CN114344470A - Silicosis treatment target and application thereof - Google Patents

Abstract

The invention relates to a silicosis treatment target and application thereof, wherein the treatment target is glycolysis. The invention provides a new direction for developing and treating silicosis-related medicaments by regulating glycolytic abnormality, inhibiting epithelial cell iron death and EMT and relieving silicosis, and the invention discovers that glycolytic abnormality occurs in the silicosis development process and provides a theoretical basis for clinical auxiliary diagnosis technology of silicosis.

Description

Silicosis treatment target and application thereof

Technical Field

The invention relates to the technical field of biological medicines, in particular to a silicosis treatment target and application thereof.

Background

Silicosis is caused by long-term inhalation of a large amount of dust with high content of free silicon dioxide, is a occupational disease characterized by wide pulmonary nodules and pulmonary interstitial fibrosis, is the most common and serious occupational disease in China, and seriously affects the lung function in the later stage of silicosis, is combined with various complications and seriously affects the normal life of patients. At present, the development of silicosis mainly aims at symptomatic treatment, no specific medicine and effective treatment means are clinically available, and the development mainly depends on adjuvant treatment, such as the use of medicines for targeted protection of macrophages from silica dust damage, bronchoalveolar lavage and the like. The currently used drugs such as tetrandrine and other alkaloids have certain effects, but have more adverse reactions such as anorexia, diarrhea, impaired liver and kidney functions and the like; bronchoalveolar lavage techniques are too costly and place a heavy economic burden on silicosis patients.

Epithelial-mesenchymal transition (EMT) is one of the key pathogenesis of pulmonary fibrosis, and EMT causes fibrotic effect through its upstream related signal pathway, interferes or blocks EMT-related effector molecules, and can inhibit the occurrence and development of pulmonary fibrosis.

Iron death is a novel cell death mode discovered in recent years, and is different from cell death modes such as apoptosis, necrosis and programmed cell death, wherein iron death is a cell death mode in which iron ions in cells are overloaded and depend on lipid peroxidation, and is specifically expressed as ROS metabolism, iron metabolism, amino acid and glutathione metabolism disorder in cells. In recent years, reports have shown that various harmful factors can cause intracellular iron overload and redox imbalance and induce iron death (Ferroptosis) after exposing the endothelial cells of the circulatory system, which suggests that a new damage mechanism may exist for respiratory diseases caused by the exposure of the harmful factors.

Glycolysis refers to a complex series of chemical reactions of glucose, glycogen, etc. that occur in vivo. Glucose and glycogen are oxidized in vivo to provide energy, and in vivo glycolysis mainly includes oxidative phosphorylation with mitochondria as a main functional unit and anaerobic glycolysis in cytoplasm. At present, the application of glycolysis in relieving the occurrence and development of silicosis is not concerned.

Disclosure of Invention

In order to solve the technical problems, the invention discloses glycolysis which can be used as a new treatment target of silicosis, through inhibiting glycolysis in vivo, the invention discovers that iron death and EMT of epithelial cells are reduced, the silicosis is obviously relieved, and a new direction is provided for drug development and treatment means related to the silicosis.

The first objective of the invention is to provide a silicosis therapeutic target, which is glycolysis.

The second object of the present invention is to disclose the use of a glycolytic inhibitor, capable of interfering with the glycolytic pathway, for the preparation of a medicament for the treatment of silicosis.

Further, the glycolysis inhibitor is a substance that interferes with glycolysis of lung epithelial cells.

Further, the glycolysis inhibitor is one or more of 2-deoxy-D glucose (2-DG), PFKFB3 (fructose-2, 6-bisphosphatase) isozyme inhibitor and Glut1 (glucose transporter 1) inhibitor. Wherein, the PFKFB3 isozyme inhibitor can be selected from 3-PO, PFK-158 and the like, and the Glut1 inhibitor is BAY876 and the like.

Further, the above medicine is used for treating silicosis induced by particulate dust.

Further, the above drugs inhibit lung epithelial cell iron death, EMT processes and pulmonary fibrosis levels.

Furthermore, the medicine takes glycolysis inhibitor as an active ingredient and also comprises pharmaceutically acceptable auxiliary materials.

It is a third object of the present invention to provide an agent for inhibiting iron death and EMT in lung epithelial cells, which comprises an inhibitor of glycolysis of lung epithelial cells.

The fourth object of the present invention is to provide a kit for diagnosing silicosis, which contains a reagent for detecting glycolysis of lung epithelial cells.

Further, the reagent for detecting glycolysis of lung epithelial cells comprises a reagent for detecting glycolysis-related proteins SLC2A1, SLC2A3, HK 1 and HK 2.

Glycolysis targets also provide new possibilities for silicosis drug development, such as drug screening targets.

By the scheme, the invention at least has the following advantages:

the invention discloses glycolysis as a new therapeutic target, which inhibits the iron death and EMT of epithelial cells and relieves the silicosis development by regulating glycolysis abnormity; experiments prove that glycolysis abnormal expression appears in the silicosis occurrence and development process, and the glycolysis inhibitor can obviously down-regulate lung epithelial cell iron death and EMT so as to improve the lung injury condition. The invention provides a new target for developing and treating the silicosis-relieving medicine.

The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following description is made with reference to the preferred embodiments of the present invention and the accompanying detailed drawings.

Drawings

In order that the present disclosure may be more readily and clearly understood, reference will now be made in detail to the present disclosure, examples of which are illustrated in the accompanying drawings.

FIG. 1 shows the H & E staining results of the lung tissues of the mice of each group according to the present invention;

FIG. 2 shows the result of IHC staining of lung tissue of each group of mice according to the present invention;

FIG. 3 is the expression level of glycolysis related protein detected by lung tissue western of each group of mice in the invention;

FIG. 4 shows the result of IHC staining of lung tissue of each group of mice according to the present invention;

FIG. 5 shows Fe in lung tissue of mice of each group of the present invention²⁺GSH and MDA level detection results;

FIG. 6 shows the results of sirius red staining of lung tissues of mice in each group according to the present invention;

FIG. 7 shows the QPCR detection of fibrosis-associated gene levels in lung tissues of various groups of mice according to the present invention;

FIG. 8 shows the result of IHC staining of lung tissue of each group of mice according to the present invention;

FIG. 9 shows the expression level of EMT-related proteins detected by western in lung tissues of various groups of mice according to the present invention;

FIG. 10 shows the construction of an in vitro silico-pulmonary model in HBE cells, and the QPCR detection of the expression level of a gene involved in cellular glycolysis according to the present invention;

FIG. 11 shows the results of the C11 BODIPY581/591 lipid peroxidation fluorescence probe staining to detect the lipid peroxidation level of HBE cells treated with CS or Erastin, an inducer of iron death;

FIG. 12 shows Fe in HBE cells of the present invention²⁺GSH and MDA level detection results;

FIG. 13 shows the results of immunofluorescence assay for α -SMA levels in HBE cells in accordance with the present invention;

FIG. 14 shows the western detection of the iron death, EMT and fibrosis associated protein expression levels in HBE cells of the present invention;

FIG. 15 shows the results of the C11 BODIPY581/591 lipid peroxidation fluorescence probe staining to detect the level of lipid peroxidation in cells after treatment with an iron death inhibitor in HBE cells;

FIG. 16 shows Fe in HBE cells of the present invention²⁺GSH and MDA level detection results;

FIG. 17 shows the results of immunofluorescence assay for α -SMA levels in HBE cells in accordance with the present invention;

FIG. 18 shows the western method of the present invention for detecting the expression levels of proteins associated with iron death, EMT and fibrosis in HBE cells;

FIG. 19 shows the results of the C11 BODIPY581/591 lipid peroxidation fluorescence probe staining for detecting the lipid peroxidation level of cells after treatment with 2-DG, 3-PO and BAY876 in HBE cells;

FIG. 20 shows Fe after treatment with 2-DG, 3-PO, BAY876²⁺GSH and MDA level determination results;

FIG. 21 shows the results of immunofluorescence assays for α -SMA levels in HBE cells following treatment with 2-DG, 3-PO, BAY 876;

FIG. 22 shows the western detection of iron death, EMT and fibrosis associated protein expression levels in HBE cells after treatment with 2-DG, 3-PO and BAY 876.

Detailed Description

The present invention is further described below in conjunction with the following figures and specific examples so that those skilled in the art may better understand the present invention and practice it, but the examples are not intended to limit the present invention.

The following examples relate to materials:

healthy 6-8 week old male Stat6 Wild Type (WT) mice were purchased from the experimental animals center of the chinese academy of sciences, weighing 18-20g, SPF grade.

The mice are all raised in SPF level experimental animal center in the school district of Duvilla lake of Suzhou university. The environment of the experimental animal is constant temperature and humidity, the room temperature (23 +/-2 ℃) is 50-60% of relative humidity, the illumination time is according to the circadian rhythm, and the animal can keep drinking water and ingesting food freely.

PBS solution: 10 XPBS solution is prepared, 100ml 10 XPBS solution is added into 900ml deionized water to prepare 1XPBS solution.

3% sodium pentobarbital: it is used as it is. Accurately weighing 0.3g of pentobarbital sodium crystal by using an analytical balance, adding 10ml of deionized water, sufficiently and uniformly shaking the chloral hydrate solution by using a shaking and mixing device, and storing in dark place.

1 × citrate buffer: citrate buffer (100 × concentrate) purchased from kang century, 10ml of 10 × PBS solution was added to 1000ml of deionized water to prepare 1 × citrate buffer.

Example 1 establishment of particulate dust (CS) -induced pulmonary fibrosis model in mice

Healthy 6-8 week old male C57BL/6 mice were injected intraperitoneally with 3% sodium pentobarbital 50mg/kg for anesthesia. Perfusing normal saline or SiO through non-exposed trachea₂A pulmonary fibrosis model was constructed (3 mg/mouse), and tissue and alveolar lavage fluid were recovered 7, 28, and 56 days later.

(1) Preparation of pathological section of lung tissue

After the lung tissue of the mouse is placed in a 4% paraformaldehyde solution for fixing for 1 week, the tissue is taken out for trimming, paraformaldehyde remained in the tissue is washed away, and gradient dehydration is carried out (85% ethanol solution is used for 2 hours, 95% ethanol solution is used for 1 hour and then is replaced by new 95% ethanol solution for 1 hour, and anhydrous ethanol solution is used for 0.5 hour and then is replaced by new anhydrous ethanol solution for 0.5 hour). After dehydration, the tissue was cleared by treatment with xylene for 30 minutes followed by a 10 minute further treatment with fresh xylene solution. The tissues were cleared and then treated with paraffin wax (paraffin was changed every hour for a total of 3 hours). The waxed tissue is then poured into a container along with melted paraffin and poured into cold water to solidify it immediately into a wax block. After the tissue is embedded, the tissue is sliced, then the tissue is attached to a glass slide, and finally the tissue is dried in an oven at 60 ℃ for 5 hours and then taken out for standby.

(2) Hematoxylin-Eosin (H & E) staining

Dewaxing and hydrating white paraffin slices of mouse lung tissues: soaking the mixture in xylene solution for 10min, taking out the xylene solution and replacing with new xylene, and soaking the xylene solution again for 10 min; soaking the mixture for 4 minutes by using absolute ethyl alcohol, and soaking the mixture for 4 minutes again after replacing new absolute ethyl alcohol; then soaking the mixture for 4 minutes by using 95% ethanol, and soaking the mixture for 4 minutes again by using 80% ethanol; finally, washing the fabric for 5 minutes by running water, drying the fabric in the shade, and waiting for dyeing. Placing the dehydrated slices into a hematoxylin water solution for dyeing for 5 minutes, washing with tap water, and sucking residual water on the slices; putting the slices into hydrochloric acid ethanol for differentiation for several seconds; washing with running water for 2 hours, and then putting into distilled water for a moment; then putting the mixture into 70 percent and 90 percent ethanol for dehydration for 10 minutes respectively; and (5) putting the mixture into alcohol eosin staining solution for staining for 2-3 minutes. Soaking in 95% ethanol, anhydrous ethanol, and anhydrous ethanol for 5min, and dehydrating in gradient. Xylene soak for 5 minutes, and finally neutral gum blocking.

The H & E staining results are shown in fig. 1, where solid arrows indicate nodule formation of inflammatory cells in lung tissue, dashed arrows indicate increased inflammatory cell infiltration and increased lung septal thickening, and the results in fig. 1 show: compared with CS 0d group mice, the infiltration of inflammatory cells in CS 7, 28 and 56d lung tissues is increased, and the lung intervals are thickened.

(3) Immunohistochemistry (IHC) staining:

paraffin sections were routinely dewaxed and hydrated (see hematoxylin-eosin stain dewaxed and hydrated above). Placing the slices on a slice frame, placing the slices into a container filled with 1 Xcitrate buffer solution, boiling the slices on an electromagnetic oven until the slices are boiled, boiling the slices for 8 minutes, closing the electromagnetic oven, and cooling the slices for 5 minutes; this procedure (antigen retrieval) was repeated 3 times. After the antigen is repairedThe slices were cooled on ice for 20 minutes; cooling and washing with water for 5 minutes; the sections were placed in a staining jar containing 1XPBS solution and washed on a shaker for 5 minutes. Wiping off water stain on the slices, adding 3% H₂O₂Methanol was applied dropwise to the tissue and allowed to act for 15 minutes (on wet box) to eliminate endogenous peroxidase activity. After washing with water for 5 minutes, the sections were placed in 1XPBS solution and washed on a shaker for 5 minutes. The expression of HK 2 was detected by adding murine HK 2(sc-374091) separately, and after overnight incubation at 4 ℃ the cells were washed three times with PBS, each for 5 minutes. Adding a secondary antibody provided in the reagent kit (Kangji, SP Rabbit)&Mouse HRP Kit (DAB), rabbit/Mouse Universal Streptavidin-HRP Kit (DAB)), incubated at 37 ℃ for 20 minutes in an incubator, washed three times with PBS, each for 5 minutes. Dripping DAB staining solution for 2 minutes, and washing after a staining effect is achieved; counterstain with hematoxylin for 1 min, and wash with water for 5 min. Gradient dehydration with ethanol (95%, 95%, 100%, 100% for 4 min each), xylene washing three times for 10min each, and oven drying the slices. And finally, sealing the sheet by using neutral resin, and observing the result under a microscope.

The results are shown in FIG. 2, and the IHC results show: increased brown particles in CS 7, 28, 56d lung tissue compared to CS 0d group mice, indicating increased expression of glycolytic marker gene HK 2 in CS-induced lung tissue fibrosis model.

(4) Western blot: the gel was formulated according to the reagent instructions. Putting the prepared SDS-PAGE gel into an electrophoresis device, slowly pouring electrophoresis liquid, pulling out a comb in the gel, and adding a sample and a protein marker into gel pores, wherein each pore is 10 mu L. And adjusting the voltage to 75V, running the glue at constant voltage, and adjusting the voltage to 180V when a protein marker strip appears. Stopping electrophoresis when the sample runs to the bottom of the electrophoresis. And (5) turning off the power supply, taking out the gel plate, and flushing redundant glue running liquid by tap water. The PVDF membrane is activated by methanol for 15 seconds in advance, and is put into a membrane transferring solution together with filter paper and sponge required by membrane transferring. And (3) starting the gel, buckling the gel into a membrane transferring solution, and placing the gel according to the thick sponge, the thick filter paper, the gel, the PPVDF membrane, the thin filter paper and the thin sponge in sequence to prepare the membrane transferring. The voltage was adjusted to 75V and the membranes were spun for 2 hours. And taking out the transferred film, activating by methanol, rinsing by using triple distilled water, displaying protein after 5 minutes of ponceau dyeing, photographing and recording original data, and cutting a small corner at the upper right corner of the film according to the sample adding direction to show a mark. Primary antibody incubation was performed overnight at 4 ℃ and PBST washed 4 times for 5 minutes each. After incubation for 1 hour, the PBST was washed 4 times for 5 minutes each. Finally, the membrane is swept.

Western blot antibody information: primary antibody purchased from Santa cruz: SLC2A1(sc-377228), SLC2A3(sc-74497), HK 1(sc-46695), HK 2(sc-374091), β -actin (sc-47778)

The Western blot results are shown in FIG. 3, and compared with the CS 0d group of mice, the expression levels of glycolytic related proteins (SLC2A1, SLC2A3, HK 1, HK 2) in lung tissues of the CS-exposed group of mice are increased, indicating that the CS exposure promotes glycolysis of lung epithelial cells.

IHC staining was as above, and the results are shown in FIG. 4, which shows that the level of the iron death marker protein PTGS-2 is up-regulated in lung epithelial cells of mice after CS treatment.

(5) Fe in lung tissue²⁺GSH, MDA level determination

Grinding lung tissue of mice of each group to obtain homogenate, centrifuging at 12000rpm and 4 deg.C for 15min, collecting supernatant 0.5ml, adding iron color developing agent 1.5ml, vortex mixing, boiling water bath 5min, cooling with flowing water, centrifuging (2300g, 10min), collecting supernatant 1.0ml, measuring absorbance of each tube at 520nm wavelength, and calculating Fe in each group²⁺Horizontal; taking 100 mu l of the supernatant, adding 100 mu l of the first reagent, uniformly mixing by vortex, centrifuging (3500rpm,10min), taking 100 mu l of the supernatant, sequentially adding two 100 mu l of the reagents and three 25 mu l of the reagents, measuring the absorbance of each tube at 405 wavelengths, and calculating the GSH level in each group; in addition, 100 mul of supernatant is taken, MDA detection working solution (TBA storage solution 50ul, TBA diluent 150ul and antioxidant 3ul) which is prepared in advance is added, vortex mixing is carried out, boiling water bath is carried out for 15min, centrifugation (3000g and 10min) is carried out after running water cooling, 200ul of supernatant is taken, absorbance is measured at the wavelength of 532nm, and the generation amount of MDA in each group is calculated.

Fe²⁺The results of the GSH and MDA assays are shown in fig. 5, and after CS treatment, the GSH levels in the tissues decreased, while MDA production and ferrous ion accumulation increased, indicating that CS caused increased levels of oxidative stress in lung tissues. The results show that iron death is involved in the generation and development of the fibrosis of the lung tissue induced by CS。

(6) The dyeing steps of Sirius red (Sirius red) are as follows:

after paraffin sections are subjected to conventional dewaxing hydration, a proper amount of celestite blue dye solution is dripped for 5-10 minutes, the sections are placed into 1XPBS, washed for 3 times, 5 minutes each time, and then sirius red saturated acid solution is dripped into the sections for 15-30 minutes, absolute ethyl alcohol is used for differentiation after dyeing is finished, and finally gradient ethyl alcohol is used for dehydration, a neutral resin is used for sealing, and results are observed under a microscope.

Results of Sirius red staining are shown in fig. 6, which indicate collagen fibril formation in lung tissue following CS treatment;

(7) the Quantitative real time polymerase chain reaction (Q-PCR/qPCR/rt-qPCR) procedure was as follows:

absorbing the culture solution, washing with PBS once, directly adding a proper amount of TRI zon into the culture dish, standing for 2 minutes, and repeatedly blowing and absorbing with a gun head to fully lyse the cells. The lysed cells were transferred to a 1.5ml EP tube, added with an appropriate amount of chloroform, shaken vigorously 50 times and then allowed to stand for 2 minutes. Centrifuging at 12000rpm at 4 deg.C for 15min, separating the sample into three layers, collecting the upper colorless aqueous layer, adding equal volume of isopropanol, and standing at room temperature for 10 min. Centrifuge at 12000rpm for 20 minutes at 4 ℃ and discard the supernatant. Washing with 75% ethanol for 3 times, each 1 time at 4 deg.C and 12000rpm, centrifuging for 5min, and discarding the supernatant. Air-drying at room temperature, adding 30-100 microliter of RNase-free water, and fully dissolving RNA. After being placed in a water bath tank at 57 ℃ for 8 minutes, the mixture was allowed to stand on ice for 10 minutes.

RT reactions were prepared on ice using PrimeScript RT Master Mix Perfect Real Time kit, as indicated. Setting reverse transcription conditions: 15 minutes at 37 ℃; 5 seconds at 85 ℃; finally, the mixture was placed at 4 ℃. And adding the obtained RT reaction liquid into a Real Time reaction system in the next step. The Real time PCR reaction was performed according to SYBR Premix Ex TaqTM Specification II (Perfect Real time) (Takara code: DRR 081). A PCR reaction solution was prepared as described using a Thermal Cycler Dice Real Time System (Takara Code: TP800) amplification apparatus, and a Real Time PCR reaction was carried out. Primer information is shown in table 1:

TABLE 1 primer information

Primer name	Forward primer	Reverse primer
			FN	CATGAAGGGGGTCAGTCCTA	TAGGTTTGCAGGTCCATTCC
α-SMA	GTCCCAGACATCAGGGAGTAA	TCGGATACTTCAGCGTCAGGA
			TGFβ	GACTCTCCACCTGCAAGACC	GACTGGCGAGCCTTAGTTTG
Arg-1	AAGGCCAACCGTGAAAAGAT	GTGGTACGACCAGAGGCATAC

The QPCR results are shown in FIG. 7, and indicate that the expression level of fibrosis-associated genes (. alpha. -SMA, FN, TGF. beta.) was increased in lung tissues of mice after CS treatment. The results show that after CS treatment, the mouse lung tissue fibrosis is induced to develop.

The IHC staining procedure is the same as above, and the result is shown in FIG. 8, which shows that CS treatment promotes the expression of EMT-related protein N-cad in mouse lung tissues;

the Western results are shown in a figure 9, and the results show that the expression levels of E-cadherin (E-cad) and Vimentin (Vimentin) are increased, the expression levels of E-cadherin (E-cad) and beta-catenin (beta-catenin) are inhibited, and the results show that the CS treatment induces the EMT of the lung epithelial cells of the mice.

Example 2

After HBE cells are treated by CS or iron death inducer Erastin, the cells are collected for QPCR, C11 BODIPY581/591 lipid peroxidation fluorescent probe staining, indirect immunofluorescence staining, western, GSH, MDA and Fe²⁺The level determination comprises the following specific steps:

the QPCR results are shown in figure 10, and after CS treatment, glycolysis-related genes were upregulated in HBE cells, indicating an increased glycolysis process in lung epithelial cells in a CS-induced model of pulmonary fibrosis in vitro.

(1) C11 BODIPY581/591 lipid peroxidation fluorescent probe staining: the cells were removed from the incubator, an appropriate volume of C11 BODIPY581/591 was added to the cells cultured to an appropriate density, incubated for 30 minutes in the absence of light, the culture medium was discarded, 1ml of 1 × PBS was added to wash the cells twice to remove excess dye, and the results were observed using a fluorescence microscope.

The staining result of the C11 BODIPY581/591 lipid peroxidation fluorescent probe is shown in figure 11, and compared with Ctrl group, the green fluorescent signal intensity in cells is obviously enhanced after CS or iron death inducer Erastin treatment.

(2)Fe²⁺GSH and MDA levels are shown in FIG. 12, and compared with the CS group, after treatment with CS or Erastin, which is an iron death inducer, the GSH level in HBE cells is reduced, and MDA is generated and Fe²⁺Accumulation increases.

(3) Live cell indirect immunofluorescence staining: taking out cells from the incubator, discarding the culture solution, adding 1ml of 1XPBS to wash away the residual culture solution; after discarding PBS, 1ml of cold methanol was added for fixation, and after standing on ice for 15 minutes, the remaining liquid was washed off with 1ml of 1XPBS twice, and then on the 2 nd washing, the mixture was placed on a shaker for 3 minutes. And (3) taking the round cover glass out of the culture dish, adding 30-100 mu l of primary anti-alpha-SMA () into the round cover glass, keeping the round cover glass in the dark at room temperature for 50 minutes, washing the round cover glass with PBS for three times, adding a secondary antibody (Kangji, SP Rabbit & Mouse HRP Kit (DAB), Rabbit/Mouse universal Streptavidin-HRP Kit (DAB)), keeping the round cover glass in the dark at room temperature for 1 hour, washing the round cover glass with PBS for three times, adding 70-80 mu l of DAPI into the round cover glass for cell nucleus dyeing, standing the round cover glass for 15 minutes, and observing the result under a fluorescence microscope.

The results of indirect immunofluorescence staining are shown in FIG. 13, and compared with Ctrl group, the intensity of red fluorescence signal in HBE cells is enhanced after treatment with CS or iron death inducer Erastin. The results show that the expression level of the protein alpha-SMA related to the fibrosis of the HBE cells is down-regulated by inhibiting iron death.

The Western results are shown in figure 14, and after the cells are treated by CS or iron death inducer Erastin, the expression levels of iron death related protein and fibrosis related protein in the cells are increased, the expression levels of EMT related protein N-cad and Vimentin protein are increased, and the expression levels of E-cad and beta-catenin protein are reduced.

Example 3

HBE cells are treated with iron death inhibitor Ferr-1 and DFO, and then collected for C11 BODIPY581/591 lipid peroxidation fluorescence probe staining, indirect immunofluorescence staining, western staining, GSH, MDA and Fe²⁺The level determination comprises the following specific steps:

the staining results of the C11 BODIPY581/591 lipid peroxidation fluorescent probe are shown in fig. 15, which shows that the green fluorescence signal intensity in cells is significantly reduced after the administration of the iron death inhibitor, indicating that the CS-induced HBE cell iron death is inhibited and the level of lipid peroxidation in cells is down-regulated.

Fe²⁺GSH, MDA levels are shown in FIG. 16, and when treated with the iron death inhibitor, the GSH level in HBE cells is increased, and MDA is generated and Fe is generated compared with the CS group²⁺Accumulation is reduced.

The results of indirect immunofluorescence staining are shown in fig. 17, and compared with Ctrl group, the intensity of red fluorescence signal in HBE cells is increased after CS treatment, and the intensity of red fluorescence signal in cells is significantly decreased after iron death inhibitor treatment. The results show that the expression level of the protein alpha-SMA related to the fibrosis of the HBE cells is down-regulated by inhibiting iron death.

The Western results are shown in figure 18, and after the treatment of the iron death inhibitor, the expression levels of iron death related protein and fibrosis related protein in the cells are reduced, the expression levels of EMT related protein E-cad and Vimentin protein are increased, and the expression levels of E-cad and beta-catenin protein are inhibited.

The above results indicate that CS induced the EMT process of HBE cells and the level of fibrosis was inhibited after administration of the iron death inhibitor.

Example 4

HBE cells were treated with glycolytic inhibitors 2-DG, 3-PO, BAY876, and collected for C11 BODIPY581/591 lipid peroxidation fluorescent probe staining, indirect immunofluorescence staining, western staining, and GSH, MDA, Fe²⁺The level determination comprises the following specific steps:

the staining result of the C11 BODIPY581/591 lipid peroxidation fluorescent probe is shown in figure 19, and compared with the CS group, the treatment of 2-DG, 3-PO and BAY876 shows that the intensity of a green fluorescent signal is obviously weakened, which indicates that the glycolysis process of HBE cells induced by CS is inhibited, and the lipid peroxidation level of the cells is down-regulated.

Fe²⁺GSH, MDA levels are shown in FIG. 20, and when 2-DG, 3-PO, BAY876 treatment is given, the GSH level is increased in HBE cells, and MDA production and Fe are increased in HBE cells compared with CS group²⁺Accumulation is reduced.

The indirect immunofluorescence results of fig. 21 show: compared with Ctrl group, the intensity of the red fluorescence signal in HBE cells is enhanced after the CS treatment, and the intensity of the red fluorescence signal in HBE cells is obviously weakened after the 2-DG, 3-PO and BAY876 treatments. The results show that the expression level of the fibrosis-related protein alpha-SMA is down-regulated by inhibiting glycolysis.

The Western results are shown in a figure 22, and after treatment by 2-DG, 3-PO and BAY876, the expression level of iron death related protein and fibrosis related protein in cells is reduced, the expression level of EMT related protein N-cad and Vimentin protein is reduced, and the expression level of E-cad and beta-catenin protein is increased.

The above results indicate that CS-induced iron death of lung epithelial cells, EMT processes and levels of fibrosis in lung tissue are inhibited following administration of glycolytic inhibitors.

Example 52-DG, 3-PO, BAY876 intervention particulate dust (CS) induced pulmonary fibrosis model establishment in mice

With 4% chloral hydrateHealthy 6-8 week old male C57BL/6 mice were injected intraperitoneally at 0.1ml/10g for anesthesia. 2 days after mice were pretreated by intraperitoneal injection of 2-DG (600mg/kg), 3-PO (70mg/kg) or BAY876(5mg/kg), non-exposed trachea was perfused with physiological saline or SiO₂A pulmonary fibrosis model was constructed (3 mg/mouse) with glycolytic inhibitor intervention given every 2 days and tissue and alveolar lavage fluid were recovered after 7, 28, and 56 days.

H & E staining results show that after CS treatment, nodules of lung tissue inflammatory cells are formed, inflammatory cell infiltration is increased, lung intervals are thickened, and the lung tissue damage degree of mice treated by 2-DG, 3-PO and BAY876 is obviously reduced.

The results of the measurement of total protein content and LDH content in alveolar lavage fluid show that the contents of protein and lactate dehydrogenase in alveolar lavage fluid are remarkably increased after CS treatment is performed, and the contents of protein and LDH in mice treated by 2-DG, 3-PO and BAY876 are reduced. This suggests that inhibiting glycolysis may be effective in alleviating the occurrence of fibrosis in lung tissue caused by CS.

The IHC staining result shows that the PTGS-2 expression quantity in the lung tissue of the mouse is obviously reduced after the treatment of 2-DG, 3-PO and BAY 876.

Fe²⁺GSH, MDA level measurement results show that after the treatment of 2-DG, 3-PO and BAY876, the GSH level in lung tissues is increased, and the MDA is generated and Fe is generated compared with the CS group²⁺Accumulation is reduced. The above results indicate that inhibition of glycolysis significantly inhibits the occurrence of iron death in lung tissue.

The IHC staining result shows that the expression level of N-cad in the lung tissue of the mice treated by 2-DG, 3-PO and BAY876 is obviously reduced compared with the CS group.

As shown by Western results, after treatment by 2-DG, 3-PO and BAY876, the expression levels of iron death related protein and fibrosis related protein in lung tissues are reduced, the expression levels of EMT related protein N-cad and Vimentin protein are reduced, and the expression levels of E-cad and beta-catenin protein are increased. The results show that glycolysis is inhibited, iron death and EMT processes in lung tissues are blocked, and the fibrosis level of the lung tissues is obviously reduced.

It should be understood that the above examples are only for clarity of illustration and are not intended to limit the embodiments. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. And obvious variations or modifications of the invention may be made without departing from the spirit or scope of the invention.

Claims (10)

1. A silicosis therapeutic target, characterized by: the silicosis treatment target is glycolysis.

2. The application of glycolysis inhibitor in preparing the medicine for treating silicosis is characterized in that: the glycolytic inhibitor is capable of interfering with the glycolytic pathway.

3. Use according to claim 2, characterized in that: the glycolysis inhibitor is a substance interfering with glycolysis of lung epithelial cells.

4. Use according to claim 2, characterized in that: the glycolysis inhibitor is one or more of 2-deoxy-D glucose, a PFKFB3 isoenzyme inhibitor and a Glut1 inhibitor.

5. Use according to claim 2, characterized in that: the medicament is used for treating particle dust induced silicosis.

6. Use according to claim 2, characterized in that: the drug inhibits lung epithelial cell iron death, EMT processes and levels of pulmonary fibrosis.

7. Use according to claim 2, characterized in that: the medicine takes glycolysis inhibitor as an active ingredient and also comprises pharmaceutically acceptable auxiliary materials.

8. An agent that inhibits lung epithelial iron death and EMT, comprising: the agent contains an inhibitor of glycolysis of lung epithelial cells.

9. A kit for diagnosing silicosis, comprising: the kit comprises reagents for detecting glycolysis of lung epithelial cells.

10. The kit of claim 9, wherein: the reagent for detecting glycolysis of lung epithelial cells comprises a reagent for detecting glycolysis-related proteins SLC2A1, SLC2A3, HK 1 and HK 2.

Images