CN112322632B

CN112322632B - Gene LAM, application thereof, method for obtaining strawberry male sterile line and kit

Info

Publication number: CN112322632B
Application number: CN202011238592.2A
Authority: CN
Inventors: 康春颖; 冯佳; 程来超
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-11-09
Filing date: 2020-11-09
Publication date: 2022-02-11
Anticipated expiration: 2040-11-09
Also published as: CN112322632A

Abstract

The invention relates to the technical field of molecular biology, and particularly provides a gene LAM, a nucleotide sequence of which is shown in SEQ ID NO. 1, application of the LAM gene in regulation and control of strawberry organ development, a method for obtaining a strawberry male sterile line by changing the LAM gene to enable the LAM gene not to perform a function, and a kit. The strawberry male sterile line obtained by the method can be directly used as a female parent in the strawberry breeding process, and the complicated manual emasculation process is omitted. And meanwhile, the formation of stolons of the obtained strawberry plants is inhibited, the stolons are basically not generated, and the stolons do not need to be manually removed after blooming, so that the generation of inflorescences and fruit setting are facilitated.

Description

Gene LAM, application thereof, method for obtaining strawberry male sterile line and kit

Technical Field

The invention relates to the technical field of molecular biology, in particular to a gene LAM, application thereof, a method for obtaining a strawberry male sterile line and a kit.

Background

The cultivated strawberry (Fragaria x ananassa, pineapple strawberry) is a perennial strawberry plant, belongs to the Rosaceae strawberry genus, and is deeply favored by consumers due to the aromatic, sweet and sour taste, bright color and rich nutrition of the fruit. According to statistics, the total area of the strawberries in the Chinese of 2018 is 17.3 kilohm²The total yield is 500 ten thousand t, which becomes the first strawberry production country and the first consumption country in the world and accounts for more than 50 percent of the total yield in the world. In the strawberry genus, the cultivated strawberry is an octaploid and has a complex genetic background, and the diploid strawberry species forest strawberry (Fragaria viscosa) has complete genome and transcriptome information, has a mature genetic operation system, and is one of the ancestral species of the cultivated strawberry, so that the cultivated strawberry is a model material for basic research of the strawberry.

The stolon is a special branch in the strawberry and is characterized in that the first internode is extremely elongated, each two internodes are long to form a filial seedling, and the genetic background of the filial seedling is completely the same as that of a mother plant. Each stolon can breed dozens of filial generation seedlings, so the stolon is an important organ for the nutrition propagation of the strawberries. Before the strawberry blooms, a large amount of stolons are generated; after flowering, it is desirable to reduce the number of stolons, thereby promoting inflorescence formation and fruit set. Therefore, effective regulation of stolons is linked to the propagation of strawberries and the fruit yield. In the stolon formation process, the plant hormone Gibberellin (GA) plays a key role in regulation. Spraying GA from an exogenous source can enable strawberry plants to form more stolons, and spraying GA synthesis inhibitor can inhibit the formation of the stolons. To date, only two gibberellin pathway genes have been found to play a key role in this process, including the gibberellin synthase gene FveGA20ox4 and the signaling pathway gene FveRGA1, which are positive and negative regulators of strawberry stolon production, respectively. The discovery of the new regulating and controlling element is beneficial to deeply analyzing the molecular regulating and controlling mechanism generated by the strawberry stolons and providing gene resources for the molecular breeding of the strawberries.

Besides the stolons propagation which is widely applied at present, the development of seed propagation varieties becomes a new direction for strawberry breeding. The seed propagation has the advantages of reducing operation steps, reducing cost, reducing disease spread and the like, and is a brand new propagation system for strawberries. For seed reproduction, first, excellent parent and parent materials need to be selected and bred respectively. In field crops, male sterile materials are often used as female parents to achieve the purposes of simplifying hybridization operation and ensuring the success rate of hybridization. At present, no genetic material with male sterility characteristics is reported in strawberries.

The flowers of the forest strawberries consist of four-wheel flower organs, and respectively comprise 5 sepals, 5 petals, 20 stamens and a large number of pistils attached to the surface of a receptacle. Very few reports have been made on the function of forest strawberry flower organ development regulatory genes, such as fvelupo 1 and FaTM 6. After the two genes are mutated, the development of flower organs of each round of strawberry is abnormal, and the two genes are difficult to be applied to breeding. In order to solve this problem, the development of genes that specifically regulate the development of strawberry stamens is urgently needed.

Disclosure of Invention

The inventor finds a mutant loss of axillary merists (lam) with male sterility caused by stamen deletion in a forest strawberry EMS mutant library, and simultaneously inhibits the formation of stolons. The mutant gene of the mutant is found through fine gene positioning, the mutant of the gene is obtained through a gene editing technology mediated by a CRISPR/Cas9 technology, the phenotype of the LAM mutant is reproduced, and the function of the LAM gene is further confirmed.

Based on the gene, the invention provides the gene LAM, and the nucleotide sequence of the gene LAM is shown as SEQ ID NO. 1.

The invention also provides application of the gene LAM in regulating and controlling the organ development of strawberry plants.

Further, the organ is a stamen.

Further, the organ is a stolon.

The invention also provides a method for obtaining the strawberry male sterile line, which comprises the following steps:

knocking out or changing the gene LAM as claimed in claim 1 in strawberry, so that the gene LAM is deleted or mutated, and further, the encoded protein cannot express or lose activity; and/or, inhibiting the expression of the gene LAM.

Further, the method for changing the gene LAM is gene editing.

Further, the method for inhibiting the expression of the gene LAM is RNA interference.

Further, the gene editing adopts a CRISPR/Cas9 method.

Further, the DNA sequence of the target region in the strawberry genome by the CRISPR/Cas9 method is shown as SEQ ID NO. 2 or SEQ ID NO. 3.

The invention also provides a kit for obtaining the strawberry male sterile line, which comprises at least one of the following components:

(1) the sequence of the sgRNA molecule is shown as SEQ ID NO. 4 or SEQ ID NO. 5;

(2) a coding DNA molecule of a sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5;

(3) CRISPR/Cas9 targeting vectors comprising sgRNAs of the sequence shown in SEQ ID NO. 4 or SEQ ID NO. 5.

The invention has the beneficial effects that: the invention provides application of the gene LAM in regulating and controlling stamen generation and stolon generation of strawberries, and obtains a male sterile line of the strawberries by changing the LAM gene to enable the LAM gene not to have functions. And meanwhile, the formation of stolons of the obtained strawberry plants is inhibited, the stolons are basically not generated, and the stolons do not need to be manually removed after blooming, so that the generation of inflorescences and fruit setting are facilitated.

Drawings

FIG. 1 is the result of mapping the mutant genes of LAM mutants of the present invention, wherein 1A is the structure and mutation site of the LAM gene, and 1B is the evolutionary tree of the LAM gene;

FIG. 2 shows phenotypic results of stamen deletion of lam mutants, wherein FIG. 2A shows floral organs of wild-type YW and lam mutants, scale: 1 cm; fig. 2B is a statistic of number of stamens of wild-type YW and lam mutants,. about.p < 0.01; FIG. 2C shows the development process of the floral organs of the wild type YW and lam mutants observed by scanning electron microscopy, with the following scale: 100 μm;

FIG. 3 is the phenotypic outcome of reduced numbers of stolons for the lam (H4) mutant, where 3A is wild-type H4 and lam (H4) plants; figure 3B is a statistic of number of stolons in wild type H4 and lam (H4) plants, P < 0.01; FIG. 3C is wild-type YW and lam mutant axillary buds, scale: 1 cm;

FIG. 4 shows lam of the present invention^CREditing condition and phenotype analysis of mutant, wherein 4A is position and sequence of two sgRNAs of LAM gene, and 4B is LAM^CRAnalysis of mutant editing behavior, 4C was lam^CRPhotographs of flowers of the mutants, scale: 1cm, 4D islam^CRStatistics of number of stamens of mutants<0.01; 4E is lam^CRComparative plot of reduction in the number of stolons of the mutants; 4F is lam^CRStatistics of the number of stolons of the mutants<0.01；

Detailed Description

The principles and features of this invention are described in connection with the drawings and the detailed description of the invention, which are set forth below as examples to illustrate the invention and not to limit the scope of the invention.

The experimental procedures in the following examples are, unless otherwise specified, conventional procedures, such as the Molecular cloning laboratory Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual,2001) such as Sambrook, or the conditions suggested by the manufacturer's instructions for biochemical reagents. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The plant materials used in the present invention are:

wild type forest strawberry (Yellow Wonder, YW)

Wild type forest strawberry (Hawaii 4, H4)

The experimental plant materials were all exposed to 100. mu. mol m light at 22 deg.C^-2 s^-1Plants with photoperiod of 16h light/8h dark were grown in the cultivation room.

Example 1 mapping of the mutagenic Gene LAM

A male sterile mutant lam caused by stamen deletion is found in a forest strawberry (YW) EMS mutant library, and stolon formation of the mutant is inhibited.

After the lam mutant is found, firstly, backcross is carried out by taking the lam mutant as a female parent and taking the wild forest strawberry YW as a male parent to obtain a BC1F1 generation population, then the BCIF1 population is selfed to obtain a BC1F2 generation population, and the lam mutant and the YW wild forest strawberry can be separated from the BC1F2 generation population.

Respectively taking 20 lam mutants in BC1F2 generation groups and 20 leaves of YW wild forest strawberries, mixing the same amount, respectively extracting genomes by adopting a CTAB method, and entrusting Beijing Baimaike biotechnology limited company to perform double-end library construction sequencing by adopting an Illumina HiSeqXTen platform after detecting that the DNA quality of the genomes reaches the standard. After obtaining the sequencing data, the sequencing data are analyzed by a bioinformatics method to search for the mutagenic gene. Reads obtained by sequencing were first aligned to the forest strawberry second edition (V2.0) genome using Bowtie2, and then SNPs were searched by samtools. The following principles were followed in the process of locating SNPs: (1) the SNP homozygosity rate in the mutant pool is 100%, and the SNP at this site in the wild-type pool is less than 50% (2) the variation pattern of SNPs is G to A or C to T. (3) The coding regions are preferably considered.

Through gene mapping, the mutagenic gene of the lam mutant is gene01184(Fragaria vesca gene, ver1.1)/FvH 4-3 g41310(Fragaria vesca gene, ver4.0), and the gene sequence is shown in SEQ ID NO: 1:

atgggttcattcaattcttctcatcatcaaagaatagtacctcaacaacaagaagaccaagatcatccacagattcacgcagatctacaactgtataaccagcaccaccgccaccacccccagtaccagattcctcagccgccattgttaatgtcacgcggattaaccgcccggcaactcctcatccgctgcgccgagctcatttctcagctcgacttctcctccgctcacggccttatttccattctagcctcctcgaactactcccctcacggtgactccaccgagagactagtccaccagttcgttcgcgccctctctctccgcctgcctccagtggcggcggccccaccagatatggctcgtgtcgccgccgccactggaacatcagccgcctccacctctagcgcgttatcgctcgaggtggagacggaagcggaagaagagacgcttcagtcgtgctacttaaccctaaaccagataaccccattcatcaggttcagccacttgacggcaaatcaagctatcctcgaagctattgactcgagtcaccacgccatccacatcctggactttgatatcaaacacggcgtgcaatggcctccgttgatgcaggccctcgtcgagagatcctacggctcaagctcatctcctccaccgttgctccgcatcaccgccaccggtcgcgatctcactctcctccgccgaactggcgagcgtctcctaaggtttgctcagtcccttggactcaccttccacttccgccccatcgttctcctaaacgacgtcgcaatgatcgactacctcaacccggcgtcgcttggtctcttccctaacgaagccctcgccgtcaactgcgtcctctacctccacagactcctcaccgacgacgcacgtgacctccacctcttcctcgacaagatcagagccttgaacccgaagatagttacagtagccgagcgagaagccaatcacaacagccctatgtttctcaacaggtttgtcgaggcggtggaccactacggcgccgttttcgggtccttggaagcgacgctcccgccgaacagcagggagaggctggcggtggagcagatgtggttcggaagagagattgctgacgtggtggcggccgatgatgatcaaggaagaaaacagttgaggcatgagaggtatgagaattgggagatgatgatgaggaggtcggggttctcgaatgttccgttgagtcccttcgctctttcgcaagccaagcttcttctccggcttcactacccttccgagggttaccagcttcatagcctcaaggactcgttcttcttaggttggatgaatcgtccccttttctcagtttcttcttggaactaa

the gene contains only one intron, and does not include exons. G to A mutation occurs at 600th base of gene01184, and a stop codon is formed, so that the protein is terminated early and is out of function. LAM (gene01184) belongs to the GRAS family and contains five conserved elements: LHRI, VHIID, LHRII, PFYRE and SAW. The mutation site of the lam mutant occurs on the VHIID element. The localization of the mutagenic genes of the lam mutants is shown in FIG. 1.

And counting the number of stamens and stolons of the related materials. In counting the number of stamens of the relevant material, the number of stamens of flowers of the single wild type and mutant were counted. When the number of stolons is counted, the growth environments of the lam (H4) mutant and the H4 wild type are consistent, the growth period is one year, and the number of the stolons is counted by a single plant.

Through refined phenotypic statistics, it was found that in wild forest strawberry YW, the number of stamens remained around 20, whereas in lam mutant there was almost no stamens formed and very few stamens were present in individual flowers. Further observation of the development of floral organs by Scanning Electron Microscopy (SEM) revealed that at stage4, lam and YW showed no difference and that both bracts, sepals and petal primordia had formed. At stage6, lam and YW were observed after removal of bracts and sepals, where significant androecium was visible, whereas in lam mutants no formation of androecium was observed, as shown in FIG. 2. This result indicates that stamen formation of LAM mutants is suppressed and that LAM gene can positively regulate the formation of strawberry stamen.

Since the background of the LAM mutant was YW that did not produce stolons, to see if the LAM gene affected the generation of stolons, the LAM mutant was hybridized with forest strawberries H4 that could produce stolons. In the F2 population, an H4 background mutant of lam was obtained, called lam (H4). Under the same growth environment and at the same growth period of 6 months, the numbers of stolons of 26 wild type H4 and 39 lam (H4) mutants are counted respectively, and the result is shown in figure 3, wherein 18 stolons grow averagely in wild type H4 forest strawberry plants, the number of the stolons can reach 23 at most, and the number of the stolons is at least 14. In lam (H4) mutant plants, however, stolon formation was greatly limited, with few stolons present, which could form stolons. Under the condition that the stolons are formed, only 4 stolons can be formed at most, and the average number of the stolons of the 39 lam (H4) mutants is counted to be 1. It was further observed that in the lam (H4) mutant plants, although stolons were formed, they stopped once they entered the reproductive growth stage, whereas in the wild type H4 plants, stolons were still produced under specific conditions even when they entered the reproductive growth stage. This result indicates that the creeping formation of LAM (H4) mutant was inhibited and that LAM gene positively regulated the formation of strawberry creeping.

Statistics on the number of YW and LAM mutant axillary buds shows that the number of LAM mutant axillary buds is remarkably reduced, and the LAM gene can influence the initiation of axillary buds.

Example 2 obtaining strawberry male sterile line Using CRISPR/Cas9 technology

1. Construction of CRISPR/Cas9 gene editing vector

The design of sgRNA is carried out according to the coding sequence of LAM gene, and the DNA sequences of the target regions of two sgRNAs, the sgRNA1 and the sgRNA2, the sgRNA1 and the sgRNA2 are designed in total as shown in SEQ ID NO. 2 or SEQ ID NO. 3

SEQ ID NO:2ccacctctagcgcgttatcgctg

SEQ ID NO:3ccgaactggcgagcgtctcctaa

Wherein the nucleic acid sequences of sgRNA1 and sgRNA2 are as follows:

sgRNA1：cagcgauaacgcgcuagaggugg(SEQ ID NO:4)

sgRNA2：uuaggagacgcucgccaguucgg(SEQ ID NO:5)

the DNA sequences of the sgRNA1 and the sgRNA2 are shown in SEQ ID NO 6 and SEQ ID NO 7, respectively:

SEQ ID NO:6:cagcgataacgcgctagaggtgg

SEQ ID NO:7:ttaggagacgctcgccagttcgg

designing a PCR primer according to the sequence of the sgRNA, carrying out PCR synthesis by using pCBC-DT1T2 as a template to obtain a AtU6 promoter-sgRNA-AtU 6 terminator fragment, and connecting the fragment into a final vector pHSE401 by using a Golden Gate Assembly method to obtain a pHSE401 vector integrating the LAM gene sgRNA. Wherein the primer sequence synthesized by PCR is as follows:

LAM-F1：atatatggtctcgattcagcgataacgcgctagagggtt(SEQ ID NO:8)

LAM-F2：tcagcgataacgcgctagagggttttagagctagaaatagc(SEQ ID NO:9)

LAM-R1：aacttaggagacgctcgccagttaatctcttagtcgactctac(SEQ ID NO:10)

LAM-R2：attattggtctcgaaacttaggagacgctcgccagttaa(SEQ ID NO:11)

wherein, the PCR system is as follows: LAM-F1: 5 μ L, LAM-F2: 0.2 μ L, LAM-R1:5 μ L, LAM-R2: 0.2 μ L, KOD enzyme: 1 μ L, KODbuffer: 5 mu L, dNTP: 5 mu L, MgCl₂：3.5μL、DMSO：2.5μL、pCBC-DT1T2：5μL、H₂O：17.6μL

The connecting system is as follows:

2. transformation of forest strawberries

The MS used in the following procedure was M404 Murashige & Skoog Modified basic Medium with Gamborg Vitamins (Phototech, M404-100L) available from Western Mejed, Beijing. Wherein 1/2MS is 1/2 with the addition amount being the instruction concentration.

An agrobacterium-mediated forest strawberry callus transformation method is adopted, and the specific operation steps are as follows:

1) preparation of sterile seedlings

Putting seeds of forest strawberry H4 into a test tube, adding sterile water, putting the test tube into a refrigerator, soaking overnight at 4 ℃, absorbing the sterile water, adding 70% alcohol, soaking for 5min (shaking), washing with sterile water for 4-5 times, removing the alcohol, adding 2% sodium hypochlorite, adding a drop of Tween20, soaking for 10min (shaking), washing with sterile water for 3-4 times, sowing the seeds on a culture dish containing 1/2MS culture medium (1/2MS2.22g/L + sucrose 20g/L + agar 7g/L, pH5.8), carrying out dark culture at 4 ℃ for two weeks, transferring the seeds to a tissue culture room for germination, and transferring the seeds to a bottle of 1/2MS for later use when 2 true leaves grow out.

2) Culturing callus

In a clean bench, the leaves of the aseptic seedlings are cut off by scissors, placed on a sterilized empty dish, cut into a plurality of small pieces (each small piece of leaves is cut 3 times) by a scalpel, placed on a 5+ + culture medium (MS4.44g/L, sucrose 20g/L, agar 7g/L, indolebutyric acid 0.3mg/L, 6-benzylaminopurine 3.4mg/L, pH5.8), placed on each plate for about 20 pieces, the front faces of the leaves face downwards, and dark-cultured at 22 ℃ for 15-30d until the cut grows out of the callus.

3) Preparation of bacterial liquid

Dipping the bacterial liquid preserved at the temperature of minus 80 ℃ on a solid LB culture medium (yeast extract 5g/L + peptone 10g/L + NaCl10g/L + agar 15g/L + gentamicin 50 ug/mL + rifampicin 50 ug/mL + spectinomycin 50 ug/mL), streaking and activating agrobacterium at the temperature of 28 ℃ for 2-3 days, selecting a monoclonal antibody and 4mL liquid LB culture medium (yeast extract 5g/L + peptone 10g/L + NaCl10g/L + gentamicin 50 ug/mL + rifampicin 50 ug/mL), shaking at the temperature of 28 ℃ overnight, and carrying out PCR to identify positive bacterial liquid.

4) Transformation of

Pouring the bacterial liquid into a 2mL centrifuge tube, taking a 3-4 tube, centrifuging at 8000rpm for 2min, discarding the supernatant, taking 1mL Co-buffer (MS4.44g/L + sucrose 20g/L, pH5.8) to resuspend the bacterial liquid, adding into a triangular flask containing 20mL Co-buffer, adding 200 μ L of 50mg/mL Acetosyringone (AS) solution, shaking in the shade at room temperature for 3h, adding 3 plates of callus, shaking in the shade at room temperature for 0.5-1h, washing the callus with sterile water for 2-3 times, clamping onto filter paper with tweezers, draining the water, placing on a 5+ + culture medium, placing leaves with the front side facing downwards, placing into an incubator, and Co-culturing in the shade for 3 d.

5) Cleaning callus

After 3 days of co-culture, part of the callus was inoculated with Agrobacterium, the callus was clamped in a triangular flask containing sterile water, washed 2-3 times, blotted with filter paper, placed on CT medium (MS4.44g/L + sucrose 20g/L + agar 7g/L + indolebutyric acid 0.3mg/L + 6-benzylaminopurine 3.4mg/L + carbenicillin 250mg/L + timentin 250mg/L, pH5.8), placed in an incubator for 1 week and then cultured under normal culture conditions (incubator: 16 hours of light, 22 ℃, 8 hours of dark, 19 ℃).

6) Subculture

After 2 weeks of culture on CT medium, the calli were transferred to a resistant medium (MS4.44g/L + sucrose 20g/L + agar 7g/L + indolebutyric acid 0.3mg/L + 6-benzylaminopurine 3.4mg/L + carbenicillin 250mg/L + timentin 250mg/L + kanamycin 5mg/L, pH5.8), after which the medium was changed every 2 weeks to one month until callus differentiated to shoots.

7) Rooting culture

After the generation of shoots from the wound healed, the shoots were excised from the tissue and transferred to a rooting medium (1/2MS2.22g/L + glucose 20g/L + agar 7g/L + indolebutyric acid 0.1mg/L + carbenicillin 200mg/L + timentin 200mg/L + kanamycin 5mg/L, pH5.8) for cultivation until they were rooted.

Example 3 identification of CRISPR/Cas9 Gene editing status of transgenic plants

Firstly, extracting genome DNA of a transgenic plant, carrying out PCR amplification to obtain a corresponding LAM sequence, carrying out sequencing analysis, then selecting a plant different from an LAM reference sequence, namely a transgenic material subjected to editing, and carrying out detailed analysis on the editing condition of the transgenic material. And (3) connecting the PCR product of the edited plant to a T vector by using TA cloning, carrying out escherichia coli transformation, selecting 15 monoclonals, respectively carrying out PCR amplification to obtain an LAM sequence, carrying out sequencing, comparing, and analyzing the specific editing condition. The PCR primers used were LAM-F and LAM-R, the sequences of which were:

LAM-F:atgggttcattcaattcttctcat(SEQ ID NO:12)

LAM-R:tagttccaagaagaaactgagaat(SEQ ID NO:13)

three forest strawberry lams obtained by CRISPR/Cas9 technology^CRMutants (L23, L27 and L35). In lam^CRIn L23, a deletion of one base occurred at sgRNA2, and others were consistent with the wild type; in lam^CRIn L27, there are two different edits at sgRNA 1: respectively refers to the insertion and deletion of one base, and the deletion of one base and three bases respectively occurs at the sgRNA 2; in lam^CRIn L35, the sgRNA1 had a deletion of one base and a deletion of 27 bases, respectivelyIn loss, a deletion of one base occurred at sgRNA 2.

And counting the number of stamens and stolons of the related materials. In counting the number of stamens of the relevant material, the number of stamens of flowers of the single wild type and mutant were counted. When the number of stolons is counted, lamCR and control are T1 generation transgenic materials, control is a material without editing, the growth environment is consistent, and the growth period is three months when stolons are counted.

Number of stamens: control (T0 generation transgenic material with no editing), lam^CRThe average number of stamens of L23, L27, L35 is 10, 0, 1, 0, respectively;

stolon quantity: control (T1 generation transgenic material with no editing occurring) and lam^CR(edited T1 generation transgenic material) average numbers of stolons were 5 and 1, respectively;

these different edits cause lam^CRL23, L27, L35 produced the same phenotype as lam-loss of stamens and reduction of stolons.

Specifically, as shown in FIG. 4, where lamCR-pooled is a mixed population of edited T1 generation transgenic material from other different strains.

The invention discovers for the first time that the gene LAM can be applied to the regulation of the occurrence of stamens and the occurrence of stolons of strawberries, can positively regulate the occurrence of the stolons and the occurrence of the stamens, can obtain a male sterile line of strawberries by changing the LAM gene to prevent the genes from performing functions, can be directly applied as a female parent in the breeding process of the strawberries, and omits the complicated manual emasculation process. And meanwhile, the formation of stolons of the obtained strawberry plants is inhibited, the stolons are basically not generated, and the stolons do not need to be manually removed after blooming, so that the generation of inflorescences and fruit setting are facilitated.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Sequence listing

<110> university of agriculture in Huazhong

<120> gene LAM, application thereof, method for obtaining strawberry male sterile line and kit

<160> 13

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1365

<212> DNA

<213> forest strawberry (Fragaria visco)

<400> 1

atgggttcat tcaattcttc tcatcatcaa agaatagtac ctcaacaaca agaagaccaa 60

gatcatccac agattcacgc agatctacaa ctgtataacc agcaccaccg ccaccacccc 120

cagtaccaga ttcctcagcc gccattgtta atgtcacgcg gattaaccgc ccggcaactc 180

ctcatccgct gcgccgagct catttctcag ctcgacttct cctccgctca cggccttatt 240

tccattctag cctcctcgaa ctactcccct cacggtgact ccaccgagag actagtccac 300

cagttcgttc gcgccctctc tctccgcctg cctccagtgg cggcggcccc accagatatg 360

gctcgtgtcg ccgccgccac tggaacatca gccgcctcca cctctagcgc gttatcgctc 420

gaggtggaga cggaagcgga agaagagacg cttcagtcgt gctacttaac cctaaaccag 480

ataaccccat tcatcaggtt cagccacttg acggcaaatc aagctatcct cgaagctatt 540

gactcgagtc accacgccat ccacatcctg gactttgata tcaaacacgg cgtgcaatgg 600

cctccgttga tgcaggccct cgtcgagaga tcctacggct caagctcatc tcctccaccg 660

ttgctccgca tcaccgccac cggtcgcgat ctcactctcc tccgccgaac tggcgagcgt 720

ctcctaaggt ttgctcagtc ccttggactc accttccact tccgccccat cgttctccta 780

aacgacgtcg caatgatcga ctacctcaac ccggcgtcgc ttggtctctt ccctaacgaa 840

gccctcgccg tcaactgcgt cctctacctc cacagactcc tcaccgacga cgcacgtgac 900

ctccacctct tcctcgacaa gatcagagcc ttgaacccga agatagttac agtagccgag 960

cgagaagcca atcacaacag ccctatgttt ctcaacaggt ttgtcgaggc ggtggaccac 1020

tacggcgccg ttttcgggtc cttggaagcg acgctcccgc cgaacagcag ggagaggctg 1080

gcggtggagc agatgtggtt cggaagagag attgctgacg tggtggcggc cgatgatgat 1140

caaggaagaa aacagttgag gcatgagagg tatgagaatt gggagatgat gatgaggagg 1200

tcggggttct cgaatgttcc gttgagtccc ttcgctcttt cgcaagccaa gcttcttctc 1260

cggcttcact acccttccga gggttaccag cttcatagcc tcaaggactc gttcttctta 1320

ggttggatga atcgtcccct tttctcagtt tcttcttgga actaa 1365

<210> 2

<211> 23

<212> DNA

<213> forest strawberry (Fragaria visco)

<400> 2

ccacctctag cgcgttatcg ctg 23

<210> 3

<211> 23

<212> DNA

<213> forest strawberry (Fragaria visco)

<400> 3

ccgaactggc gagcgtctcc taa 23

<210> 4

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

cagcgauaac gcgcuagagg ugg 23

<210> 5

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

uuaggagacg cucgccaguu cgg 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

cagcgataac gcgctagagg tgg 23

<210> 7

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

ttaggagacg ctcgccagtt cgg 23

<210> 8

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atatatggtc tcgattcagc gataacgcgc tagagggtt 39

<210> 9

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

tcagcgataa cgcgctagag ggttttagag ctagaaatag c 41

<210> 10

<211> 43

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

aacttaggag acgctcgcca gttaatctct tagtcgactc tac 43

<210> 11

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

attattggtc tcgaaactta ggagacgctc gccagttaa 39

<210> 12

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

atgggttcat tcaattcttc tcat 24

<210> 13

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

tagttccaag aagaaactga gaat 24

Claims

1. The application of the gene LAM in regulating and controlling the organogenesis of strawberry plants is characterized in that the nucleotide sequence of the gene LAM is shown in SEQ ID NO. 1, and the organ is stamen.

2. The application of the gene LAM in regulating and controlling the generation of strawberry plant organs is characterized in that the nucleotide sequence of the gene LAM is shown as SEQ ID NO:1, and the organs are stolons.

3. A method for obtaining a strawberry male sterile line is characterized by comprising the following steps:

knocking out or changing a gene LAM in the strawberry, wherein the nucleotide sequence of the gene LAM is shown as SEQ ID NO. 1, so that the gene LAM is deleted or mutated, and further, the encoded protein can not express or lose activity; or, inhibiting the expression of the gene LAM.

4. The method of claim 3, wherein the method of altering the gene LAM is gene editing.

5. The method of claim 3, wherein the method of inhibiting the expression of gene LAM is RNA interference.

6. The method according to claim 4, wherein the gene editing employs CRISPR/Cas9 method.

7. The method according to claim 6, wherein the DNA sequence of the target region in the strawberry genome of the CRISPR/Cas9 method is shown as SEQ ID NO 2 or SEQ ID NO 3.