CN109700791B

CN109700791B - Application of neosinomenine in preparing medicine for treating benign prostatic hyperplasia

Info

Publication number: CN109700791B
Application number: CN201910138290.9A
Authority: CN
Inventors: 王嗣岑; 李婷; 徐珂; 贺建宇; 张�杰; 贺浪冲
Original assignee: Xian Jiaotong University
Current assignee: Xian Jiaotong University
Priority date: 2019-02-25
Filing date: 2019-02-25
Publication date: 2021-01-19
Anticipated expiration: 2039-02-25
Also published as: CN109700791A

Abstract

The invention discloses an application of ramaline in preparing a benign prostatic hyperplasia resistant medicament. The invention discovers for the first time that the neolanoline has the obvious effect of resisting benign prostatic hyperplasia, and the effect is mild and lasting. The invention provides a brand-new choice and thought for the treatment of the benign prostatic hyperplasia at present, and also makes a contribution to the development of the technical field; the invention relates to a compound with a definite chemical structure, which can be quantitatively fed when being used for pharmacy and is used for preparing modern dosage forms. The medicine has high safety, and has potential for developing into medicine for treating benign prostatic hyperplasia.

Description

Application of neosinomenine in preparing medicine for treating benign prostatic hyperplasia

Technical Field

The invention relates to a new medical application of neopilatine, in particular to an application of neopilatine in preparing a benign prostatic hyperplasia resistant medicament.

Background

Benign prostatic hyperplasia is a common physiological lesion of old men, has high incidence rate and great pain, is difficult to radically cure, is harmful to people with inevitable population aging, has the service life of people increasing year by year, has the incidence rate greatly improved compared with the prior benign prostatic hyperplasia, and becomes one of the most common senile diseases of the old men in China.

The treatment for benign prostatic hyperplasia can be divided into surgical treatment and drug treatment, however, since benign prostatic hyperplasia patients are high in the years, most patients may have serious cardiovascular and cerebrovascular complications, and the surgical treatment has high risk, the drug treatment for benign prostatic hyperplasia is very important.

Currently, the main drugs clinically used for the treatment of benign prostatic hyperplasia are: (1) synthetic drugs aimed at a particular target only, e.g. 5 alpha-reductase inhibitors, alpha₁Receptor antagonists, etc., but due to benignThe pathogenesis of the prostatic hyperplasia is complex, the treatment course is generally long, and the medicaments can cause adverse reactions such as headache, sexual dysfunction and the like in long-term administration; (2) the natural product preparation is relatively mild in action and relatively small in adverse reaction, and is relatively suitable for long-term administration. And the benign prostatic hyperplasia is related to a plurality of receptors and enzymes, the pathogenesis is complex, and the benign prostatic hyperplasia is considered to be the result of the synergistic action of a plurality of factors, and the natural product preparation for treating the benign prostatic hyperplasia can play a role in multiple targets.

The molecular formula of the neolanoline is C₁₉H₂₂NO₅The chemical name is 3- (2- (dimethylamino) ethyl) -4,5-dihydroxy-1, 6-dimethoxy-9-fluorenone, the English name is 3- (2- (dimethylamino) ethyl) -4,5-dihydroxy-1, 6-dihydroxy-9H-fluoren-9-one, the structure of which is shown in formula (I),

is an active ingredient obtained by screening and separating from the root of Caulophyllum robustum by utilizing cell membrane chromatography. Studies have shown that ramaline has a protective effect on the myocardium. There is no report on the activity of pilocarpine against benign prostatic hyperplasia.

Disclosure of Invention

The invention aims to provide application of neopilatine in preparing a benign prostatic hyperplasia resistant medicament.

In order to achieve the purpose, the invention adopts the following technical scheme:

the application of the neosinomenine in preparing the medicines for resisting the hyperplasia of prostate; the structural formula of the neopiline is as follows:

the invention further improves the application of the neopiline in preparing the medicine for resisting benign prostatic hyperplasia.

In a further improvement of the invention, the medicament is a clinically acceptable pharmaceutical preparation.

The invention further improves that the pharmaceutical preparation is tablets, capsules or granules.

Application of radix Caulophylli extract in preparing medicine for resisting prostatic hyperplasia is provided.

The invention further improves the application of the radix Caulophylli extract in preparing the drugs for resisting benign prostatic hyperplasia.

Compared with the prior art, the invention has the following beneficial effects:

the animal experiment proves that: by adopting the rabbit in vitro prostate muscle band relaxation experiment, the new pilocarpine is found to be capable of obviously reducing the shrinkage of the rabbit prostate muscle band caused by phenylephrine, and the effect of the new pilocarpine is equivalent to that of tamsulosin hydrochloride under high concentration.

On the other hand, by adopting a testosterone propionate-induced benign prostatic hyperplasia model experiment of a mouse, the neopilatine is found to be capable of obviously reducing the visceral organ indexes of the mouse, including a bladder index and a prostate index; meanwhile, the neopilin is found to be capable of obviously reducing the levels of hormones such as prostatic acid phosphatase, testosterone, dihydrotestosterone and the like of benign prostatic hyperplasia model mice; meanwhile, the histological staining of the mouse prostate shows that the neopilin can obviously improve the hyperplasia of prostate epithelial cells and stromal cells.

The invention simultaneously adopts a mouse bladder intubation perfusion model to research the influence of the neolanoline on the lower urinary tract symptoms caused by benign prostatic hyperplasia mice, and finds that the neolanoline can obviously reduce the peak micturition pressure of the mice; meanwhile, the phenomenon of thickening of the bladder wall can be obviously improved by discovering the neopiline through histological staining of the bladder of the mouse. On the other hand, the Adra1a gene of a C57BL/6J mouse is knocked out by using a CRISPR-Cas9 technology, a mouse benign prostatic hyperplasia model is constructed by using testosterone propionate induction, and the improvement effect of the pilocarpine on the mouse organ index of the Adra1a gene knocked-out benign prostatic hyperplasia model is found to be small; meanwhile, the neopilin is found to have small improvement effect on the levels of hormones such as prostatic acid phosphatase, testosterone, dihydrotestosterone and the like of a benign prostatic hyperplasia model mouse knocked out by the Adra1a gene; at the same time passThe histological staining of the prostate of a benign prostatic hyperplasia model mouse with the Adra1a gene knockout proves that the hyperplasia of epithelial cells and stromal cells of the prostate is not obviously improved by the neorubine, which suggests that the neorubine is possibly prepared by alpha_1AReceptor binding plays a role in the resistance of benign prostatic hyperplasia.

Drawings

Fig. 1-1 is a graph showing the effect of pilocarpine and tamsulosin hydrochloride on isolated prostate muscle bar relaxation in rabbits (n ═ 6).

FIGS. 1-2 are dose-response curves of PE contracting isolated rabbit prostate in the presence of the non-competitive antagonist ramalin.

FIGS. 1-3 are Ariens non-competitive antagonism maps.

Fig. 2-1 shows the effect of rambutamine on PI, BI in C57BL/6J mice (n ═ 8).

FIG. 2-2 is a graph of the effect of rambutan on the urinary pressure curve of C57BL/6J mice. Wherein A is a normal control group, B is a sham-operated group, C is a model control group, D is a tamsulosin group, E is a high-dose group of neotame, F is a medium-dose group of neotame, and G is a low-dose group of neotame.

FIGS. 2-3 show the effect of rambutan on bladder tissue morphology in C57BL/6J mice (. times.100). Wherein A is a normal control group, B is a sham-operated group, C is a model control group, D is a tamsulosin group, E is a high-dose group of neotame, F is a medium-dose group of neotame, and G is a low-dose group of neotame.

Fig. 2-4 are graphs showing the effect of rambutan on PAP, T, DHT levels in C57BL/6J mice (n-6). Wherein, A is the influence of the neoramaline on PAP level of C57BL/6J mice, B is the influence of the neoramaline on T level of C57BL/6J mice, and C is the influence of the neoramaline on DHT level of C57BL/6J mice.

FIGS. 2-5 show the effect of rambutan on prostate tissue morphology in C57BL/6J mice (. times.200). Wherein A is a normal control group, B is a sham-operated group, C is a model control group, D is a tamsulosin group, E is a high-dose group of neotame, F is a medium-dose group of neotame, and G is a low-dose group of neotame.

FIG. 3-1 shows the Adra1a of rambutan alkaloid^-/-Gene knockout mouse PI. Effect of BI (n ═ 6).

FIG. 3-2 shows the Adra1a pair of rambutan alkaloids^-/-Influence of the urinary pressure curve of knockout mice. Wherein A is a normal control group, B is a model control group, C is a tamsulosin group, and D is a hispidine group.

FIG. 3-3 shows neolysin Adra1a^-/-Influence of the bladder tissue structure of knockout mice (. times.100). Wherein A is a normal control group, B is a model control group, C is a tamsulosin group, and D is a hispidine group.

FIGS. 3-4 show the Adra1a pair of rambutan bases^-/-Effect of gene knockout mice on PAP, T, DHT levels (n ═ 6). Wherein A is neolanoline pair Adra1a^-/-Effect of PAP levels in mice, B is the neobase couple of ramalin to Adra1a^-/-Effect of mouse T levels, C is Adra1a of Renanthine Palmaria^-/-Effect of mouse DHT levels.

FIGS. 3-5 show the Adra1a pair of rambutan bases^-/-Effect of prostate tissue architecture in knockout mice (× 200). Wherein A is a normal control group, B is a model control group, C is a tamsulosin group, and D is a hispidine group.

Detailed Description

The present invention will be described in detail with reference to the accompanying drawings.

Application of radix Caulophylli extract in preparing medicine for resisting benign prostatic hyperplasia is provided.

Materials and methods

1. Relaxation of isolated prostate gland in rabbits with neorubicin

1.1 Experimental materials

1.1.1 instruments and devices

Multi Myogaph System-610M (Denmark DMT instruments, Inc.); power Lab biological signal acquisition and analysis system (Australian Edd instruments, Inc.); surgical scissors and forceps (Shanghai medical instruments Co., Ltd.); ophthalmic scissors, ophthalmic forceps (WPI corporation, usa); disposable sterile syringes (Jiangxi Jinshan medical devices, Inc.); 10. mu.L, 100. mu.L, 1000. mu.L, 5000. mu.L pipette gun (Eppendorf, Germany); the Ou-Ka-XSP-C series of biomicroscopes (Chongqing photoelectric instruments, Inc.); an electric heating constant temperature water bath (Beijing kingdom Yongxing instruments Co., Ltd.); a circulating water type vacuum pump (Oncorhyne GmbH); -80 ℃ refrigerator (korean LG group); vortexing machines (Haiman, its Linbel instruments, Inc.); petri dishes (Costar, USA); model AS5150A ultrasonic oscillator (waebel instruments, hama, ltd.); a Youtopu water purifier (Chengdou Yopu water purification facility, Inc.); JA1103N electronic balance (shanghai national bridge biotechnology limited).

1.1.2 reagents and materials

Neovillose alkali (HPLC detection mass fraction is more than 98%, self-made in laboratories); tamsulosin hydrochloride (HPLC detection mass fraction > 98%, Wuhan Chi chemical Co., Ltd.); phenylephrine hydrochloride ((R) - (-) -Phenylephrine hydrochloride, PE, shanghai alatin reagent); NaCl powder (research and development center for chemical reagent engineering, guangdong province); KCl powder (research and development center of chemical reagent engineering, Guangdong province); NaH₂PO₄·2H₂O (Jinhua Daichemical Co., Ltd., Guangzhou city); NaHCO 2₃Powder (Tianjin Tianli chemical reagents, Ltd.); CaCl₂Powder (Tianjin Bodi chemical Co., Ltd.); MgCl₂·6H₂Powder O (west longe chemical plant, guangdong Shantou city); DMSO solution (kingdom chemical reagents ltd, guangzhou); chloral hydrate (Shanghai Shanpu chemical Co., Ltd.).

1.1.3 Experimental animals

The quality of the common-grade New Zealand white rabbits is 2.5 kg-3.0 kg of male rabbits, and is provided by the experimental animal center of the Sigan university of transportation.

2 method of experiment

2.1 preparation of the solution

2.1.1 preparation of Kreb's-Henseleit buffer solution

Weighing 27.816g of NaCl and NaHCO₃ 5.04g，KCl 1.372g，NaH₂PO₄·2H₂O0.748 g, placing in a 1000mL beaker, adding 1000mL of triple distilled water, stirring until the mixture is completely dissolved, and weighing MgCl₂·6H₂O 0.976g，CaCl₂0.664g of the mixture is placed in another 1000mL beaker, 1000mL of triple distilled water is added and stirred until the mixture is completely stirredAnd (4) dissolving. Mixing the above two solutions, stirring well, adding triple distilled water to constant volume of 4L, storing in brown bottle at room temperature, adding 1.090g glucose per L when using, and mixing well.

2.12 60mmol·L^-1K⁺Preparation of-Kreb's buffer solution

Weighing KCl 4.474g, NaCl 3.716g and NaHCO₃ 1.260g，NaH₂PO₄·2H₂0.188g of O, stirring with 500mL of triple distilled water until completely dissolved, and weighing MgCl₂·6H₂O 0.244g，CaCl₂0.166g, stirring with 300mL of triple distilled water until the triple distilled water is completely dissolved, then mixing and uniformly stirring the two solutions, adding the triple distilled water to a constant volume of 1000mL, then adding 1.090g of glucose, and storing in a refrigerator at 4 ℃ for later use.

2.1.3 preparation of Hibiscus lanuginosus alkali and tamsulosin hydrochloride concentration gradient solution

The concentration range of the drug used in the experiment is 1 multiplied by 10^-9～1×10^-4mol·L^-1So that the maximum drug concentration is 7X 10^-2mol·L^-1The calculation process is shown in Table 1-1. Weighing appropriate amount of rambutan base or tamsulosin hydrochloride, dissolving in EP tube containing DMSO to obtain final concentration of 7 × 10^-2mol·L^-1The solution (c) is marked as solution No. I; the solution (286. mu.L) is taken, DMSO 714. mu.L is added to prepare 1000. mu.L of 2X 10 concentration^-2mol·L^-1Marked as solution No. 2; taking 100. mu.L of the solution I, adding 900. mu.L of DMSO solution to prepare the solution with the concentration of 7X 10^-3mol·L^-1The solution of (c) is marked as solution No. c; taking 100 mu L of the solution No. 2, adding 900 mu L of DMSO solution to prepare the solution with the concentration of 2 multiplied by 10^-3mol·L^-1The solution of (1) is marked as solution No. IV; taking 100 mu L of solution No. III, adding 900 mu L of DMSO solution to prepare the mixture with the concentration of 7 multiplied by 10^-4mol·L^-1The solution of (1) is marked as solution No. V; taking 100 mu L of solution No. IV, adding 900 mu L of DMSO solution to prepare the solution with the concentration of 2 multiplied by 10^-4mol·L^-1Labeled as solution number |; taking 100 μ L of the solution, adding 900 μ L of DMSO solution to obtain a mixture with concentration of 7 × 10^-5mol·L^-1The solution of (c) is marked as solution (c); getAdding 100 mul of solution, adding 900 mul of DMSO solution to prepare the solution with the concentration of 2 multiplied by 10^-5mol·L^-1Marked as solution # v; collecting 100 μ L solution, adding 900 μ L DMSO solution to obtain a solution with concentration of 7 × 10^-6mol·L^-1The solution of (a) is marked as solution number (ninc); taking 100 μ L of the solution, adding 900 μ L of DMSO solution to obtain a mixture with concentration of 2 × 10^- ⁶mol·L^-1Labeled as solution r; 500 μ L of the solution (Ri # 500) is added into 500 μ L of DMSO solution to prepare the mixture with the concentration of 1 × 10^-6mol·L^-1Is labeled as a solution

Number (n).

TABLE 1-1 calculation procedure for drug solution concentration

2.1.4 preparation of PE concentration gradient solution

Antagonistic action on PE contraction the concentration range of PE used was 1X 10^-9～1×10^-4mol·L^-1So that the maximum drug concentration is 7X 10^-2mol·L^-1The specific calculation process and preparation method are the same as 2.1.3.

2.1.5 preparation of Hibiscus lanuginosus alkali and tamsulosin hydrochloride concentration gradient liquid

pEC of two drugs obtained by experiments on relaxation effect of neorubicin and tamsulosin hydrochloride on PE contraction₅₀For the value, three concentrations of high, medium and low were selected for the experiment. pEC of tamsulosin hydrochloride and rambutan base₅₀Values of 7.29. + -. 0.05 and 5.93. + -. 0.30, respectively. The concentrations of the two drugs used in the experiment are shown in tables 1-2. Because the medicine is diluted by 1X 10 after being added into the bath³Twice, so the concentration of the prepared liquid medicine should be 1 × 10 of the concentration in the table³And (4) doubling.

TABLE 1-2 concentrations of each drug used in the experiments

2.2 measurement of the diastolic Effect on isolated prostate glands of rabbits

2.2.1 preparation of prostate muscle strips

Taking a healthy New Zealand white rabbit, performing anesthesia by chloral hydrate, cutting the lower abdomen, shearing the prostate and the surrounding tissues along the urethra, putting the cut into a watch glass containing precooled Kreb's-Henseleit buffer solution, removing blood stain, carefully removing redundant fat and connective tissues, constructing the prostate tissue into a muscle strip of about 1cm multiplied by 2mm, connecting the muscle strip with a DMT vascular tension measuring system by a thin line, and connecting a computer to record the change of the prostate tension. DMT bath with 95% O₂，5％CO₂Kreb's-Henseleit buffer solution and keep the temperature constant at 37 ℃. After zeroing until there was no longer any major change in prostate tone, the prostate muscle strips were given 4mN pretension, which was adjusted to stabilize within 20 min. After stabilization, the prostatic muscle strips were left at 37 ℃ with 95% O₂，5％CO₂And (4) balancing the saturated Kreb's-Henseleit buffer solution for 60-90 min (replacing the Kreb's-Henseleit buffer solution every 20min during the whole experiment).

2.2.2 testing reactivity of prostate muscle strips

To test the reactivity of the prostatic muscle strips to drugs ex vivo, 60 mmol.L was used before the experiment was started^-1K of⁺Pre-shrinking by Kreb's solution, washing with Kreb's-Henseleit solution for 3 times when the shrinkage reaches a stable platform, and after the tension returns to the baseline level, washing with 60 mmol.L^-1K of⁺-Kreb's solution pre-shrinking, repeating the above process once. If the muscle strips can contract stably and the two contraction platforms are consistent, the function is normal, the experiment can be carried out, and the abnormal muscle strips are not discarded. Formal experiments were started 20min after the tone of the prostatic muscle was stably balanced.

2.2.3 determination of tension

After the balance is finished, Kreb's-Henseleit buffer solution in the bath is subjected to constant volume to 10mL, PE solution is respectively added into the bath after the base line is stable, and stable recovery is obtainedAfter the condensation reaction, the bath is added with concentration gradient solution of neotame or tamsulosin hydrochloride respectively, each concentration is added with 10 μ L, so that the concentration of the drug in the bath is 1 × 10^-9、3×10^-9、1×10^-8、3×10^-8、1×10^-7、3×10^-7、1×10^-6、3×10^-6、1×10^-5、3×10^-5、1×10^-4mol·L^-1Control groups were added to the corresponding volume of DMSO, and the computer recorded the change in tone of the prostatic muscle strips. The percent relaxation (%) of the prostate versus log Drug concentration (log [ Drug ]]) Plotting the curve of the relaxation effect of the two drugs.

2.3 determination of antagonism to PE-induced shrinkage of isolated prostate in rabbits

2.3.1 preparation of prostate muscle strips

The preparation method is the same as 2.2.1.

2.3.2 testing reactivity of prostate muscle strips

The detection method is the same as 2.2.2.

2.3.3 measurement of tension

After the equilibrium is over, 60 mmol.L is used^-1K⁺Pre-shrinking Kreb's buffer solution, flushing with Kreb's-Henseleit buffer solution for 3-4 times after baseline is stabilized, and adding PE solution (1 × 10) into bath tank by using cumulative concentration normal method after tension is restored to baseline level^-9～1×10^-4mol·L^-1) And obtaining a concentration-shrinkage effect curve of the PE. After the maximum contraction effect is obtained, washing the cells for 3-4 times by Kreb's-Henseleit buffer solution, adding the neotame or tamsulosin hydrochloride into the bath tank for incubation for 30min after the tension is balanced, adding an isovolumetric DMSO solution into a control group, and then adding a PE solution (1 multiplied by 10) into the bath tank again^-9～1×10^-4mol·L^-1) And obtaining a concentration-shrinkage effect curve of the second PE. By comparing the influence of the neopilin and tamsulosin hydrochloride on the contraction effect caused by PE on the isolated prostate muscle strips of the control group, the antagonism of the neopilin on the isolated prostate contraction of the rabbits is further analyzed.

2.4 data processing and statistical analysis data are expressed as mean ± standard error (mean ± SEM), Graphpad Prism 6 software is used for graph plotting, statistical analysis is performed on data using SPSS 24.0, independent sample t test is used for measurement data comparison between two groups, and one-way analysis of variance (ANOVA) is used for repeated measurement data. P < 0.05 is used as a difference significance threshold value.

3 Effect of pilocarpine on benign prostatic hyperplasia model in mice

3.1 instruments and materials

3.1.1 instruments

The system comprises a heating plate, a BL-420S biological function experiment system, a pressure transducer, a venous indwelling needle, a constant-temperature water bath, an infusion pump, a high-speed refrigerated centrifuge, a microscope, an electronic analysis balance and an enzyme mark instrument;

3.1.2 reagent rambutan (self-made in laboratory, HPLC detection mass fraction > 98%), chloral hydrate, tamsulosin hydrochloride, testosterone propionate, camellia oil, paraformaldehyde solution, prostatic acid phosphatase kit, testosterone ELISA kit, dihydrotestosterone ELISA kit, surgical scissors, surgical forceps, ophthalmic scissors, curved forceps, petri dishes, wire gloves, 2 × Hieff TM PCR Master Mix (With Dye) (Shanghai san Biotech Co., Ltd.);

3.1.3 male C57BL/6J mice of 80 experimental animals, 7-8 weeks old, with individual mass of 20 +/-2 g, provided by the Experimental animals center of the university of transportation of Xian, SCXK (Shaan) 2012 and 003; alpha is alpha_1AGene knockout homozygote (Adra 1)^-/-) The mice were purchased from Nanjing university-Nanjing biomedical research institute, strain C57BL/6J, and were bred and bred in the laboratory animal center of the university of Western-Ann transportation according to the SPF-level animal breeding standard. Taking male alpha at the time of use_1AThe gene knockout mice are 24, 7-8 weeks old and 20 +/-2 g in individual mass. During the experiment, the mice were freely fed with water at room temperature 22, humidity 55, ventilation, 12h/12h light and dark cycle.

3.2 methods

3.2.1 Breeding and genotyping of Adra1 knockout mice

Extracting genome DNA:

a. the mice grew to 3 weeks of age, and about 1cm of rat tail tissue was cut at the tip of the tail, placed in a 1.5mL EP tube, and minced.

Add 180. mu.L Buffer GTT to the EP tube and mix well with shaking.

b. Add 20. mu.L of protease K, vortex and mix thoroughly.

c. Incubated overnight in a 56 ℃ water bath until the tissue solution was completely clear, and vortexed during incubation to disperse the sample evenly.

d.12000rpm centrifugation for 1min to remove undigested tissue like rat hair. The supernatant was transferred to a new EP tube.

e. Add 200. mu.L Buffer GL, vortex and mix well. Add 200. mu.L of absolute ethanol, vortex, and mix well. Adding all the obtained solution into an adsorption column filled in a collecting tube, centrifuging at 12000rpm for 1min, pouring off waste liquid in the collecting tube, and replacing the adsorption column in the collecting tube again.

f. mu.L of Buffer GW1 (absolute ethanol was added before use) was added to the adsorption column, centrifuged at 12000rpm for 1min, the waste liquid in the collection tube was decanted, and the adsorption column was replaced in the collection tube.

g. mu.L of Buffer GW2 (absolute ethanol was added before use) was added to the adsorption column, centrifuged at 12000rpm for 1min, the waste liquid in the collection tube was decanted, and the adsorption column was replaced in the collection tube.

Centrifuging at 12000rpm for 2min, and pouring off waste liquid in the collecting pipe. The adsorption column was left at room temperature for 5min to completely dry the residual liquid in the adsorption material.

i. The adsorption column was placed in a new EP tube, 100. mu.L of buffer GE was suspended in the middle of the adsorption column, left at room temperature for 5min, centrifuged at 12000rpm for 1min, the DNA solution was collected and stored at-20 ℃.

Polymerase Chain Reaction (PCR)

The extracted DNA is quantified by a microplate reader, 200ng of genome DNA extracting solution is taken, and the following primers are applied:

primer 1: 2837-Adra1a-in-5F1 CTAATTGCGTGGATGCACAGGATGG

2837-Adra1a-in-3R1 GGCTGTTCCCAGTGGATTGGCTTC

Primer 2: 2837-Adra1a-in-5F1 CTAATTGCGTGGATGCACAGGATGG

2837-Adra1a-in-5R1 GCCACAGCCAGGTTGACAATGTAGT

The PCR reaction system was 50. mu.L, prepared on ice as follows:

the amplification procedure was as follows:

agarose gel electrophoresis

0.3g agarose is weighed and dissolved in 30mL TBE buffer solution, placed in a microwave oven and heated until completely melted, taken out and shaken well, and 1 mu L Ethidium Bromide (EB) is added. After the agarose solution is cooled, the agarose solution is poured into a rubber plate gently, and a comb is inserted. And after the agarose gel is cooled, adding electrophoresis buffer solution into the electrophoresis tank, and pulling out the comb. And (3) uniformly mixing the DNA sample and the sample adding buffer solution according to the volume ratio of 4: 1, adding the mixed solution into sample wells by using a micropipette, adding 20 mu L of the mixed solution into each well, and recording the sample adding sequence. Connecting a power supply, carrying out electrophoresis at 100V for 30min, placing the gel image in a gel imager for observation and photographing.

Judgment of identification result

Wild-type mice: the DNA fragment has a band of 565bp only

Homozygous mice: has only 609bp band

Heterozygote mice: at the same time, there are 565bp and 609bp bands

3.2.2 animal groups and experiments

After being adapted for one week, 56C 57BL/6J mice were randomly divided into 7 groups according to individual mass, which are respectively: a normal control group, a sham operation group, a model control group, a positive drug (tamsulosin hydrochloride) group and a low, medium and high dose group of the neotame. Except for the normal control group and the sham operation group, the abdomen of the other 5 groups of miceChamber injection testosterone propionate 5mg kg^-1·d^-1Normal control group is injected with normal saline, and sham operation group is injected with camellia oil, and the injection is continuously carried out for 21 d. After the molding is finished, the low-medium and high-medium dosage groups of the neosinomenine are respectively 12.5 mg.kg^-1·d^-1、25mg·kg^-1·d^-1、50mg·kg^-1·d^-1Gavage, positive medicine group gavage 0.03 mg.kg^-1·d^-1Tamsulosin hydrochloride, normal control group intragastric normal saline, sham operation group and model control group intragastric 0.5% CMC-Na for 28 days continuously, and after last intragastric administration, fasting for 24h and weighing.

3.2.3 urodynamic examination

C57BL/6J mouse intraperitoneal injection of 400 mg-kg of 4% chloral hydrate^-1Fixing the supine position, preparing skin, sterilizing, taking down the abdominal incision, cutting the abdominal cavity on the pubic symphysis to find the bladder, inserting the venous cannula into the bladder from the top of the bladder at 30 degrees, and connecting the infusion pump and the pressure sensor at the far end of the venous cannula. The pressure sensor is connected with the BL-420S biological skill experiment system, and the infusion pump feeds the physiological saline at a rate of 2 mL.h^-1The bladder is perfused continuously until micturition reflex appears or urine begins to overflow around the ureter, the micturition pressure curve is recorded by using a BL-420S biological skill experimental system and the micturition pressure (VMP), the Micturition Basal Pressure (MBP), the Micturition Threshold Pressure (MTP), the micturition interval (ICI), the Micturition Time (MT), the micturition contraction frequency (VC) and the non-micturition contraction frequency (NVCs) of the bladder are observed and recorded.

3.2.4 organ index measurement and histopathological examination

After urodynamic examination, blood was collected from the eyeball of the mouse, and after clotting at 4 ℃ for 30min, 3000 rpm-min at 4 ℃^-1Centrifuging for 30min, separating upper layer serum, and storing in refrigerator at-80 deg.C. After the mice were sacrificed by cervical dislocation, the skin and muscles of both ventral sides were cut along the groin of both sides until under the costal margin. The cut abdominal skin muscles are turned to the chest, so that the abdominal viscera are fully exposed. Two white or grey-white seminal vesicle glands are arranged at the left and right sides of the front side of the urinary bladder at the back of the abdominal cavity of the mouse, and the root of the seminal vesicle is close to the urinary bladder. On the inside of the two seminal vesicle glands, one prostate was placed next to each other from 1/3 or 2/3 down from the top. On the side of the prostateA thin blood vessel is arranged on the surface of the seminal vesicle, and the thin blood vessel is tightly tied with the seminal vesicle gland. The blood vessels spanning the two glands were cut at the white crossing point, the prostate was isolated, the root of the prostate was clamped, and the prostate was completely removed. The bladder of the mouse was pushed to the anterior side with forceps and two white pieces of adipose tissue were visible behind it. The tissue is then flipped or extirpated to reveal the two prostate glands immediately adjacent to the sphincter vesicae. The prostate on the posterior side of the bladder can be removed completely by holding the root of the prostate with forceps. The tissue surrounding the prostate was peeled off, weighed rapidly, and immediately thereafter the prostate tissue was fixed with 10% formalin in a refrigerator at 4 ℃ for 2-4 hours in preparation for the preparation of paraffin sections. The prostate and bladder were removed from the mice, washed with ice saline, the fat and connective tissue around the prostate and bladder were removed, the leaf prostate was carefully separated, the surface moisture was blotted off with filter paper, the mouse prostate and bladder wet weights were weighed with an electronic balance and the Prostate Index (PI) and Bladder Index (BI) were calculated.

Prostate index ═ wet mass of prostate (mg)/mass of mouse (g)

Bladder index ═ wet mass of bladder (mg)/mass of mouse (g)

Histopathological examination (HE staining of prostate and bladder tissue)

Taking right side leaf of prostate or whole bladder, fixing with 10% paraformaldehyde solution, dehydrating, clearing, soaking in wax, embedding for 24 hr, and placing the embedded wax block in refrigerator at 4 deg.C overnight for slicing the next day. Checking whether the slicer is normal or not, wherein the blade is inserted at an inclination angle of 10-20 degrees, the included angle between the wax block and the surface of the blade is 5 degrees, cutting the tissue block into slices with the thickness of 5 microns, placing the slices into a slice unfolding box (the water temperature is about 50 ℃), unfolding and airing the slices, pasting the slices on a glass slide, and writing numbers. After baking the slices in a constant temperature oven at 60 ℃ for 30-60 min, respectively dewaxing the xylene I-xylene II for 15min, wherein the dewaxing time is different in different seasons, and the dewaxing time is longer in winter. Rinsing with 100% alcohol, rinsing with 95% alcohol, 80% alcohol, 70% alcohol and distilled water, washing with distilled water, dewaxing, staining with hematoxylin for 5-10 min, soaking with distilled water for 2-5 s, differentiating with 1% hydrochloric acid alcohol for about 5s, washing with distilled water according to bluing condition observed under microscope, and terminating differentiation. And controlling the time for washing blue by tap water according to the definition of cell nuclei observed under a microscope, wherein the time is about 15min, the cell nuclei are re-dyed by 0.5% eosin water for 1-2 min, and the cell nuclei are washed by tap water for 30 s. The method comprises the steps of dehydrating 85% alcohol-90% alcohol-95% alcohol-100% alcohol for 2min step by step, carrying out transparent 2 min-neutral gum sealing on xylene I-xylene II-xylene III, labeling, observing under a common optical microscope, and taking pictures according to pathological histological changes of prostate cavity size, whether secretion exists in the cavity, the thickness of glandular epithelium, whether glandular epithelial cells protrude into the glandular cavity or not, cell arrangement, arrangement among glands, whether interstitial and smooth muscle are increased, nucleus positions and the like of each group of mice.

3.2.5 determination of mouse Prostatic Acid Phosphatase (PAP) levels

Principle of detection

The enzyme-linked immunosorbent assay (ELISA) is adopted for determination by a double antibody sandwich method. The specimen, the standard and the detection antibody marked by HRP are sequentially added into the coated micropores previously coated with the capture antibody of the mouse Prostatic Acid Phosphatase (PAP), and are incubated and washed thoroughly. The color is developed with the substrate TMB, which is converted to blue by the catalysis of peroxidase and to the final yellow color by the action of an acid. The shade of color was positively correlated with the mouse Prostatic Acid Phosphatase (PAP) in the sample. The absorbance (OD value) was measured at a wavelength of 450nm with a microplate reader, and the sample concentration was calculated.

The determination step comprises:

a. the desired panel was removed from the aluminum foil bag after equilibration for 20min at room temperature, and the remaining panels were sealed with a zip-lock bag and placed back at 4 ℃.

b. And arranging a standard product hole and a sample hole, wherein 50 mu L of standard products with different concentrations are added into the standard product hole respectively.

c. The sample hole to be tested is firstly added with 10 mu L of sample to be tested, and then added with 40 mu L of sample diluent.

d. Then, 100. mu.L of detection antibody labeled with horseradish peroxidase (HRP) was added to each of the standard wells and the sample wells, the reaction wells were sealed with a sealing plate film, and incubated in a water bath or an incubator at 37 ℃ for 60 min.

e. The liquid was discarded and patted dry on absorbent paper and the plate was washed 5 times in this way.

f. 50. mu.L of substrate A, B was added to each well and incubated at 37 ℃ for 15min in the absence of light.

g. Add stop solution 50. mu.L per well, measure OD value of each well at 450nm wavelength within 15 min.

h. And (4) taking the concentration of the standard substance as an abscissa and taking the corresponding OD value as an ordinate, drawing a linear regression curve of the standard substance, and calculating the concentration value of each sample according to a curve equation.

3.2.6 mouse Testosterone (T) level determination

Principle of detection

Enzyme-linked immunosorbent assay (ELISA) using double antibody sandwich method is adopted. The specimen, the standard and the detection antibody marked by HRP are sequentially added into the coated micropores previously coated with the capture antibody of the mouse Prostatic Acid Phosphatase (PAP), and are incubated and washed thoroughly. The color is developed with the substrate TMB, which is converted to blue by the catalysis of peroxidase and to the final yellow color by the action of an acid. The shade of the color was positively correlated with mouse testosterone (T) in the sample. The absorbance (OD value) was measured at a wavelength of 450nm with a microplate reader, and the sample concentration was calculated.

The determination step comprises:

3.2.7 mouse Dihydrotestosterone (DHT) level determination

Reagent preparation

a. All reagents and samples to be tested were equilibrated at room temperature for 20min prior to the experiment.

b. Concentrated washing solution: dilute with double distilled water (1: 25).

c. Mouse DHT standard (lyophilized powder): adding 1mL of standard dilution into each bottle of standard, standing at room temperature for 30min, reversing, mixing, and dissolving to obtain a solution with a concentration of 2000 pg. multidot.mL^-1.7 dilution standard EP tubes were prepared, and 300uL of the standard dilution was added to each EP tube and diluted twice at a time to 2000 pg. multidot.mL^-1，1000pg·mL^-1，500pg·mL^-1，250pg·mL^-1，125pg·mL^-1，62.5pg·mL^-1，31.2pg·mL^-1Standard dilution (0 pg. mL)^-1) Directly as a blank well.

d. Detection solution a and detection solution B: the liquid on the tube wall or the bottle cap flows to the tube bottom by instantaneous centrifugation before use. Using detection diluent A or B according to the ratio of 1: diluting and mixing evenly according to the proportion of 100.

e. Color development solution: and (3) mixing the color developing agent A and the color developing agent B according to the weight ratio of 9: 1 proportion and mixing.

Measurement procedure

b. And setting standard product holes and sample holes, wherein 100 mu L of standard products with different concentrations are added into the standard product holes respectively. 20 mu L of sample to be detected is added into the sample hole to be detected, and 80 mu L of sample diluent is added into the sample hole to be detected. The reaction wells are sealed with a sealing plate film and incubated for 90min in a 37 ℃ water bath or thermostat.

c. Discarding liquid in the hole, adding 350uL of washing liquid into each hole, soaking for 1min, throwing off liquid in the enzyme label plate, forcibly discharging on absorbent paper for several times to absorb residual liquid in the hole, and repeating for 3 times. And (5) finally, washing, namely completely drying the liquid in the holes.

d. Add 100uL of detection solution A to each well, seal the reaction well with a sealing plate, and incubate at 37 ℃ for 60min in a water bath or thermostat.

e. The plate was washed 3 times, then 100uL of detection solution B was added to each of the standard and sample wells, the reaction wells were sealed with a sealing plate film, and incubated in a 37 ℃ water bath or incubator for 30 min.

f. Washing the plate for 5 times, adding 100uL of color development solution into each hole, covering a film, and incubating for 10-15 min at 37 ℃ in a dark place.

Color development was immediately terminated when the high concentration standards were observed to be darker in color and a color gradient was apparent.

g. 100uL of the stop solution was added to each well, and the OD value of each well was measured at a wavelength of 450nm within 10 min.

3.2.8 data handling and statistical analysis data are expressed as mean ± standard error (mean ± SEM), Graphpad Prism 6 software was used for charting, data were statistically analyzed using SPSS 24.0, independent sample t-tests were used for metrology data comparison between groups, and one-way analysis of variance (ANOVA) was used for repeated measurements. P < 0.05 is used as a difference significance threshold value.

Second, experimental results

1 Fulvine relaxation of isolated prostate in rabbits

1.1 measurement of the diastolic Effect on isolated prostate glands of rabbits

The in vitro experimental data of tamsulosin hydrochloride and rambutan are shown in tables 1-3 and fig. 1-1, and both of them can show obvious relaxation effect on isolated prostate of domestic rabbit. It pEC₅₀The values are all larger, indicating that the same relaxation response can be achieved with a smaller concentration of pilocarpine.

Tables 1-3 pEC of isolated prostate relaxation by rambutamine and tamsulosin hydrochloride₅₀Value (n ═ 6, mean ± SEM)

Name of drug	Tamsulosin hydrochloride	New alkali for red hair
			pEC₅₀	7.29±0.05	5.93±0.30

As can be seen from tables 1-3 and FIGS. 1-1, pEC of ramaline₅₀A value of 5.93. + -. 0.30, although less than tamsulosin pEC₅₀The value, however, is 1X 10 for rambutan^-4mol·L^-1The time-relaxation effect is similar to tamsulosin, which indicates that the hispidine can relax isolated prostate better and the effect is mild and lasting.

1.2 determination of antagonism to PE-induced shrinkage of isolated prostate in rabbits

This experiment investigated the neokaline pair of red hair alpha_1A-antagonism of isolated prostate contraction by AR agonists, figure 1-2 antagonism of isolated prostate contraction by phendroxyepine. As can be seen from FIGS. 1-2, the neoramaline has a certain degree of relaxation effect on isolated prostate at a certain concentration, and the action mode is non-competitive antagonism. Noncompetitive antagonism means that the antagonist drug is bound with the receptor by a covalent bond and is in an irreversible state or is not a covalent bond, but the dissociation is slow after the binding, and the two conditions can cause the quantity-effect curve of the agonist to move to the right in a nonparallel way and reduce the maximum effect. Using pA in general₂' denotes the negative logarithm of the molar concentration of the noncompetitive antagonist at which the maximum effect of the agonist is reduced by half. The Ariens non-competitive antagonist action formula is:

E_AB＝E_A×[1/(1+[B]/K_B)] (1)

E_Aand E_ABRespectively at the concentration of added antagonist [ B]Maximal effect of the agonist before and after. Equation (1) is equivalent to:

[E_A]/[E_AB]＝1+[B]/K_B (2)

let [ E)_A]/[E_AB]For R, taking the logarithm on both sides of the equal sign, equation (2) becomes:

Log(R-1)＝-(-log[B])+(-logK_B) (3)

using log (R-1) as Y, -log [ B ]]For X, the equation may be in the form of the linear equation Y ═ a + bX. When R is 2, pA₂’＝-log[B]＝-a/b。pA₂' indicates the magnitude of the non-parallel competition effect. FIGS. 1 to 3 show the non-competitive antagonism of Arien, and pA of pilocarpine can be seen from FIGS. 1 to 3₂' value 5.87.

2 Effect of pilocarpine on benign prostatic hyperplasia model in mice

2.1 general conditions of the laboratory animals

No mice die in the experimental process, and each group of mice has flexible activity, good mental state and normal drinking water and food intake.

2.2 Effect of Renanthine on mouse organ index

Table 2-1 effect of rambutan on PI, BI in C57BL/6J mice (n ═ 8, mean ± SEM)

As shown in Table 2-1 and FIG. 2-1, the drug had no significant effect on the body weight of the mice; the high dose group of hispidine significantly reduced prostate and bladder indices in mice.

2.3 Effect of pilocarpine on lower urinary tract symptoms caused by benign prostatic hyperplasia in mice

Table 2-2 effect of rambutan on urodynamic parameters in C57BL/6J mice (n ═ 8, mean ± SEM)

As shown in table 2-2 and fig. 2-2, pilocarpine can significantly improve the increase in peak micturition pressure caused by benign prostatic hyperplasia in mice; as can be seen from fig. 2-3, rambutan significantly ameliorates the phenomenon of compensatory thickening of the bladder wall caused by benign prostatic hyperplasia.

2.4 Effect of pilocarpine on the levels of hormones associated with benign prostatic hyperplasia in mice

Table 2-3 effect of rambutan on PAP, T, DHT levels in C57BL/6J mice (n ═ 6, mean ± SEM)

As shown in tables 2-3 and figures 2-4, high doses of pilocarpine significantly reduced the levels of acid phosphatase, testosterone and dihydrotestosterone in mice; as can be seen from fig. 2-5, pilocarpine can reduce the proliferation of prostate epithelial cells and stromal cells. The results suggest that the neopilin has a better therapeutic effect on benign prostatic hyperplasia of normal mice.

3 Redox couple Adra1a^-/-Effect of mouse benign prostatic hyperplasia model

3.1 Renanthramine Palmaria 1a^-/-Effect of mouse organ index

TABLE 3-1 Renanthe Palmaria Adra1a^-/-Influence of PI and BI in knockout mice (mean. + -. SEM, n ═ 6)

As shown in Table 3-1 and FIG. 3-1, the prostate hyperplasia degree was smaller in the knockout mice as compared with that in the wild-type mice, and two kinds of α_1AThe receptor antagonist had a weak effect on mice, demonstrating alpha_1AThe receptor may be involved in the pathogenesis of prostatic hyperplasia.

3.2 Renanthe-Adra 1a^-/-Effect study of lower urinary tract symptoms caused by benign prostatic hyperplasia in knockout mice

TABLE 3-2 Renanthe pairs Adra1a^-/-Influence of urodynamic parameters in knockout mice (mean ± SEM ═ 6)

As shown in table 3-2 and fig. 3-2, except for the threshold pressure of urination, there was no significant difference in urination parameters between the positive drug group and the hispidulin group and the benign prostatic hyperplasia model group, and as can be seen from fig. 3-3, the thickening of the bladder wall was not significant in the model control group compared with the blank control group, and there was no significant difference in the drug-treated group compared with the model group.

3.3 Renanthe Palmaria Adra1a^-/-Effect of Gene knockout mice on levels of related hormones

TABLE 3-3 Renanthe Palmaria Adra1a^-/-Influence of PAP, T, DHT levels in knockout mice (n ═ 6, mean. + -. SEM)

As can be seen from tables 3 to 3 and fig. 3 to 4, there was no significant difference between the model control group and the blank control group and between the administration group and the model control group in the knockout mice. The above results suggest α_1AThe absence of the receptor may affect the onset and treatment of benign prostatic hyperplasia diseases.

And (4) conclusion: the neorubicin can remarkably relax the shrinkage of isolated prostate of rabbit caused by phenylephrine, and pEC thereof₅₀The value was 5.93. + -. 0.30; and the mode of action is non-competitive antagonism, antagonism parameter pA₂' value 5.87. On the other hand, the pilocarpine can obviously improve the organ index rise and the lower urinary tract symptom caused by benign prostatic hyperplasia of mice, and has obvious improvement effect on the hormone level rise caused by the benign prostatic hyperplasia; after the Adra1a gene is knocked out, the improvement effect of the neosine pilocarpus on the benign prostatic hyperplasia symptoms of the mice is greatly reduced compared with that of normal mice, and the possible effect target point of the neosine pilocarpus is suggested to be alpha_1AThe adrenergic receptors, the specific mechanisms of action, are still subject to further experimental investigation.

Claims

1. The application of the neosinomenine in preparing the medicines for resisting the hyperplasia of prostate; the structural formula of the neopiline is as follows:

2. the use of claim 1, wherein: application of neopiline in preparing medicine for treating benign prostatic hyperplasia is disclosed.

3. Use according to claim 1 or 2, characterized in that: the medicine is a clinically acceptable pharmaceutical preparation.

4. Use according to claim 3, characterized in that: the pharmaceutical preparation is tablets, capsules or granules.