons), axillary buds exist at each axillary part of each leaf, the axillary buds can keep dormant, one to two axillary buds at the most basal part can grow into new branches after the dormancy is broken preferentially, and new inflorescence meristem can be formed beside the new branches. While the higher number of axillary buds in the sl1-1 mutant broke dormancy and developed into new branches, more inflorescences and flowers were formed, and the plant type was significantly changed (FIG. 2E).

Statistics on the flowering time of the mutant sl1-1 show that the flowers of part of the plants begin to open after 84 days of transplanting into the soil, and most of the plants open at 102 days. Whereas in wild type, flowers began to open only a few plants at 94 days and flower opening for the majority of plants was achieved at 114 days (FIG. 2F), suggesting that early flowering is promoted in the sl1-1 mutant.

The receptacle is the main edible part of the strawberry, and the transverse diameters of the receptacles at different developmental stages of the wild type and mutant fruit maturity are counted: there was no significant difference in the cross-sectional diameter of the mutant receptacle after pollination for 14 days compared to the wild type receptacle, whereas the mutant receptacle diameter increased significantly at 21 days, continuing to maintain an increasing trend and reaching maturity at 24 days (this period corresponds to the color transition period against the background of Ruegen red fruit) (fig. 2G, H). This result indicates that the SL gene negatively regulates the development of strawberry flowers and fruits.

Example 2 allele assay

In this example, the single-leaf mutant sl1-1 in strawberry YW background and the single-leaf mutant sl1-2 in Ruegen background were backcrossed with each other to obtain generation F1. Mature leaves of the F1 generation population all present a single-leaf (the proportion of the mature single leaves accounts for 91.5 percent) phenotype, the fruit color turns red, and the leaf edge is not obviously changed by saw teeth.

Meanwhile, the single-leaf mutant sl1-1 in YW background is taken as a male parent, the natural mutation population mophyllla is taken as a female parent for hybridization, F1 generations are obtained in sequence, and the single-leaf phenotype of the F1 generations is observed. Mature leaves of the population of hybrid F1 appeared as single leaves (mature single leaf ratio of 95%), ginkgo biloba, and stolon phenotype (FIG. 3A), indicating that single-leaf mutants in different backgrounds were caused by the same mutagenic gene.

Example 3 genetic analysis

In order to reduce the influence of background SNP, backcross is carried out by taking the sl1-1 mutant as a female parent and taking the wild forest strawberry YW as a male parent to obtain a BC1F1 generation group compound leaf phenotype, a BC1F2 generation single compound leaf separation group is obtained after selfing, and the separation ratio of the sl1-1 single leaf mutant and the wild type compound leaf in the separation group is counted. The segregation ratio of the sl1-1 single-leaf mutant and the wild type compound leaf in the statistic segregation population is 48:150 (chi)²＝0.06，χ^{2 0.05}3.84), indicating that the phenotype of the single-leaf mutant is a single-gene-controlled recessive mutation.

Example 4 Gene mapping

A mixed pool genome re-Sequencing technology (Mapping-by-Sequencing) is applied, a BC1F2 generation population is divided into a mutant group and a wild type group according to the phenotype difference of single-leaf compound leaves, tender leaves of 20 plants of materials are respectively selected for equal sampling in each group, the samples are mixed and ground, then a CTAB method is adopted to extract genomes, the DNA quality of the genomes is detected through agarose gel electrophoresis, after the samples are qualified, the samples are entrusted to Beijing Nuo grass biotechnology limited company to carry out double-end library construction and Sequencing by adopting Illumina HiSeq X Ten platform, and after the Sequencing is finished, the data volume of 150bp double-end small fragments which is 8G in total can be obtained. Sequencing data were analyzed by bioinformatics method, reads obtained by sequencing were aligned to forest strawberry second edition (V2.0) genome using Bowrie2, and then SNPs were searched by samtools.

The following principles were followed in the process of locating candidate SNPs: (1) the pattern of variation of SNPs is G to A or C to T; (2) the SNP homozygosity rate in the mutant pool is 100 percent, and the SNP of the site in the wild pool is less than 50 percent; (3) since artificial mutagenesis is random, SNPs are not present in other mutants; (4) the preference for localization in the coding region and causing premature termination or variable splicing of translation is followed by consideration of the UTR region or intron region.

Through gene mapping, the mutation site of the SL1-1 mutant was found to be located on chromosome 7, and the mutagenic gene was gene13363 (mutagenesis ver1.1)/FvH4_7g28640 (mutagenesis ver4.2), which was named SIMPLE LEAF (SL). The SL gene was prematurely terminated at amino acid 502 in the SL1-1 mutant, at amino acid 618 in the SL1-2 mutant, and at the second exon of the monopolylla mutant by an eight base (GTTCATCA) insertion (FIG. 4A).

CDS sequence of SL gene

ATGGGTGAAACCAAAGGAGATAACCCCAACATACAGCACCAACAACCACAACAAACTCAGCAGCACCAGCAAATTTCAACCTCTCCAAATGATCCTCTTGAAGAAGCATCACCGTTAACGGTAGCTGTGACCGGAGCTACTGCTCCCTTTAACATTCCTGCTCCATTGTATGTTCCAATCAGTGGTGCAACATCTTCTTCATTGCCTTTTGATCAATCACAATTTGAGGCCGTGAATCCCAAGAGACCTAGATACACCAGTACTGGGCAATGGAAGCTTCTACCATCCCCATCTTCCCAACAAAAACAGACTCCTACCCAAACTACCGGAGCTTCTTCCTCCGATACAGCCTCATCCCCACCTCACTCTCCTCTCCCGTCTCTCTCCGCAACCTCAGGCCAAGACACAACGAAAACAGAAGGAGAAGAACAAAACCCATCTCTTCACCGCAGTCAGTTCCGAAGAGGCAAGTATGTCAGTCCGGTTTGGAAGCCCCACGAGATGTTGTGGCTAGCCAAGGCTTGGAGGGCTGTTTATCAAAGCCAAGGCTCAGAACACCACTCAGATATCACTGGTCAACCCACCAGAGCCAAAACAAGGGCTGATAAGGACAGGGAAGTTGCCGAGTTTCTTCAGAAGAATGGGATCAACCGAGACGCGAAAACAGCCGGTACGAAATGGGATAACATGCTGGGAGAGTTTCGAAAAGTCTATGAGTGGGAAAGAGGAGCTGATAGAGAACAAGTTGGGAACAAGAGCTATTTCAGGCTTTCTCCTTACGAGAGGAAGCTTCACAGATTGCCTGCTTCTTTTGACGAAGAGGTATTTGATGAGCTCGCACAGTTTATGGGGTCTAGAATGAGGACTCCTCCGATCAGCAGAGCTGCTGATAGCACACGGTCACAATCTCTTTATGTCACCACAAGTAGTGTTTTGCCACAACCACCTTCTTTCAGAGAAGAAGACCTCCCTAACTCAGGTAGGGCAAGGCAGCTAATGATCATGACCGGTGGTGGGGAAGGACCTTTTTACCCCAGATCGGGAAGCTTGTTAGGGTTTGATCATCTACCTCACTATCATCACCAGTCTTCACTAGACTACGTTGCAGGTGTCTCTTCATCGACGTCTTTGACGAAGGAGCTTCGTCGAATTGGGAAGATTCGGATGACATGGGAAGAATCTGTTAGTTTGTGGGGTGAAGAAGGTGAGCACCACCGTGGGAGGATCAAGATTCAAGGCGGCTCAAGCTTCTTGAATGCGGACGAGCTTGCTTACTTTGACGATTCCCTGGTCGCCTGCACCATGGAAGCTTTCGAAGATGGCCCTTTTAGAGGTTTCTCTGTTGATCGTTTTGTGTCTGGTCAACAAGTCAAGGTCTTTGGCAGACGAAAGCCATCTACTCCAGGCTTCTCAAAGAAGACCCTTCCGTTTGCTGAATCCTCTATAAGATCAATGCCTCCATGGGAGTTTCAAGACCCAAGTGAATACTACATCACTTGTCTTCGAGTTCCACCCCAATCGCTTCCACGCTTATCGGACCTTTCAAGCTACTTGCTACAGCCACCGCCTGAGGAGTTCCGATTTCCACTCCGGAAAGACGTTTACCGGGACTTGCCACCGGGGAGAGAGAGTTTCTTCACTACATCAAATGATTTGCTGGATTGTAGAGCCATCACGTACGATATTGTAAGCACCATTATTCGAAGCAACTATGGTATTGGTGCTACCACTAGTAGGGACTCCTTCATTGGCCTTTGGGATGACTGCATCAATAGGTTCGTCTCCAAGTTTTGTTGTGTCGACATGGTCTTCGTTCGAAAGGCTACATCTTCAATATCAACAACTGAAGCTTTGCAAGACCAATGGCCAAATGTGACGGGGTTTGTGAAAAACTTTTGTTTGTGGAGAGGGGAAGAGACAGATCAAGTTAGAGAAGGTCACATTCATCCTTCCAAATCATTAGTGGAGAAACTTCAATGGACGTATACCGATCTTCCTTATATTTTCGGGTACTATTCTATAGGTAGTTTGGTCACATTCTGTGCTCTAAGTAAAGGAGGACAAGATCAAGTTATTCAGACTAACTTACAGACGCTTGATCAATCTTTGCCGTCGGATAGACTGAAAGCCCTAGTCCTGTGTTACAGAGTTGCTGGATTATTGCCCTTGCTAGCTGATAGATGCTTAAACATGATCCACAGCGGGACTACTAGTACTAGCAACGGGGGTGCTCCAAGTTACAAGTTTATGCTACTTCCTTACAGTGATTTTGAGAGGGTTGATTTGCGTAACGGGAATATTGTTGAGCTGACCCCAAATACAGTGACCAGATTTTTCTCCAACCAAAGAAAGTGGTCAGCGGTCAAAGAAATCTACGACTTCCTTGATCACAGAATACCCCATGCAGAGTGTATTCACAGGTCGTCGGAGAAAGACTTGGCCTTGGTTTTCAAGCCAAGAGGGTGCAAATTCAAGCCAAGAAACTGCGACGAGCTCGTGGAGGCGCTCAAGTACGTGACCAAAGCTCTGGTGGCACTGCACGACTTGTCGTTCATGCACAGGGACATAGGGTGGGACAAAGTGATGAGGAGCACGGAGAGGGACAACGAGTGGCTCCTTTGTGGGTTCGACGAGGCAGTTGGTGCACCACAGCTGAATCCGTACTCGGTTGCTGCGGCGGAGCGTGGCGAACACGCGCCGGAGCTGGAGAGGGCGTTGCATGGGGTGAAAGTGGACGTGTGGGGTGTGGGACACCTGGTGAGGAGTTGTGGGTTGGCAGGTGTGCCAAAGATGCTGAGGGAGCTCCAGAATCGGTGTTTGGAACAAAACCCAGAGCTTAGGCCAACTGCGGCCGAATGCTACCACCACCTGCTTCAGCTCCAGTCGTCACTGTCGGTTGTCACCGCCATGATGTGA(SEQ IN NO.1)

Coding sequence of SL gene protein

MGETKGDNPNIQHQQPQQTQQHQQISTSPNDPLEEASPLTVAVTGATAPFNIPAPLYVPISGATSSSLPFDQSQFEAVNPKRPRYTSTGQWKLLPSPSSQQKQTPTQTTGASSSDTASSPPHSPLPSLSATSGQDTTKTEGEEQNPSLHRSQFRRGKYVSPVWKPHEMLWLAKAWRAVYQSQGSEHHSDITGQPTRAKTRADKDREVAEFLQKNGINRDAKTAGTKWDNMLGEFRKVYEWERGADREQVGNKSYFRLSPYERKLHRLPASFDEEVFDELAQFMGSRMRTPPISRAADSTRSQSLYVTTSSVLPQPPSFREEDLPNSGRARQLMIMTGGGEGPFYPRSGSLLGFDHLPHYHHQSSLDYVAGVSSSTSLTKELRRIGKIRMTWEESVSLWGEEGEHHRGRIKIQGGSSFLNADELAYFDDSLVACTMEAFEDGPFRGFSVDRFVSGQQVKVFGRRKPSTPGFSKKTLPFAESSIRSMPPWEFQDPSEYYITCLRVPPQSLPRLSDLSSYLLQPPPEEFRFPLRKDVYRDLPPGRESFFTTSNDLLDCRAITYDIVSTIIRSNYGIGATTSRDSFIGLWDDCINRFVSKFCCVDMVFVRKATSSISTTEALQDQWPNVTGFVKNFCLWRGEETDQVREGHIHPSKSLVEKLQWTYTDLPYIFGYYSIGSLVTFCALSKGGQDQVIQTNLQTLDQSLPSDRLKALVLCYRVAGLLPLLADRCLNMIHSGTTSTSNGGAPSYKFMLLPYSDFERVDLRNGNIVELTPNTVTRFFSNQRKWSAVKEIYDFLDHRIPHAECIHRSSEKDLALVFKPRGCKFKPRNCDELVEALKYVTKALVALHDLSFMHRDIGWDKVMRSTERDNEWLLCGFDEAVGAPQLNPYSVAAAERGEHAPELERALHGVKVDVWGVGHLVRSCGLAGVPKMLRELQNRCLEQNPELRPTAAECYHHLLQLQSSLSVVTAMM(SEQ IN NO.2)

The candidate SNPs were amplified by Polymerase Chain Reaction (PCR) and the amplified fragments were subjected to Sanger sequencing, which further confirmed that the mutation sites were homozygous in the segregating populations of single-leaf mutants of generations 48 BC1F2, 20 BC2F2 and 10 BC3F2, while allelic mutants of different mutation sites (sl1-1, sl1-2, monophyllla) indicated that the mutation sites were linked to the single-leaf phenotype.

Sequence alignment analysis found that the SL gene encodes a MYB-Like transcription factor with GT-1 and PKc conserved domains (FIG. 4B), and no function was reported in strawberry. The evolutionary tree analysis found that the SL protein has fewer homologous genes in other species, and the results are relatively conservative, and most functions are not reported (FIG. 4C).

Example 5 construction of SL Gene expression vector and verification of genetic transformation

Quantitative results show that the expression level of SL gene is reduced in SL1-1, SL1-2, mophyllla, SL1-1SL1-2 and SL1-2SL1-1 mutants. SL-GFP overexpression vector to wild strawberry Hawaii4(H4), H4 wild background forest strawberry CDS sequence as template, PCR amplification to obtain target fragment, construction of vector according to the onestrep method (Vazyme, Clonexpel II One Step Cloning Kit), cleavage linearization of pRI101 vector plasmid with KpnI/SalI (NEB), primer sequence:

SL-OX-F：

TCTTCACTGTTGATACATATGATGGGTGAAACCAAAGGAGATAAC

SL-OX-R：

GCCCTTGCTCACCATGAATTCCATCATGGCGGTGACAACCGACAG

after obtaining the pRI101 vector integrated with SL gene, stable transformation of forest strawberry is carried out to obtain transgenic plants.

1. Stabilizing and transforming forest strawberries: the MS used in the following procedure was M404 Murashige & Skoog Modified basic Medium with Gamma Vitamins (Phototech, M404-100L) from Western Mejed, Beijing, using Agrobacterium-mediated transformation of forest strawberry callus. Wherein 1/2MS is 1/2 with the addition amount being the instruction concentration of the instruction book, and the specific operation steps are as follows:

1) preparation of sterile seedlings

Putting the seeds of forest strawberries into an EP (EP) tube, adding 75% alcohol, soaking for 5min (shaking), washing with sterile water for 4-5 times, removing the alcohol, adding 2% sodium hypochlorite, adding a drop of Tween20, soaking for 5min (shaking), washing with sterile water for 3-4 times, sowing the seeds on a culture dish containing 1/2MS culture medium (1/2MS2.22g/L + sucrose 20g/L + agar 7g/L, pH5.8), culturing in the dark at 4 ℃ for two weeks, transferring to a tissue culture room for germination, and transferring to a bottle of 1/2MS for later use when 2 true leaves grow out.

2) Culturing callus

In a clean bench, the leaves of the aseptic seedlings are cut off by scissors, placed on a sterilized empty dish, cut into a plurality of small pieces (each small piece of leaves is cut 3 times) by a scalpel, placed on a 5+ + culture medium (MS4.44g/L, 20g/L of sucrose, 7g/L of agar, 0.3mg/L of indolebutyric acid and 3.4mg/L of 6-benzylaminopurine, pH5.8), placed on each plate for about 20 pieces, the front surfaces of the leaves face downwards, and dark-cultured at 22 ℃ for 15-30d until the cut grows out of the callus.

3) Preparation of bacterial liquid

Dipping the bacterial liquid preserved at the temperature of minus 80 ℃ on a solid LB culture medium (yeast extract 5g/L + peptone 10g/L + NaCl 10g/L + agar 15g/L + gentamicin 50 ug/mL + rifampicin 50 ug/mL + spectinomycin 50 ug/mL) containing resistance, streaking and activating the agrobacterium at the temperature of 28 ℃ for 2-3 days, selecting a monoclonal bacterial plaque and 6mL liquid LB culture medium (yeast extract 5g/L + peptone 10g/L + NaCl 10g/L + gentamicin 50 ug/mL + rifampicin 50 ug/mL + spectinomycin 50 ug/mL), shaking at the temperature of 28 ℃ overnight, and carrying out PCR to identify the positive bacterial liquid.

4) Transformation of

Pouring the bacterial liquid into a 2mL centrifuge tube, taking a 3-4 tube, centrifuging at 8000rpm for 2min, discarding the supernatant, taking 1mL Co-buffer (MS4.44g/L + sucrose 20g/L, pH5.8) to resuspend the bacterial liquid, adding into a triangular flask containing 25mL Co-buffer, adding 250 μ L Acetosyringone (AS) solution with the concentration of 50mg/mL, shading and shaking for 3h at room temperature, adding 3 plates of callus, shading and shaking for 0.5-1h at room temperature, cleaning the callus for 1 time by sterile water, clamping onto filter paper by tweezers, sucking the water to dry, placing on a 5+ + culture medium, placing the leaf with the front face facing downwards, placing into an incubator, and shading and Co-culturing for 3 d.

5) Cleaning callus

After 3 days of co-culture, part of the callus was inoculated with Agrobacterium, the callus was clamped in a triangular flask containing sterile water, washed 2-3 times, blotted with filter paper, placed on CT medium (MS4.44g/L + sucrose 20g/L + agar 7g/L + indolebutyric acid 0.3mg/L + 6-benzylaminopurine 3.4mg/L + carbenicillin 250mg/L + timentin 250mg/L, pH5.8), placed in an incubator for 1 week and then cultured under normal culture conditions (incubator: 16 hours of light, 22 ℃, 8 hours of dark, 19 ℃).

6) Subculture

After 2 weeks of culture on CT medium, the calli were transferred to a resistant medium (MS4.44g/L + sucrose 20g/L + agar 7g/L + indolebutyric acid 0.3mg/L + 6-benzylaminopurine 3.4mg/L + carbenicillin 250mg/L + timentin 250mg/L + kanamycin 5mg/L, pH5.8), after which the medium was changed every 2 weeks to one month until callus differentiated to shoots.

7) Rooting culture

After the generation of the shoots healed, the shoots were excised from the tissue and transferred to a rooting medium (1/2MS2.22g/L + glucose 20g/L + agar 7g/L + indolebutyric acid 0.1mg/L + carbenicillin 200mg/L + timentin 200mg/L + kanamycin 5mg/L, pH5.8) for cultivation until they were rooted.

2. Identification of transgenic material: first, the transgenic plant is subjected to genomic DNA level identification, and a fragment containing the vector sequence and SL gene, or a fragment spanning the intron sequence, is obtained by PCR amplification. Secondly, the transcription level is identified, qRT-PCR is utilized to measure the expression quantity of SL gene of transgenic plant, and the used PCR primers are as follows:

pRI101-F:CTGACGTAAGGGATGACGCACAAT

SL-R:ACTCTCCCAGCATGTTATCCCA

SL-qRT-F:ATGCCTCCATGGGAGTTTCA

SL-qRT-R:TTTCCGGAGTGGAAATCGGA

the results showed that 6 independent forest strawberry overexpression mutants (L1-6) were obtained in the 35S: SL-Flag transgenic T0 generation. Performing genome DNA level identification on the transgenic plant, and performing PCR amplification to obtain a segment containing a vector sequence and an SL gene, wherein the band is consistent with the positive control (FIG. 5B); and secondly, identifying the transcription level of the gene, and measuring the expression quantity of the SL gene of the transgenic plant by utilizing qRT-PCR (quantitative reverse transcription-polymerase chain reaction), wherein the result shows that the expression quantity is all up-regulated (figure 5C), which indicates that the cloning of the transgenic material is correct. Observation of the T0 phenotype revealed premature senescence of leaves, but no altered phenotype of leaf-renaturation (FIG. 5D), as well as poor pistil fertility and reduced seed set. At the same time, a 35S: SL-GFP vector is constructed, and the phenotype that three leaves are changed into five leaves besides leaf senescence is found, the compound leaf property is obviously increased (figure 5E), which shows that the single-leaf phenotype is caused by SL gene function loss, and the SL gene is disclosed to promote the compound leaf development in the leaf development process.

It should be noted that the above examples are only for further illustration and description of the technical solution of the present invention, and are not intended to further limit the technical solution of the present invention, and the method of the present invention is only a preferred embodiment, and is not intended to limit the protection scope of the present invention. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> university of agriculture in Huazhong

<120> strawberry SL gene and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2916

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgggtgaaa ccaaaggaga taaccccaac atacagcacc aacaaccaca acaaactcag 60

cagcaccagc aaatttcaac ctctccaaat gatcctcttg aagaagcatc accgttaacg 120

gtagctgtga ccggagctac tgctcccttt aacattcctg ctccattgta tgttccaatc 180

agtggtgcaa catcttcttc attgcctttt gatcaatcac aatttgaggc cgtgaatccc 240

aagagaccta gatacaccag tactgggcaa tggaagcttc taccatcccc atcttcccaa 300

caaaaacaga ctcctaccca aactaccgga gcttcttcct ccgatacagc ctcatcccca 360

cctcactctc ctctcccgtc tctctccgca acctcaggcc aagacacaac gaaaacagaa 420

ggagaagaac aaaacccatc tcttcaccgc agtcagttcc gaagaggcaa gtatgtcagt 480

ccggtttgga agccccacga gatgttgtgg ctagccaagg cttggagggc tgtttatcaa 540

agccaaggct cagaacacca ctcagatatc actggtcaac ccaccagagc caaaacaagg 600

gctgataagg acagggaagt tgccgagttt cttcagaaga atgggatcaa ccgagacgcg 660

aaaacagccg gtacgaaatg ggataacatg ctgggagagt ttcgaaaagt ctatgagtgg 720

gaaagaggag ctgatagaga acaagttggg aacaagagct atttcaggct ttctccttac 780

gagaggaagc ttcacagatt gcctgcttct tttgacgaag aggtatttga tgagctcgca 840

cagtttatgg ggtctagaat gaggactcct ccgatcagca gagctgctga tagcacacgg 900

tcacaatctc tttatgtcac cacaagtagt gttttgccac aaccaccttc tttcagagaa 960

gaagacctcc ctaactcagg tagggcaagg cagctaatga tcatgaccgg tggtggggaa 1020

ggaccttttt accccagatc gggaagcttg ttagggtttg atcatctacc tcactatcat 1080

caccagtctt cactagacta cgttgcaggt gtctcttcat cgacgtcttt gacgaaggag 1140

cttcgtcgaa ttgggaagat tcggatgaca tgggaagaat ctgttagttt gtggggtgaa 1200

gaaggtgagc accaccgtgg gaggatcaag attcaaggcg gctcaagctt cttgaatgcg 1260

gacgagcttg cttactttga cgattccctg gtcgcctgca ccatggaagc tttcgaagat 1320

ggccctttta gaggtttctc tgttgatcgt tttgtgtctg gtcaacaagt caaggtcttt 1380

ggcagacgaa agccatctac tccaggcttc tcaaagaaga cccttccgtt tgctgaatcc 1440

tctataagat caatgcctcc atgggagttt caagacccaa gtgaatacta catcacttgt 1500

cttcgagttc caccccaatc gcttccacgc ttatcggacc tttcaagcta cttgctacag 1560

ccaccgcctg aggagttccg atttccactc cggaaagacg tttaccggga cttgccaccg 1620

gggagagaga gtttcttcac tacatcaaat gatttgctgg attgtagagc catcacgtac 1680

gatattgtaa gcaccattat tcgaagcaac tatggtattg gtgctaccac tagtagggac 1740

tccttcattg gcctttggga tgactgcatc aataggttcg tctccaagtt ttgttgtgtc 1800

gacatggtct tcgttcgaaa ggctacatct tcaatatcaa caactgaagc tttgcaagac 1860

caatggccaa atgtgacggg gtttgtgaaa aacttttgtt tgtggagagg ggaagagaca 1920

gatcaagtta gagaaggtca cattcatcct tccaaatcat tagtggagaa acttcaatgg 1980

acgtataccg atcttcctta tattttcggg tactattcta taggtagttt ggtcacattc 2040

tgtgctctaa gtaaaggagg acaagatcaa gttattcaga ctaacttaca gacgcttgat 2100

caatctttgc cgtcggatag actgaaagcc ctagtcctgt gttacagagt tgctggatta 2160

ttgcccttgc tagctgatag atgcttaaac atgatccaca gcgggactac tagtactagc 2220

aacgggggtg ctccaagtta caagtttatg ctacttcctt acagtgattt tgagagggtt 2280

gatttgcgta acgggaatat tgttgagctg accccaaata cagtgaccag atttttctcc 2340

aaccaaagaa agtggtcagc ggtcaaagaa atctacgact tccttgatca cagaataccc 2400

catgcagagt gtattcacag gtcgtcggag aaagacttgg ccttggtttt caagccaaga 2460

gggtgcaaat tcaagccaag aaactgcgac gagctcgtgg aggcgctcaa gtacgtgacc 2520

aaagctctgg tggcactgca cgacttgtcg ttcatgcaca gggacatagg gtgggacaaa 2580

gtgatgagga gcacggagag ggacaacgag tggctccttt gtgggttcga cgaggcagtt 2640

ggtgcaccac agctgaatcc gtactcggtt gctgcggcgg agcgtggcga acacgcgccg 2700

gagctggaga gggcgttgca tggggtgaaa gtggacgtgt ggggtgtggg acacctggtg 2760

aggagttgtg ggttggcagg tgtgccaaag atgctgaggg agctccagaa tcggtgtttg 2820

gaacaaaacc cagagcttag gccaactgcg gccgaatgct accaccacct gcttcagctc 2880

cagtcgtcac tgtcggttgt caccgccatg atgtga 2916

<210> 2

<211> 971

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Gly Glu Thr Lys Gly Asp Asn Pro Asn Ile Gln His Gln Gln Pro

1 5 10 15

Gln Gln Thr Gln Gln His Gln Gln Ile Ser Thr Ser Pro Asn Asp Pro

20 25 30

Leu Glu Glu Ala Ser Pro Leu Thr Val Ala Val Thr Gly Ala Thr Ala

35 40 45

Pro Phe Asn Ile Pro Ala Pro Leu Tyr Val Pro Ile Ser Gly Ala Thr

50 55 60

Ser Ser Ser Leu Pro Phe Asp Gln Ser Gln Phe Glu Ala Val Asn Pro

65 70 75 80

Lys Arg Pro Arg Tyr Thr Ser Thr Gly Gln Trp Lys Leu Leu Pro Ser

85 90 95

Pro Ser Ser Gln Gln Lys Gln Thr Pro Thr Gln Thr Thr Gly Ala Ser

100 105 110

Ser Ser Asp Thr Ala Ser Ser Pro Pro His Ser Pro Leu Pro Ser Leu

115 120 125

Ser Ala Thr Ser Gly Gln Asp Thr Thr Lys Thr Glu Gly Glu Glu Gln

130 135 140

Asn Pro Ser Leu His Arg Ser Gln Phe Arg Arg Gly Lys Tyr Val Ser

145 150 155 160

Pro Val Trp Lys Pro His Glu Met Leu Trp Leu Ala Lys Ala Trp Arg

165 170 175

Ala Val Tyr Gln Ser Gln Gly Ser Glu His His Ser Asp Ile Thr Gly

180 185 190

Gln Pro Thr Arg Ala Lys Thr Arg Ala Asp Lys Asp Arg Glu Val Ala

195 200 205

Glu Phe Leu Gln Lys Asn Gly Ile Asn Arg Asp Ala Lys Thr Ala Gly

210 215 220

Thr Lys Trp Asp Asn Met Leu Gly Glu Phe Arg Lys Val Tyr Glu Trp

225 230 235 240

Glu Arg Gly Ala Asp Arg Glu Gln Val Gly Asn Lys Ser Tyr Phe Arg

245 250 255

Leu Ser Pro Tyr Glu Arg Lys Leu His Arg Leu Pro Ala Ser Phe Asp

260 265 270

Glu Glu Val Phe Asp Glu Leu Ala Gln Phe Met Gly Ser Arg Met Arg

275 280 285

Thr Pro Pro Ile Ser Arg Ala Ala Asp Ser Thr Arg Ser Gln Ser Leu

290 295 300

Tyr Val Thr Thr Ser Ser Val Leu Pro Gln Pro Pro Ser Phe Arg Glu

305 310 315 320

Glu Asp Leu Pro Asn Ser Gly Arg Ala Arg Gln Leu Met Ile Met Thr

325 330 335

Gly Gly Gly Glu Gly Pro Phe Tyr Pro Arg Ser Gly Ser Leu Leu Gly

340 345 350

Phe Asp His Leu Pro His Tyr His His Gln Ser Ser Leu Asp Tyr Val

355 360 365

Ala Gly Val Ser Ser Ser Thr Ser Leu Thr Lys Glu Leu Arg Arg Ile

370 375 380

Gly Lys Ile Arg Met Thr Trp Glu Glu Ser Val Ser Leu Trp Gly Glu

385 390 395 400

Glu Gly Glu His His Arg Gly Arg Ile Lys Ile Gln Gly Gly Ser Ser

405 410 415

Phe Leu Asn Ala Asp Glu Leu Ala Tyr Phe Asp Asp Ser Leu Val Ala

420 425 430

Cys Thr Met Glu Ala Phe Glu Asp Gly Pro Phe Arg Gly Phe Ser Val

435 440 445

Asp Arg Phe Val Ser Gly Gln Gln Val Lys Val Phe Gly Arg Arg Lys

450 455 460

Pro Ser Thr Pro Gly Phe Ser Lys Lys Thr Leu Pro Phe Ala Glu Ser

465 470 475 480

Ser Ile Arg Ser Met Pro Pro Trp Glu Phe Gln Asp Pro Ser Glu Tyr

485 490 495

Tyr Ile Thr Cys Leu Arg Val Pro Pro Gln Ser Leu Pro Arg Leu Ser

500 505 510

Asp Leu Ser Ser Tyr Leu Leu Gln Pro Pro Pro Glu Glu Phe Arg Phe

515 520 525

Pro Leu Arg Lys Asp Val Tyr Arg Asp Leu Pro Pro Gly Arg Glu Ser

530 535 540

Phe Phe Thr Thr Ser Asn Asp Leu Leu Asp Cys Arg Ala Ile Thr Tyr

545 550 555 560

Asp Ile Val Ser Thr Ile Ile Arg Ser Asn Tyr Gly Ile Gly Ala Thr

565 570 575

Thr Ser Arg Asp Ser Phe Ile Gly Leu Trp Asp Asp Cys Ile Asn Arg

580 585 590

Phe Val Ser Lys Phe Cys Cys Val Asp Met Val Phe Val Arg Lys Ala

595 600 605

Thr Ser Ser Ile Ser Thr Thr Glu Ala Leu Gln Asp Gln Trp Pro Asn

610 615 620

Val Thr Gly Phe Val Lys Asn Phe Cys Leu Trp Arg Gly Glu Glu Thr

625 630 635 640

Asp Gln Val Arg Glu Gly His Ile His Pro Ser Lys Ser Leu Val Glu

645 650 655

Lys Leu Gln Trp Thr Tyr Thr Asp Leu Pro Tyr Ile Phe Gly Tyr Tyr

660 665 670

Ser Ile Gly Ser Leu Val Thr Phe Cys Ala Leu Ser Lys Gly Gly Gln

675 680 685

Asp Gln Val Ile Gln Thr Asn Leu Gln Thr Leu Asp Gln Ser Leu Pro

690 695 700

Ser Asp Arg Leu Lys Ala Leu Val Leu Cys Tyr Arg Val Ala Gly Leu

705 710 715 720

Leu Pro Leu Leu Ala Asp Arg Cys Leu Asn Met Ile His Ser Gly Thr

725 730 735

Thr Ser Thr Ser Asn Gly Gly Ala Pro Ser Tyr Lys Phe Met Leu Leu

740 745 750

Pro Tyr Ser Asp Phe Glu Arg Val Asp Leu Arg Asn Gly Asn Ile Val

755 760 765

Glu Leu Thr Pro Asn Thr Val Thr Arg Phe Phe Ser Asn Gln Arg Lys

770 775 780

Trp Ser Ala Val Lys Glu Ile Tyr Asp Phe Leu Asp His Arg Ile Pro

785 790 795 800

His Ala Glu Cys Ile His Arg Ser Ser Glu Lys Asp Leu Ala Leu Val

805 810 815

Phe Lys Pro Arg Gly Cys Lys Phe Lys Pro Arg Asn Cys Asp Glu Leu

820 825 830

Val Glu Ala Leu Lys Tyr Val Thr Lys Ala Leu Val Ala Leu His Asp

835 840 845

Leu Ser Phe Met His Arg Asp Ile Gly Trp Asp Lys Val Met Arg Ser

850 855 860

Thr Glu Arg Asp Asn Glu Trp Leu Leu Cys Gly Phe Asp Glu Ala Val

865 870 875 880

Gly Ala Pro Gln Leu Asn Pro Tyr Ser Val Ala Ala Ala Glu Arg Gly

885 890 895

Glu His Ala Pro Glu Leu Glu Arg Ala Leu His Gly Val Lys Val Asp

900 905 910

Val Trp Gly Val Gly His Leu Val Arg Ser Cys Gly Leu Ala Gly Val

915 920 925

Pro Lys Met Leu Arg Glu Leu Gln Asn Arg Cys Leu Glu Gln Asn Pro

930 935 940

Glu Leu Arg Pro Thr Ala Ala Glu Cys Tyr His His Leu Leu Gln Leu

945 950 955 960

Gln Ser Ser Leu Ser Val Val Thr Ala Met Met

965 970

Claims

1. A strawberry SL gene encoding a transcription factor for a GT-1 domain and a PKc conserved domain.

2. The strawberry SL gene according to claim 1, wherein the CDS sequence is shown IN SEQ IN No. 1.

3. A protein encoded by the strawberry SL gene of claim 1 or 2.

4. The protein according to claim 3, characterized IN that it has the amino acid sequence shown IN SEQ IN No. 2.

5. An expression vector comprising the strawberry SL gene of claim 1 or 2.

6. Use of the strawberry SL gene according to claim 1 or 2, the protein according to claim 3 or 4 and the expression vector according to claim 5 for regulating single or multiple leaves of a crop.

7. Use of the strawberry SL gene according to claim 1 or 2, the protein according to claim 3 or 4, or the expression vector according to claim 5 for controlling the flowering number of crops.

8. Use of the strawberry SL gene according to claim 1 or 2, the protein according to claim 3 or 4 or the expression vector according to claim 5 for regulating the premature ripening of fruit.