CN112716940A - Application of canagliflozin in preparation of medicine for treating STAT6 protein-related diseases - Google Patents

Abstract

The invention relates to an application of canagliflozin in preparation of a medicine for treating STAT6 protein-related diseases, and belongs to the technical field of biology. The canagliflozin can resist renal interstitial fibers by inhibiting STAT6 protein expression; cana is used for intragastric administration in a renal interstitial fiber model caused by ligation of a unilateral ureter of a mouse, renal interstitial fibrosis of the mouse is improved, and potential medicines and new ideas are provided for treating diseases such as renal interstitial fiber and the like related to STAT6 protein.

Description

Application of canagliflozin in preparation of medicine for treating STAT6 protein-related diseases

Technical Field

The invention relates to the field of biological medicines, and particularly relates to an application of canagliflozin in preparation of a medicine for treating diseases related to STAT6 protein.

Background

Canagliflozin (Cana) having a chemical formula C₂₄H₂₅FO₅S is white to off-white powder, is almost insoluble in water, can be freely dissolved in ethanol, has a melting point of 68-72 ℃, is stable under high temperature and humidity conditions, slowly degrades under alkaline and peroxide conditions, and is unstable under photolysis and free radical oxidation conditions. Cana is a sodium-glucose cotransporter 2(SGLT-2) inhibitor, can inhibit reabsorption of glucose by the kidney, enables excessive glucose to be discharged from urine, and accordingly reduces blood sugar, and is a novel antidiabetic drug. Previous researches show that the SGLT-2 inhibitor can improve cardiovascular and renal risk factors such as glycosylated hemoglobin, blood pressure, body weight, proteinuria and the like, and achieves the effects of protecting cardiovascular and delaying renal function decline. Recent experimental studies have shown that Cana can reduce plasma concentrations of TNFR1, IL-6, MMP7 and FN1 in patients with type 2 diabetes and hyperproteinemia, potentially helping to reverse molecular processes associated with inflammation, extracellular matrix and fibrosis. In addition, animal experiments show that Cana can reduce the weight, fat mass and white adipose tissue weight of mice, inhibit fat cell hypertrophy and improve glycolipid metabolism disorder caused by high-fat diet. However, no studies have been focused on the role and effector mechanisms of Cana in renal fibrotic lesions.

Renal interstitial fibrosis is a common pathological feature of kidney diseases and a common pathological cause of the progression of chronic kidney diseases to end-stage renal failure. Recent statistics have shown that the prevalence of chronic kidney disease is increasing in developing and developed countries and is expected to remain on this increasing trend for the next few decades. Chronic kidney disease has become a global public health problem threatening human health. Renal interstitial fibrosis is characterized by accumulation of fibroblasts, overproduction and deposition of extracellular matrix, and loss of functional nephrons, and no effective treatment for renal interstitial fibrosis is currently available.

The Signal Transducer and Activator of Transcription (STAT) family is composed of transcription factors that play a complex and important role in the regulation of physiological processes such as cell proliferation, differentiation, apoptosis, and angiogenesis. STAT6 is phosphorylated and then transcribed into nucleus, and after being connected with CREB-binding protein (CBP), it activates downstream cell factors to play corresponding biological action. In renal interstitial fibers, the JAK3/STAT6 signaling pathway plays an important role in the activation of bone marrow-derived fibroblasts, the production of extracellular matrix, and the development of interstitial fibrosis.

Therefore, the research on the role of canagliflozin on the JAK3/STAT6 signaling pathway to treat related diseases is a problem to be solved urgently by the technicians in the field.

Disclosure of Invention

In order to solve the technical problems, the invention aims to provide an application of canagliflozin in preparing a medicament for treating diseases related to STAT6 protein, and provides a new theory and potential medicament for clinically treating the diseases related to STAT6 protein, especially chronic kidney diseases.

In order to achieve the purpose, the invention adopts the following technical scheme:

in one aspect, the invention discloses an application of canagliflozin in preparing a medicament for treating diseases related to STAT6 protein.

Further, diseases related to STAT6 protein include renal interstitial fibrosis, pulmonary interstitial fibrosis, acute lung inflammation, and the like.

Canagliflozin can resist diseases related to STAT6 protein such as renal interstitial fibrosis by inhibiting STAT6 protein expression.

Further, the dosage form of the medicine is oral medicine.

In another aspect, the invention discloses the use of canagliflozin in the preparation of an autophagy inducing agent and in the preparation of a medicament for inducing autophagy in the treatment of a disease that can benefit from autophagy induction.

Further, the autophagy inducer is used for inducing autophagy of human tubular epithelial cells and alveolar epithelial cells.

Further, diseases that can benefit from autophagy induction include renal interstitial fibrosis, pulmonary interstitial fibrosis, asthma, acute pulmonary inflammation, and the like.

Further, the dosage form of the medicine is oral medicine.

In the invention, the structural formula of canagliflozin is as follows:

by the scheme, the invention at least has the following advantages:

the invention discloses an application of canagliflozin in preparing a medicament for treating STAT6 protein-related diseases, which can resist renal interstitial fibrosis by inhibiting STAT6 protein expression; in a mouse renal interstitial fibrosis model caused by unilateral ureteral ligation, Cana is used for gastric lavage, the mouse renal interstitial fibrosis is improved, and potential medicines and new ideas are provided for treating diseases such as renal interstitial fibrosis and the like related to STAT6 protein; cana can resist chronic renal fibrosis by inhibiting STAT6 protein expression to up-regulate PPAR alpha pathway, and provides a new theory and potential drug for clinical treatment of chronic renal diseases.

The foregoing description is only an overview of the technical solutions of the present invention, and in order to make the technical solutions of the present invention more clearly understood and to implement them in accordance with the contents of the description, the following description is made with reference to the preferred embodiments of the present invention and the accompanying detailed drawings.

Drawings

FIG. 1 shows the results of H & E staining and oil red staining of kidney tissues of mice in each group according to the present invention;

FIG. 2 shows the results of sirius red staining of kidney tissues of various groups of mice according to the present invention;

FIG. 3 shows the results of detecting STAT6 and fibrosis-associated protein expression levels in kidney tissue lysates of various groups of mice according to the present invention using Western Blot;

FIG. 4 shows the results of qRT-PCR detection of mRNA expression levels of various groups of kidney tissues of various groups of mice according to the present invention;

FIG. 5 shows the results of H & E staining and oil red staining of kidney tissues and measurement of triglyceride content level of mice in each group;

FIG. 6 shows the results of qRT-PCR detection of the fat metabolism-related mRNA expression levels in each group of mouse kidney tissues according to the present invention;

FIG. 7 shows the half-life test results of intracellular STAT6 in HK2 according to the present invention;

FIG. 8 shows the results of Western Blot detection of STAT6 ubiquitination levels after the HK2 cells of the present invention were administered with Cana treatment;

FIG. 9 shows the results of Western Blot detection of the expression level of autophagy marker proteins in HK2 cells of the present invention administered with different doses of Cana treatment;

FIG. 10 shows the results of qRT-PCR detection of the expression level of mRNA as an autophagy marker in HK2 cells treated with different doses of Cana;

FIG. 11 shows the immunofluorescence assay of HK2 cells of each group according to the present invention;

FIG. 12 shows the results of H & E staining and sirius red staining of kidney tissues of various groups of mice according to the present invention;

FIG. 13 shows the measurement results of the triglyceride level in the kidney tissue of each group of mice according to the present invention;

FIG. 14 shows the results of Western Blot analysis of kidney tissue lysates of various groups of mice according to the present invention for detecting the expression levels of proteins related to fibrosis, lipid metabolism, autophagy, etc.

Detailed Description

The following examples are given to further illustrate the embodiments of the present invention. The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention.

Healthy 6-8 week old male Stat6, ATG7 wild type (Stat 6)^+/+、Atg7^+/+) Mice were purchased from the laboratory animal center, academy of sciences, China, weighing 18-20g, SPF grade. Stat6^flox/floxMouse purchased from Atg7 Biotech Ltd^{flox /flox}From the Proc of Suzhou university medical college Wang Jian Rong professor topic group, weight 18-20g, SPF grade, Stat6^flox/flox、Atg7^{flox /flox}Mating with marrow cell specific knockout tool mice respectively to obtain Stat6^-/-、Atg7^-/-A mouse. The mice are all raised in SPF level experimental animal center in the school district of Duvilla lake of Suzhou university. The environment of the experimental animal is constant temperature and humidity, the room temperature (23 +/-2 ℃) is 50-60% of relative humidity, the illumination time is according to the circadian rhythm, and the animal can keep drinking water and ingesting food freely.

4% paraformaldehyde solution (bi yun day), a DAB color development solution Kit (Kangji, SP Rabbit & Mouse HRP Kit (DAB), Rabbit/Mouse universal Streptavidin-HRP Kit (DAB)), eosin alcohol solution (bi yun day), and hematoxylin staining solution (bi yun day).

PBS solution: 10 XPBS solution is prepared, 100ml 10 XPBS solution is added into 900ml deionized water to prepare 1 XPBS solution.

TRIzol reagent (CWBIO, Beijing, China), HiFiScript cDNA Synthesis kit (CWBIO), UltraSYBR Mixed qPCR kit (CWBIO).

4% chloral hydrate: chloral hydrate is ready for use. Accurately weighing 0.4g of chloral hydrate crystal by using an analytical balance, adding 10ml of deionized water, fully and uniformly shaking the chloral hydrate solution by using a shaking and mixing device, and storing in a dark place.

1 × citrate buffer: citrate buffer (100 × concentrate) was purchased from kang as a century.

Example 1

The UUO model is established by the following method:

building a UUO model: anesthesia was performed with 4% chloral hydrate by intraperitoneal injection at 0.1ml/10 g. Anesthetized male C57BL/6 mice were fixed on the back, and the kidneys were exposed by incision using the midline of the abdomen to the paravertebral side of the right two lateral fingers, and after skin sterilization. The ureter was found in the infrarenal pole, separated from the surrounding tissues by a temporary stretch, ligated with surgical thread, and sutured sequentially to the peritoneum and skin.

Example 2

Study subjects: c57BL/6 mice; the modeling method comprises the following steps:

two experimental groups were established: UUO group and UUO + Cana group. Wherein, UUO group: after the mice are raised for one week, the right ureter is ligated by operation, specifically according to the method for establishing the UUO model in the embodiment 1, and the mice are raised for three weeks; UUO + Cana group: mice were gavaged with Cana at 20 mg/(kg. d) from the start of ureteral ligation until sacrifice.

After the experiment is finished, the kidney tissues of the mice are collected to be stained by H & E, oil red O and sirius red, so that the intervention effect of Cana on renal interstitial fibrosis is clear. The specific experimental method is as follows:

preparation of a kidney pathological section:

after mouse kidney tissue is fixed in 4% paraformaldehyde solution for 1 week, the tissue is taken out for trimming, paraformaldehyde remained in the tissue is washed away, and gradient dehydration is carried out (85% ethanol solution is used for 2 hours, 95% ethanol solution is used for 1 hour and then is replaced by new 95% ethanol solution for 1 hour, and anhydrous ethanol solution is used for 0.5 hour and then is replaced by new anhydrous ethanol solution for 0.5 hour). After dehydration, the tissue was cleared by treatment with xylene for 30 minutes followed by a 10 minute further treatment with fresh xylene solution. The tissues were cleared and then treated with paraffin wax (paraffin was changed every hour for a total of 3 hours). The waxed tissue is then poured into a container along with melted paraffin and poured into cold water to solidify it immediately into a wax block. After the tissue is embedded, the tissue is sliced, then the tissue is attached to a glass slide, and finally the tissue is dried in an oven at 60 ℃ for 5 hours and then taken out for standby.

Hematoxylin-Eosin (Hematoxylin-Eosin, H & E) staining:

dewaxing and hydrating mouse kidney paraffin white tablets: soaking the mixture in xylene solution for 10 min, taking out the xylene solution and replacing with new xylene, and soaking the xylene solution again for 10 min; soaking the mixture for 4 minutes by using absolute ethyl alcohol, and soaking the mixture for 4 minutes again after replacing new absolute ethyl alcohol; then soaking the mixture for 4 minutes by using 95% ethanol, and soaking the mixture for 4 minutes again by using 80% ethanol; finally, washing the fabric for 5 minutes by running water, drying the fabric in the shade, and waiting for dyeing. Placing the dehydrated slices into a hematoxylin water solution for dyeing for 5 minutes, washing with tap water, and sucking residual water on the slices; the slices are divided in acid water and ammonia water for several seconds; washing with running water for 2 hours, and then putting into distilled water for a moment; then putting the mixture into 70 percent and 90 percent ethanol for dehydration for 10 minutes respectively; and (5) putting the mixture into alcohol eosin staining solution for staining for 2-3 minutes. Soaking in 95% ethanol, anhydrous ethanol, and anhydrous ethanol for 5 min, and dehydrating in gradient. Xylene soak for 5 minutes, finally obtain neutral gum seal.

Oil Red O (oil Red O staining):

accurately weighing 0.5g of oil red O0.5g by using an analytical balance, adding 100ml of 98% isopropanol to prepare a fresh oil red O saturated solution, adding one part of the oil red O saturated solution into two parts of distilled water when in use, and filtering for use. Frozen mouse kidney sections were fixed with formaldehyde-calcium for 10 minutes, then washed with distilled water and then rinsed with 60% isopropanol; dyeing for 10 minutes by using oil red O dye liquor, then carrying out color separation by using 60% isopropanol until the background color becomes five, and then washing by using distilled water; washing with tap water for 1-3 minutes after Mayer hematoxylin counterstaining, and then washing with distilled water; finally, the tablet is sealed by glycerol gelatin.

Sirius Red (Sirius Red) staining:

the Sirius Red/Fast Green Collagen staining solution kit is adopted. Paraffin sections were routinely dewaxed and hydrated (see hematoxylin-eosin stain dewaxed and hydrated above). Dyeing the sirius red dyeing liquid drop for 1h, then slightly washing with running water, and removing the dyeing liquid on the surface of the slice; then, staining the nuclei with hematoxylin staining solution for 8-10 minutes, and washing with running water for 10 minutes; finally, the mixture is dehydrated and transparent conventionally and is sealed by neutral gum.

The H & E and oil red O staining results of UUO group, UUO + Cana group are shown in figure 1, wherein the arrow points to inflammatory cell infiltration, renal tubular epithelial cell atrophy and lumen dilatation; red particles indicate fat deposition; the results of sirius red staining are shown in fig. 2, in which the arrows indicate collagen. The results showed that UUO mice recovered atrophic tubular epithelial cells, dilated lumen after Cana treatment (H & E staining, fig. 1b 1), reduced red granules, indicating reduced lipid deposition in renal tissue (oil red O staining, fig. 1b2-b3), reduced accumulation of interstitial collagen fiber components (sirius red staining, fig. 2 b); suggesting that Cana intervention may ameliorate UUO-induced pathological changes.

Example 3

Mouse kidney tissue lysates of UUO group and UUO + Cana group constructed in example 2 were observed for protein expression levels of STAT6 and its downstream gene and fibrosis-associated gene using Western Blot, and the relative protein expression amounts were determined. mRNA levels of genes associated with lipid metabolism of each group of mice were measured by qRT-PCR.

Western Blot: the gel was formulated according to the reagent instructions. Putting the prepared SDS-PAGE gel into an electrophoresis device, slowly pouring electrophoresis liquid, pulling out a comb in the gel, and adding a sample and a protein marker into gel pores, wherein each pore is 10 mu L. And adjusting the voltage to 75V, running the glue at constant voltage, and adjusting the voltage to 180V when a protein marker strip appears. Stopping electrophoresis when the sample runs to the bottom of the electrophoresis. And (5) turning off the power supply, taking out the gel plate, and flushing redundant glue running liquid by tap water. The PVDF membrane is activated by methanol for 15 seconds in advance, and is put into a membrane transferring solution together with filter paper and sponge required by membrane transferring. And (3) starting the gel, buckling the gel into a membrane transferring solution, and placing the gel according to the thick sponge, the thick filter paper, the gel, the PPVDF membrane, the thin filter paper and the thin sponge in sequence to prepare the membrane transferring. The voltage was adjusted to 75V and the membranes were spun for 2 hours. And taking out the transferred film, activating by methanol, rinsing by using triple distilled water, displaying protein after 5 minutes of ponceau dyeing, photographing and recording original data, and cutting a small corner at the upper right corner of the film according to the sample adding direction to show a mark. Primary antibody incubation was performed overnight at 4 ℃ and PBST washed 4 times for 5 minutes each. After incubation for 1 hour, the PBST was washed 4 times for 5 minutes each. Finally, the membrane is swept.

Western Blot antibody information: primary antibody purchased from Santa cruz: STAT6(sc-374021), Arg-1(sc-166920), α -SMA (sc53142), FN (sc18827), GAPDH (sc-32233); HRP secondary antibodies were purchased from immunology: plano, TX RS0001 (mouse), RS0002 (rabbit).

Quantitative real time polymerase chain reaction (Quantitative real time polymerase chain reaction, Q-PCR/qPCR/rt-qPCR): absorbing the culture solution, washing with PBS once, directly adding a proper amount of TRI zon into the culture dish, standing for 2 minutes, and repeatedly blowing and absorbing with a gun head to fully lyse the cells. The lysed cells were transferred to a 1.5ml EP tube, added with an appropriate amount of chloroform, shaken vigorously 50 times and then allowed to stand for 2 minutes. Centrifuging at 12000rpm at 4 deg.C for 15 min, separating the sample into three layers, collecting the upper colorless aqueous layer, adding equal volume of isopropanol, and standing at room temperature for 10 min. Centrifuge at 12000rpm for 20 minutes at 4 ℃ and discard the supernatant. Washing with 75% ethanol for 3 times, each 1 time at 4 deg.C and 12000rpm, centrifuging for 5 min, and discarding the supernatant. Air-drying at room temperature, adding 30-100 microliter of RNase-free water, and fully dissolving RNA. After being placed in a water bath tank at 57 ℃ for 8 minutes, the mixture was allowed to stand on ice for 10 minutes.

RT reactions were prepared on ice using PrimeScript RT Master Mix Perfect Real Time kit, as indicated. Setting reverse transcription conditions: 15 minutes at 37 ℃; 5 seconds at 85 ℃; finally, the mixture was placed at 4 ℃. And adding the obtained RT reaction liquid into a Real Time reaction system in the next step. As SYBR Premix Ex Taq^TMThe Real time PCR reaction was carried out in Specification II (Perfect Real time) (Takara code: DRR 081). A PCR reaction solution was prepared as described using a Thermal Cycler Dice Real Time System (Takara Code: TP800) amplification apparatus, and a Real Time PCR reaction was carried out. The primer information is shown in Table 1.

Table 1: primer information

Western Blot and the quantitative results thereof are shown in FIG. 3, and the results show that Cana can inhibit protein expression of STAT6 and genes downstream thereof, and inhibit fibrosis-related proteins at the same time. The qRT-PCR results are shown in fig. 4, and the results show that Cana mainly induces the up-regulation of fatty acid oxidation, uptake and lipid transport related genes.

Example 4

Study subjects: stat6^+/+And Stat6^-/-Mice, after one week of feeding, the right ureter was surgically ligated and fed for three weeks. Collecting mouse kidney tissue after experiment for H&E. And (3) dyeing with oil red O, determining the content of triglyceride, and detecting the mRNA level of the genes related to the lipid metabolism of each group of mice by using qRT-PCR. Antibody information was the same as in example 3.

The results are shown in fig. 5-6, and show that the knockout of STAT6 gene can reduce pathological changes such as renal tubular epithelial cell atrophy, renal tubular dilation deformation, increase of lipid deposition (increase of red particles) and the like caused by UUO (fig. 5A), and the triglyceride measurement result shows that the knockout of STAT6 gene can obviously reduce triglyceride content (fig. 5B). The qRT-PCR results show: knock-out of the STAT6 gene promoted fatty acid oxidation, uptake, and lipid transport-related gene expression (fig. 6).

Example 5

HK2 cells were seeded in 6-well plates (3X 10)⁵Pore) 37 ℃ and 5% CO₂After 24 hours of culture in a cell culture box, serum-free medium was replaced for 24 hours, and then the Cana group was given Cana solution 40. mu.M, and cycloheximide (50. mu.M) was intervened for 0, 4, 8, and 12 hours, and Western Blot was used to measure the expression level of each protein (see example 3 for Western Blot detection procedure: primary antibody obtained from Santa cruz: STAT6(sc-374021) and GAPDH (sc-32233); and HRP secondary antibody obtained from immunology: Plano, TX: RS0001 (mouse), RS0002 (rabbit)). The Cana solution was prepared by dissolving Cana powder in DMSO (stock concentration 100mM, final concentration 40. mu.M). In addition, Ctrl group (control group) was treated with DMSO at the same volume as that of Cana solution, and cycloheximide treatment was given at 0, 4, 8, and 12 hours in the same manner to inhibit protein production.

The results are shown in fig. 7 and show that Cana significantly reduced the half-life of STAT6 in cells (Ctrl group at 7.38h, Cana group at 4.97 h).

Example 6

HK2 cells were seeded in 6-well plates (3X 10)⁵Pore) 37 ℃ and 5% CO₂After 24h of culture in the cell culture box, the serum-free medium was replaced for 24h, and the cells were divided into a control group (Ctrl group, given DMSO treatment for 24h) and a canagliflozin group (Cana group, given Canagliflozin 40. mu.M treatment for 24h) to detect the level of ubiquitination of the endogenous STAT6 protein in the HK2 cells by immunoprecipitation.

Immunoprecipitation (IP): immunoprecipitation was performed with Agarose beads (Invitrogen) and murine STAT6(Santa Cruz, sc-374021) antibodies as follows: fresh cell lysates (RIPAbuffer plus Protease Inhibitor (PI) 100X, phosphatase inhibitor (PIA & PIB) 100X, DTT 1mM, kang Shiji) were prepared, cellular proteins were harvested from 200. mu.l of RIPA Buffer mix per well (Bilun day), protein denaturation was performed by boiling for 10 min at 100 ℃, 14000rpm, centrifugation for 30 min at 4 ℃ to remove cell debris, 40. mu.l of supernatant was taken as Input, the remaining supernatant was transferred to a new EP tube, 300. mu.L of RIPA Buffer was added, 20. mu.l of Agarose beads and 1. mu.g of anti-STAT 6 (FIG. 6) antibody were added, shake-incubated overnight at 4 ℃, centrifugation for 2 min at 4000rpm, three times at 1ml of RIPA Buffer, centrifugation for supernatant at 4000rpm, Western Blot sample loading Buffer (Bilun cloud day) was added to the EP tubes containing the Input and IP protein samples, 40. mu.l per tube, boiling for 10 min at 100 ℃, 10. mu.l of the supernatant and IP gel were run respectively, western Blot detection of murine STAT6(Santa Cruz, sc-374021, corresponding to the expression of RS0001 (goat anti mouse), Immunoway) and murine GAPDH (Santa Cruz, sc-32233, corresponding to the expression of RS0001 (goat anti mouse), Immunoway) in the second antibody.

The results are shown in FIG. 8, which shows: cana increased the ubiquitination level of endogenous STAT6 compared to controls.

Example 7

HK2 cells were cultured in serum-free medium for 24h, and then treated with Cana at 0. mu.M, 5. mu.M, 10. mu.M and 20. mu.M in four groups, and then the expression level of autophagy-related protein was measured by Western Blot and the expression level of autophagy-related mRNA was measured by qRT-PCR. (Western Blot procedure in example 3 and qRT-PCR procedure in example 4, Western Blot antibody information: Primary antibody from Santa cruz: ATG7(sc376212), LC 3I/II (sc398822), GAPDH (sc-32233), HRP Secondary antibody from immunology: Plano, TX: RS0001 (goat anti mouse), RS0002 (goat anti rabbit)), and the primer information used are shown in Table 2.

The results are shown in FIGS. 9-10. Western blot results show that: the expression level of ATG7 and LC 3I/II protein increases with Cana dosage in the experimental range, thereby indicating that the level of ATG7 and LC 3I/II of autophagy-related protein is up-regulated in a dose-dependent manner on Cana; the qRT-PCR results show: i) the overall expression level of ATG-7 increased with increasing Cana dose; ii) no change in mRNA levels of Beclin-1 and ATG16L1, thus indicating a dose-dependent upregulation of the partial autophagy-related genes in Cana.

TABLE 2 primer information

Primer name	Forward primer	Reverse primer
			Beclin
1	gagccatttattgaaactcgcca	cctccccgatcagagtgaa
			ATG7	aggcacccaaagacatcaag	gcactgaactccaacgtcaa
ATG16L1	ggacatgatggtgcgtggaa	gcttcttgtgcagttcggtc

Example 8

After 24h of serum-free culture of HK2 cells, after 24h of transfection with the dual vector of mRFP-GFP-LC 3, the cells were divided into four groups, namely a control group (Ctrl group, which was treated with DMSO for 24h), a Rapamycin group (Rapamycin group, which was treated with 1. mu.M Rapamycin for 24h), a chloroquine group (CQ group, which was treated with chloroquine for 50. mu.M for 24h), and a canagliflozin group (Cana group, which was treated with 40. mu.M for 24h), and the expression of the proteins was detected by immunofluorescence.

Cell immunofluorescence assay: taking a small amount of cells in each tube into an EP tube of 1.5mL, centrifuging at 4 ℃, then resuspending for 45 minutes at room temperature by using 4% paraformaldehyde with the same volume before centrifugation, respectively taking 5 mu L of cells to drip on an adhesive slide, and coating an area which is approximately as large as a cover glass with the side length of 8mm by using a gun head; after drying at room temperature (until the cells are slightly white and can not be dried completely), drawing circles on the periphery of the cells by using a grouping pen, and dripping PBS for wetting and washing; wiping off redundant liquid, and sealing with goat serum working solution for 2 h; PBS wash 5 min 3 times; wiping off redundant liquid, and dropwise adding primary antibody for incubation at 4 ℃ overnight; PBS wash for 5 minutes 3 times; adding secondary antibody (diluted by 1:500, 5% BSA) dropwise, and incubating at room temperature or 37 ℃ for 1 h; PBS wash for 5 minutes 3 times; and sealing by using a Hoechst sealing agent, and observing by using a fluorescence microscope.

The cellular immunofluorescence results are shown in fig. 11, showing: the Cana-treated cells contained red spots, similar to rapamycin, suggesting that Cana may act as an inducer of autophagy, promoting autophagy and thus degrading ubiquitinated proteins.

Example 9

Study subjects: ATG7^+/+(WT)、ATG7^-/-(KO) mice; modeling (see example 1): UUO model group (UUO group): after the mice are raised for one week, the right ureter is ligated by operation, and the mice are raised for three weeks; UUO + Cana group: mice were gavaged with Cana from the beginning of ureteral ligation until sacrifice, 20 mg/(kg. d); each group had 8 mice. For ATG7^+/+、ATG7^-/-Mouse kidney tissue was sectioned and H&E and sirius red, the procedure is as in example 2, and the triglyceride content is determined. Subsequently, the expression level of the protein associated with the lipid metabolism was measured for each group of kidney tissues of mice using Western Blot.

The staining results of the kidney tissue sections are shown in FIG. 12; the results of Triglyceride (TG) determination are shown in FIG. 13; the Western Blot results are shown in FIG. 14. In fig. 12, the arrows in a1 and a2 point to the lumen; the arrows in a3 and a4 indicate lumen dilation; the arrows in b1-b4 point to the collagen. Renal tissue H&E staining and sirius red staining found: i) ATG7^+/+Cana in the kidney tissue of the mouse has a protective effect on renal tubular epithelial cell atrophy, lumen dilation deformation and fibrosis caused by UUO; ii) ATG7^+/+The level of renal interstitial fibrosis caused by UUO in mice is lower than that of ATG7^-/-Mouse kidney tissue; iii) ATG7^-/-In mouse kidney tissue, Cana did not protect tubular epithelial cell atrophy, luminal ectasia and fibrosis caused by UUO. Triglyceride determination found: ATG7^+/+Cana in mouse kidney tissue reduced lipid deposition, while ATG7^-/-Cana did not reduce lipid deposition in mouse kidney tissue. WestThe ern Blot detection finds: ATG7^-/-In mouse kidney tissue, Cana failed to reduce fibrosis-related proteins and increase lipid metabolism-related proteins. The above results indicate that Cana protects interstitial fibrosis by reducing lipid deposition by inducing autophagy.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, it should be noted that, for those skilled in the art, many modifications and variations can be made without departing from the technical principle of the present invention, and these modifications and variations should also be regarded as the protection scope of the present invention.

Claims (7)

1. Application of canagliflozin in preparation of medicines for treating diseases related to STAT6 protein.

2. Use according to claim 1, characterized in that: the diseases related to the STAT6 protein comprise renal interstitial fibrosis, pulmonary interstitial fibrosis or acute lung inflammation.

3. Use according to claim 1, characterized in that: the dosage form of the medicine is oral medicine.

4. Use of canagliflozin in the preparation of an autophagy inducing agent and in the preparation of a medicament for the treatment of a disease that can benefit from autophagy induction.

5. Use according to claim 4, characterized in that: the autophagy inducer is used for inducing autophagy of human renal tubular epithelial cells, alveolar epithelial cells or bronchial epithelial cells.

6. Use according to claim 4, characterized in that: the diseases that can benefit from autophagy induction include renal interstitial fibrosis, pulmonary interstitial fibrosis, asthma, or acute pulmonary inflammation.

7. Use according to claim 4, characterized in that: the dosage form of the medicine is oral medicine.

Images