CN117942348A

CN117942348A - Application of miR-194-3p in preparation of medicine for treating diabetic cardiomyopathy

Info

Publication number: CN117942348A
Application number: CN202311838066.3A
Authority: CN
Inventors: 张慧娜; 李玉; 聂绍平
Original assignee: BEIJING INSTITUTE OF HEART LUNG AND BLOOD VESSEL DISEASES; Beijing Anzhen Hospital
Current assignee: BEIJING INSTITUTE OF HEART LUNG AND BLOOD VESSEL DISEASES; Beijing Anzhen Hospital
Priority date: 2023-04-21
Filing date: 2023-12-28
Publication date: 2024-04-30
Also published as: CN116687950A

Abstract

The invention belongs to the technical field of diabetes metabolic treatment, in particular to the treatment of diabetic cardiomyopathy, and particularly relates to application of miR-194-3p in preparation of a medicament for treating diabetic cardiomyopathy. The invention verifies that the miR-194-3p based on the myocardial exosome from self source can be used as a potential drug target for treating the diabetic myocardial fibrosis, and reveals that the miR-194-3p is a potential drug target for treating the diabetic myocardial fibrosis for the first time, and analogues or promoters of the miR-194-3p and exosomes wrap or become effective means for treating/preventing the diabetic myocardial fibrosis.

Description

Application of miR-194-3p in preparation of medicine for treating diabetic cardiomyopathy

Technical Field

The invention belongs to the technical field of diabetes metabolic treatment, in particular to the treatment of diabetes cardiomyopathy, and particularly relates to an analogue of a microRNA new target point related to the treatment of diabetes myocardial fibrosis, an accelerant, an extracellular vesicle wrapping product and application thereof, in particular to application of miR-194-3p in preparation of a medicament for treating the diabetes cardiomyopathy.

Background

Recent epidemiological studies have shown that about 11% of our population suffers from diabetes mellitus and about 1.6 million people from type 2 diabetes mellitus, a significant portion of which is yet to be diagnosed. Diabetes and its related complications are thus a global burden on human health and economy. Diabetes and cardiovascular diseases are two important diseases of chronic non-infectious diseases, and are closely related. Diabetes is studied as an important risk factor for cardiovascular disease, while cardiovascular complications are one of the major chronic complications of diabetes and the leading cause of death, with the risk of diabetic patients for heart failure being 2-4 times higher than age-matched non-diabetic patients.

Diabetic cardiomyopathy is one of the cardiovascular complications of diabetes, which means that the structure and function of the myocardium of a diabetic patient are abnormal without other cardiac risk factors. Diabetic cardiomyopathy, including impaired cardiac structure and function, has been demonstrated to cause severe cardiac dysfunction, and even through enhanced glycemic control, does not improve cardiac function or reduce risk of heart failure. In diabetics, cardiac dysfunction is often difficult to find in the early clinical stages. This is mainly because, in the early stages, diabetic cardiomyopathy comprises a blind sub-clinical stage characterized by structural and functional abnormalities, including left ventricular diastolic dysfunction, fibrosis and abnormal cell signaling. Thus, even in asymptomatic diabetics with normal blood pressure and well-controlled blood glucose, about 50% exhibit a degree of cardiac dysfunction. One of the major hallmarks of diabetic cardiomyopathy is Left Ventricular (LV) diastolic dysfunction, which is the first sign of diabetic cardiomyopathy, usually occurs earlier than clinically significant left ventricular systolic dysfunction. The pathogenesis and clinical features of diabetic cardiomyopathy have been studied intensively in the last decade, but there are limited effective methods of preventing and treating this disease. Therefore, how to elucidate the pathogenesis of diabetic cardiomyopathy in its early stages and to determine an effective target is an unmet urgent medical need.

It has been studied that diabetic myocardial fibrosis is a major pathological factor leading to diabetic cardiomyopathy and is characterized by excessive deposition of collagen fibers in the heart, resulting in impaired cardiac function, and ultimately heart failure, with high morbidity and mortality worldwide. There is much evidence that diabetic cardiomyopathy patients have cardiac fibrosis, and immunohistochemical staining of myocardial tissue has found that type I and type III interstitial collagen deposition in the myocardial tissue of diabetic patients is significantly increased, as is interstitial and perivascular fibrosis. Non-invasive detection using echocardiography, nuclear magnetic resonance, and the like also reveals that diabetic cardiomyopathy exists. These evidence reveal that cardiac fibrosis is a major pathological feature of diabetic cardiomyopathy. Whereas activated myofibroblasts deposit extracellular matrix under the action of potent fibrocytokines, which is a marker of cardiac remodeling associated with diabetic cardiomyopathy.

Myocardial fibrosis is characterized by excessive deposition of extracellular matrix (ECM) by the heart and by myogenic transformation of fibroblasts (CFs), resulting in increased secretion of extracellular matrix and reduced tissue compliance. Under normal conditions, fibroblasts are flattened spindle-shaped cells, but can be affected by the cell's living environment, and exhibit corresponding morphological and functional heterogeneity, resulting in phenotypic transformation, exhibiting myogenic changes and secreting a large amount of extracellular matrix. Recent studies report that fibroblasts may account for less than 20% of the total cell population in the adult mouse heart and may play an important role in maintaining heart morphology and function. In pathological states such as diabetes, fibroblasts in connective tissue are transformed into their activated form, commonly referred to as myofibroblasts, which secrete extracellular matrix proteins to promote the fibrotic environment. Cardiac fibrosis causes a series of pathological changes that ultimately lead to the onset of congestive heart failure. At present, under the condition of diabetes, the mechanism of transformation from heart fibroblasts to myofibroblasts is not clear, and no medicine capable of effectively reversing the myocardial fibrosis of the diabetes exists clinically. TGF- β signaling pathways are reported to play an important role in the process of myocardial fibrosis; however, there is currently no effective therapeutic strategy that can directly control the occurrence and progression of diabetic myocardial fibrosis by directly targeting TGF- β signaling pathways. Recent evidence suggests that impaired endogenous defense mechanisms are a major cause of diabetic cardiomyopathy. However, an internal braking system that inhibits diabetic myocardial fibrosis has not yet been established.

In recent years, exosome (Exosome) research has received great attention from researchers in the cardiovascular field. Exosomes present in body fluids are nanoscale bilayer membrane microvesicles (diameter range: 30-100 nm) that are secreted by most cells of the body, carrying a variety of RNA, protein and lipid components from the secreting cells. The secretory cell has the targeted precise regulation and high selectivity of the content of the exosomes, and under different pathophysiological states, the exosomes containing the specific content are secreted by the cell into the extracellular environment (blood, urine, saliva, prostatic fluid, amniotic fluid, pleural effusion and the like), and the substances can reflect the types of the secretory cells (such as transferrin which is commonly found in the exosomes derived from reticulocytes) and are closely related to the physiological functions or pathological changes of the secretory cells. After exosomes are released into the extracellular environment, the exosomes can be directly taken up by receptor cells at a relatively short distance, can be taken up by paracrine pathways at a relatively long distance, and also part of exosomes reach various organs and tissues of the whole body along with circulation and are taken up by other receptor cells by endocrine pathways. Receptor cells are also highly targeted for exosome uptake, such as melanoma-derived exosomes that tend to reach sentinel nodes to promote tumor metastasis. The shuttle of exosomes between secretory cells and receptor cells mediates the transmission of biomolecules between cells, and is an important medium for information communication between different tissue cells, and in this way, the exosomes participate in a series of important physiological and pathological processes.

The differential expression profile of the exosomes of mirnas is closely related to specific pathophysiological states and mirnas encapsulated by exosomes have a high degree of biological stability. Mirnas from certain specific tissues in exosomes are able to modulate the function of other tissues or cells by specific secretion and targeted uptake. These features make exosome miRNA not only a novel biological marker which is expected to become a disease drug target, but also determines that exosome-mediated intercellular interaction plays an important role.

In addition, the exosomes are natural liposomes existing in human bodies, have longer half-life and no toxicity compared with artificially synthesized liposomes, can escape from a host immune system, and can be modified into targeted specific drug carriers carrying drugs and small nucleic acid molecules, wherein the biological characteristics determine the possibility of the exosomes in the fields of transformation medicine and molecular therapy, and the exosomes carry analogs or inhibitors of microRNAs to be the main strategy of the exosomes as therapeutic carriers.

Disclosure of Invention

Therefore, the technical problem to be solved by the invention is to provide an application of miR-194-3p in preparing medicines for treating diabetic cardiomyopathy, treating diabetic myocardial fibrosis, improving diabetic left ventricular diastolic dysfunction or reducing diabetic myocardial fibrosis area, wherein the miR-194-3p and a mimic thereof can obviously improve the left ventricular diastolic function of a diabetic mouse and the myocardial fibrosis of the mouse, the in-vivo use of the mimic leads to obvious increase of miR-194-3p expression in heart and serum, and particularly the expression of miR-194-3p of exosomes derived from serum central myocytes is obviously increased, the left ventricular diastolic function and the myocardial fibrosis are obviously improved, the fibrosis area is obviously reduced, and the diabetic myocardial fibrosis is reversed;

The invention aims to solve the second technical problem of providing an application of a self-derived cardiac exosome miR-194-3p as a potential drug target for treating diabetic myocardial fibrosis, wherein the self-derived cardiac exosome can be homing and positioned in cardiac myocytes by utilizing the homing characteristic of the exosome, and the cardiac myocyte exosome can carry a miR-194-3p analogue or a miR-194-3p expression promoter and act on the heart as a natural transport carrier of a targeted drug;

The third technical problem to be solved by the invention is to provide an application of a prediction or prognosis index for evaluating the myocardial fibrosis area of diabetes by detecting the content of miR-194-3p in blood exosomes or in myocardial cell exosomes in blood, wherein the expression of miR-194-3p in serum exosomes and myocardial cell exosomes is evaluated by different diabetes animal models to be in strong negative correlation with the myocardial fibrosis area of diabetes.

In order to solve the technical problems, the application of miR-194-3p in preparation of a medicament for treating diabetic cardiomyopathy is provided.

The invention also discloses an application of miR-194-3p in preparation of a medicament for treating diabetic myocardial fibrosis.

The invention also discloses an application of miR-194-3p in preparation of a medicament for improving diabetic left ventricular diastolic dysfunction.

The invention also discloses application of miR-194-3p in preparation of a medicament for reducing the myocardial fibrosis area of diabetes.

Specifically, the drug includes an agent that overexpresses miR-194-3 p.

Specifically, the miR-194-3p over-expression reagent comprises a miR-194-3p over-expression carrier, a miR-194-3p over-expression mimic, a miR-194-3p expression promoter and/or a miR-194-3p over-expression exosome.

The invention also discloses application of the reagent for detecting miR-194-3p in preparation of a diabetes cardiomyopathy prediction product, a diagnosis product or a prognosis evaluation product.

Specifically, the miR-194-3p is derived from blood exosome miR-194-3p or miR-194-3p in myocardial cell exosome in blood.

The invention also discloses application of the miR-194-3p mimic, analogue, exosome or expression promoter in preparing medicines for treating diabetic cardiomyopathy, medicines for treating diabetic myocardial fibrosis, medicines for improving diabetic left ventricular diastolic dysfunction or medicines for reducing diabetic myocardial fibrosis area.

The invention also discloses application of miR-194-3p and a mimic, analogue or expression promoter thereof in preparing medicines or preparations for regulating TGF beta R2 expression or TGF beta channel.

The invention also discloses miR-194-3p, and the nucleotide sequence of the miR-194-3p is shown as follows: CCAGUGGGGCUGCUGUUAUCUG.

The invention also discloses a carrier, a mimic, an exosome or an expression promoter for over-expressing the miR-194-3 p.

The invention verifies that the miR-194-3p based on the myocardial exosome from self source can be used as a potential drug target for treating the diabetic myocardial fibrosis, and reveals that the miR-194-3p is a potential drug target for treating the diabetic myocardial fibrosis for the first time, and analogues or promoters of the miR-194-3p and exosomes wrap or become effective means for treating/preventing the diabetic myocardial fibrosis.

According to the miR-194-3p, by utilizing the homing characteristic of an exosome, the exosome from a myocardial cell can home and locate in the myocardial cell, and the miR-194-3p mimic can be carried by the exosome of the myocardial cell or the miR-194-3p expression promoter can be carried by the exosome of the myocardial cell, so that the exosome acts on the heart to serve as a natural transport carrier of a targeted drug.

The invention provides a method for evaluating a prediction or prognosis index of myocardial fibrosis area of diabetes by detecting the content of miR-194-3p in blood exosomes or miR-194-3p in myocardial cell exosomes in blood. We evaluated the strong negative correlation of miR-194-3p expression in serum exosomes and myocardial exosomes, respectively, with diabetic myocardial fibrosis area by different animal models of diabetes.

According to the invention, by utilizing an miRNA chip array strategy, 38 differential exosome miRNAs (compared with a normal culture medium) are identified from exosomes secreted by myocardial primary cells cultured by high fat and high sugar, 11 human-mouse homologous miRNAs are found through database comparison, and qPCR analysis is used for verifying the expression of the human-mouse homologous differential miRNAs in the exosomes of myocardial cells in different states, so that the content of miRNA-194-3p in the exosomes secreted by myocardial primary cells cultured by high fat and high sugar is confirmed to be reduced, and the miR-194-3p in the exosomes of myocardial cells of diabetic mice is confirmed to be also obviously reduced. Clinical studies have found that miR-194-3p levels are reduced in serum exosomes and myocardial cell exosomes of diabetics. The effect and the application of the miR-194-3p in treating diabetic cardiomyopathy are fully verified.

According to the invention, the target gene and biological function of miR-194-3p are predicted through bioinformatics analysis, and the fact that miR-194-3p mainly influences the expression of TGF beta R2 is found. The invention also clarifies that after the myocardial extracellular body miR-194-3p enters myocardial fibroblasts, the TGF beta pathway is influenced by directly regulating the expression of TGF beta R2, and the differentiation phenotype of the heart fibroblasts is further regulated, so that the reduction of the content of the protective factor miR-194-3p in the diabetic condition is proved to be an important mechanism for promoting the myocardial fibrosis of diabetes. In order to verify the protective function of miR-194-3p in diabetic cardiomyopathy, the analogue agomiR-194-3p of miR-194-3p is injected into the tail of a mouse by intravenous injection, and agomiR-194-3p is found to obviously improve the reduction of left ventricular diastolic function and myocardial fibrosis of a diabetic mouse and reduce the expression of molecules related to myocardial fibrosis.

According to the invention, the content of the miR-194-3p in myocardial cells is reduced through chipset science, a novel mechanism for promoting the diabetes process by reducing the content of the miR-194-3p in the exosome is disclosed on the basis, and the improvement effect of the miR-194-3p analogue-based medicament on the diabetic myocardial fibrosis and the diabetic cardiac function injury is discovered. The miR-194-3p is disclosed as a potential drug target for treating the diabetic myocardial fibrosis for the first time, and an analogue or promoter of the miR-194-3p and an exosome thereof wrap or become an effective means for treating/preventing the diabetic myocardial fibrosis.

The miR-194-3p agomiR mimic can obviously improve the left ventricular diastolic function of a diabetic mouse and the myocardial fibrosis of the mouse. In vivo use of the mimic results in significantly increased miR-194-3p expression in heart and serum, particularly in serum central myocyte derived exosome miR-194-3p expression, and significantly improved left ventricular diastolic function and myocardial fibrosis.

Drawings

In order that the invention may be more readily understood, a more particular description of the invention will be rendered by reference to specific embodiments thereof which are illustrated in the appended drawings, in which,

FIG. 1 is a flow chart of the overall experiment of modeling of diabetic mice described in example 2;

FIG. 2 is an evaluation result of the diabetic mouse model described in example 2;

FIG. 3 is a graph showing the results of experimental example 1 showing the effect of normal myocardial cell exosomes (Myo-sEVs ^Nor) and high-sugar and high-lipid treated myocardial cell exosomes (Myo-sEVs ^HG/HL) on the conversion of fibroblasts into myofibroblasts;

FIG. 4 is a graph showing the results of experimental example 2 showing the effect of Myo-sEVs of central myocytes on myocardial fibrosis in diabetic mice induced by high-fat diet plus STZ;

FIG. 5 is a graph showing the results of myocardial fibrosis assay in experimental example 3 in which Myo-sEVs ^db/db exacerbates db/db mice;

FIG. 6 is a validation result of miR-194-3p reduction in Myo-sEVs ^HG/HL in Experimental example 4;

FIG. 7 is a graph showing the results of experimental example 5 that agomiR-194-3p can inhibit HG/HL and Myo-sEV ^HG/HL treatment-induced fibroblast to myofibroblast transformation and effectively improve diabetic myocardial fibrosis in db/db mice;

FIG. 8 is a result of verification that expression of TGF-beta R2 in Experimental example 6 is regulated by miR-194-3 p;

FIG. 9 is a validation result that miR-194-3p mimetic or agomiR-194-3p reverses Myo-sEVs ^HG/HL or TGF beta R2 expression upregulation caused by diabetes in experimental example 7;

FIG. 10 is a graph showing the results of test example 8 showing that serum-sEVs ^DM of a diabetic patient has a reduced miR-194 content and serum-sEVs ^DM promotes fibroblast to myofibroblast transformation.

Detailed Description

The invention provides application of miR-194-3p in preparation of a medicament for treating diabetic cardiomyopathy. In the invention, the nucleotide sequence of miR-194-3p is shown as follows:

CCAGUGGGGCUGCUGUUAUCUG。

The invention also provides application of miR-194-3p in preparation of a medicament for treating diabetic myocardial fibrosis.

The invention also provides application of miR-194-3p in preparation of a medicament for improving diabetic left ventricular diastolic dysfunction.

In the present invention, the drug preferably comprises an agent that overexpresses miR-194-3 p. In the present invention, the agent that overexpresses miR-194-3p comprises a miR-194-3 p-overexpressing vector or a miR-194-3 p-overexpressing mimetic (agomiR-194-3 p) or a miR-194-3p expression promoter or a miR-194-3 p-overexpressing exosome.

The invention discovers that miR-194-3p in myocardial cell-derived exosomes can be used as a potential drug target for treating diabetic myocardial fibrosis. The miR-194-3p overexpression can obviously improve the left ventricular diastolic function of a diabetic mouse and myocardial fibrosis of the mouse. The miR-194-3p expression in the heart and serum is obviously increased, especially the expression of the serum central myocyte derived exosome miR-194-3p is obviously increased, and the left ventricular diastolic function and myocardial fibrosis are obviously improved.

Specifically, the invention examines the reversion effect of the myocardial exosome miR-194-3p on the heart function and the diabetic myocardial fibrosis of a diabetic mouse through the over-expression agomiR-194-3p mimic of the tail vein injection miR-194-3p, and discovers that the myocardial exosome miR-194-3p mimic can obviously improve the left ventricular diastolic function and the myocardial fibrosis of the diabetic mouse.

The invention also provides application of miR-194-3p in preparation of a medicament for reducing the myocardial fibrosis area of diabetes.

According to the invention, the content of miR-194-3p in exosomes secreted by blood central myocytes is detected to evaluate the myocardial fibrosis area of diabetes mellitus, and the myocardial fibrosis area can be obviously reduced by the overexpression of miR-194-3 p; the content of miR-194-3p in exosomes secreted by myocardial cells was evaluated by animal models to be strongly inversely correlated with the area of diabetic myocardial fibrosis.

The method is not particularly limited in the miR-194-3p overexpression mode, can be implemented by constructing a conventional overexpression vector, can construct an exosome for overexpressing miR-194-3p, can directly purchase an overexpression mimic of miR-194-3p, such as agomiR-194-3p, is purchased from Ruibo organisms, and has the product number of miR40017148-4-5 or miR40004671-4-5, and can also be an accelerator for accelerating miR-194-3 p.

The invention also provides application of the reagent for detecting miR-194-3p in preparation of products for diagnosis and prognosis evaluation of diabetic cardiomyopathy.

The reagent for detecting miR-194-3p is not particularly limited, and can be a miR-194-3p detection kit, and the kit is from Thermo Fisher with the following product number: 002379. in the case of diabetes, the invention finds that miR-194-3p expression is significantly reduced relative to normal. The diagnosis and prognosis evaluation of the diabetic cardiomyopathy can be realized by detecting the expression quantity of miR-1944-3 p.

Example 1 clinical sample collection

The study protocol of the invention was approved by the medical ethics committee of the Beijing An Zhen hospital (approval number: 2022036) and strictly followed the guidelines of the declaration of Helsinki.

The endocrinology and health management center of the Beijing An Zhen hospital recruited 30 patients with type 2 diabetes (T2 DM) and 30 healthy controls (non-diabetes) from 6 months to 11 months in 2022, with specific basic and biochemical data as shown in Table 1 below.

TABLE 1 clinical participation population base Condition and Biochemical data

Note that: the above values are expressed as mean ± standard deviation.

All participants were in the han group. All subjects had written informed consent prior to inclusion in the study.

The diagnosis of patients with T2DM is based on the American diabetes Association criteria, including past diagnosis of T2DM, fasting glucose of no less than 7 mmoles, or plasma glucose of no less than 11.1 mmoles in a 75 gram oral glucose tolerance test for 2 hours, or random blood glucose concentration of no less than 11.1 mmoles, or HbA1c of no less than 6.5%, or patients receiving diabetic hypoglycemic therapy. Whereas subjects with fasting blood glucose < 6mM were included in the non-diabetic group. Exclusion criteria included type I diabetes, severe cardiovascular disease (CVD, class III or IV with heart function meeting new york heart association criteria), severe liver and kidney dysfunction, active liver disease, malignancy, inflammatory processes in the past two months, pregnancy, or any weight affecting factor, such as hyperthyroidism or corticosteroids. Fasting serum samples were collected and stored at-80 ℃. Clinical test data is extracted from the hospital database and analyzed.

Blood is preferably morning blood and the subject is fasted prior to morning blood collection. Blood samples were collected in tubes and serum was collected by centrifugation as soon as possible. The exosomes can be stored more stably in serum at 4 ℃, -20 ℃, -40 ℃ or-80 ℃. All of the above experimental enrolled participants were between 27-75 years old. Each group of samples needs to be taken to be 5mL of morning blood (without anticoagulant serum tube collection), and after centrifugation for 10 minutes at normal temperature of 2000g, the serum is separated into a 1.5mL centrifuge tube, and centrifugation is carried out for 10 minutes at normal temperature of 2,000g again, so that blood cell sediment in the samples is further removed, and the serum is obtained.

EXAMPLE 2 animal Studies

In this example, diabetic mice were modeled by high fat diet and STZ injection, and the specific flow chart is shown in fig. 1.

All animal treatment procedures were in compliance with the university of capital medical animal welfare standard specifications and were approved by the university of capital medical animal experiment committee. Male C57BL/6 mice were obtained from SBF Biotechnology Inc. (Beijing, china) and induced to be obese with a high fat diet (HFD, 60% fat, manufactured by RESEARCH DIETS, U.S.) for 8 weeks. Then, a diabetic mouse model was constructed by a small dose STZ treatment. Briefly, the experimental group was intraperitoneally injected with STZ (dissolved in 50mM sodium citrate buffer, pH 4.5, final concentration 40 mg/mL) at a dose of 40mg/kg. Animals in the control group were intraperitoneally injected with an equal volume of sodium citrate buffer (pH 4.5). Blood glucose levels in tail vein blood samples were measured 5 days after STZ injection to evaluate the diabetes model. STZ treated mice remained hyperglycemic (> 15mmol (270 mg/dl)) for several weeks at all times. Thereafter, a High Fat Diet (HFD) was continuously administered for 12 weeks to obtain a diabetic myocardial fibrosis mouse model. Male db/db mice, approximately 6-8 weeks old, were purchased from Junker biological Inc. (Nanj, china) and C57BL/6 male mice of the same age were used as controls. The animals are kept in a room with controllable temperature (22+/-2 ℃) for 12 hours of light/dark circulation, and food and water can be freely obtained. Db/db mice of 20-22 weeks of age were tested in the control group.

In the embodiment, two diabetic mice are adopted, one is the model building of the diabetic mice by high-fat diet and STZ injection, and the other is db/db mice, and after the specified time of culture, the projects of glucose tolerance, insulin tolerance, weight, blood sugar, cholesterol, triglyceride and the like are respectively detected, so that the success of the model mouse construction is ensured.

In this example, the specific evaluation results of the mouse model are shown in fig. 2. Wherein, (panels a-B) are GTT (a) and ITT (B) results (n=8, p < 0.05) in HFD-induced diabetic mice or db/db mice, respectively; (panels C-F) are physiological and biochemical indicators (n=10, < p < 0.05) of HFD-induced diabetic mice, db/db mice and their cognate mice, respectively, over a period of 5 months, including body weight (C), blood glucose (D), cholesterol (E), and Triglycerides (TG) (F). All results are expressed as mean ± SEM. P-values were calculated by one-way analysis of variance and Tukey multiple comparison test.

As can be seen from the evaluation results of the animal models, the model mouse (HFD for short) and db/db mice of the invention accord with the insulin resistance model of diabetes mice.

EXAMPLE 3 isolation and culture of cardiomyocytes

Isolation of primary cardiomyocytes from C57BL/6 male mice: adult male C57BL/6 mice (8 weeks) were anesthetized with 2% isoflurane. The mouse hearts were removed and perfused retrograde buffer (116 mM NaCl, 5.4mM KCl, 6.7mM MgCl ₂, 12mM glucose, 2mM glutamine, 3.5mM NaHCO ₃、1.5mM KH₂PO₄、1.0mM NaH₂PO₄, 21mM HEPES) through the aortic cannula at 37℃for 5 minutes using a Langendorf instrument (WPI, USA) at a constant flow rate of 4.5 mL/min. Subsequently, the heart was again perfused with digest containing 0.6mg/mL collagenase II (Invitrogen, paisley, RENFREWSHIRE, UK) and 15mM CaCl ₂ at 37℃for 10 minutes. The ventricular tissue was then rapidly cut into small pieces of less than 1mm ³ with fine forceps. The cell suspension was then transferred to a 15mL conical tube, allowed to settle under gravity for 15 minutes, and carefully separated into cell culture dishes with a pipette until only 50-100 μl of solution remained above the tissue fragments. The cell culture dishes were rapidly moved to an incubator at 37 ℃,5% co ₂ and 95% humidity. Cardiomyocytes exposed to 5mM glucose were classified as control group, while cardiomyocytes treated with 25mM glucose plus 250. Mu.M palmitate for 48 hours were assigned to the high sugar/high lipid (HG/HL) group.

EXAMPLE 4 isolation and culture of cardiac fibroblasts

Isolation of primary cardiac fibroblasts from C57BL/6 male mice: adult male C57BL/6 mice (8 weeks) were anesthetized with 2% isoflurane. Hearts were isolated under sterile conditions and placed in Hank's balanced salt solution (HBSS, corning Co., USA) with the addition of 100U/mL penicillin and 100. Mu.g/mL streptomycin (Corning Co., USA) and 0.01mM HEPES (Sigma Co., USA). After a secondary rinse with fresh HBSS, the heart was transferred to a sterile petri dish containing DMEM (Gibco, USA) and added with 0.25mg/mL type II collagenase and 0.01mM HEPES. The heart was then cut into 1mm ³ pieces and incubated with collagenase solution for 35 minutes at 37℃on an orbital shaker. Then, 25mL of ice-cold HBSS was added to inhibit collagenase activity. The dispersed cells were separated from undigested tissue by a cell filter having a diameter of 40 μm, and then centrifuged at 1,000rpm at 4℃for 5 minutes to collect the cells. After one centrifugation wash in HBSS, cells were resuspended in 10mL DMEM supplemented with 10% fetal bovine serum (FBS, gibco), 100U/mL penicillin and 100 μg/mL streptomycin, and sown in sterile dishes. The cells were then incubated in a humid environment at 37℃with 5% CO ₂ for 2 hours. Then, the fresh culture medium is replaced, and the non-adhered cells are removed, and the adhered cells are purified fibroblasts. When transforming fibroblasts into myofibroblasts, the fibroblasts were serum starved for 24 hours and then treated with TGF-beta 1 (10 ng/mL; peproTech) for 24 hours.

EXAMPLE 5 glucose tolerance and insulin tolerance test

To assess glucose tolerance, mice were intraperitoneally injected with D-glucose (1.5 g/kg) after 16 hours of fasting and were free to drink water. Blood glucose levels were measured from the tail vein using a blood glucose meter and a blood glucose strip (ACCU-CHEK, roche company) at 0, 15, 30, 60, and 120 minutes after glucose injection. Insulin resistance test is to measure blood glucose levels 6 hours after fasting, and then to intraperitoneally inject 0.5U/kg insulin (Novolin R) at 0, 15, 30, 60 and 120 minutes.

Example 6 detection of echocardiography

After the model was established successfully, each group of mice was scanned over the heart using a Vevo 2100 high resolution ultrasound imaging system. Before detection, the mice were weighed, shaved in the chest and fixed supine after isoflurane anesthesia. Placing the probe in the precordial region of the mouse, and taking the long-axis section of the left chamber; the M-shaped ultrasonic sampling line was placed in the mitral valve chordae tendineae level, perpendicular to the ventricular septum and the left ventricular posterior wall. Left Ventricular Ejection Fraction (LVEF), left ventricular systole rate (FS), stroke volume, cardiac output, etc. are obtained by measuring and recording the left ventricular inner diameter and volume of the mouse heart, i.e., left ventricular end diastole inner diameter (LVEDD), left ventricular end systole inner diameter (LVESD), left Ventricular End Diastole Volume (LVEDV), and Left Ventricular End Systole Volume (LVESV), on a left cardiac long axis section, in combination with Heart Rate (HR). On the four-cavity tangential planes of the apex of the heart, a sampling frame is respectively arranged at the mitral valve orifice and the left ventricular outflow orifice, and the blood flow velocity E peak and E' of the early diastole of the mitral valve orifice are measured.

EXAMPLE 7 purification and identification of the myocardial extracellular exosome Myo-sEV

Cardiomyocyte medium Myo-sEV isolation: media of cardiomyocytes exposed to normal or high sugar/high lipid (HG/HL) conditions were collected and subjected to a series of centrifugation steps: 300 Xg for 15min and 12,000 Xg for 30min, with the aim of removing myocardial cells and cell debris. Subsequently, the supernatant was filtered through a 0.2 μm microfiltration membrane (Millipore, ma, usa) and further subjected to 110,000×g ultracentrifugation for 120 minutes (Beckman Coulter, ca, usa). The sEV particles were washed with PBS to remove contaminating proteins and then subjected to a second round of ultracentrifugation at 110,000Xg for 90 minutes. All centrifugation steps were performed at 4 ℃. The expression of sEV-specific markers (e.g., CD63, CD81, TSG101, alix, calnexin) and cardiomyocyte-specific marker α -sarcomeric actin protein was detected by Western blotting analysis, confirming the characteristics of sEV. Particle size and number were measured by a NanoSight analyzer (NS 300, malvern Instruments Co.) and sEV morphology was observed by transmission electron microscopy (TEM, H-600, hitachi, japan) negative staining.

EXAMPLE 8 serum exosome extraction

Human or mouse serum was first diluted with PBS and then subjected to a series of centrifugation steps: centrifugation was performed at low speed for 300 Xg for 15 minutes, followed by centrifugation for 12,000Xg for 30 minutes, all at 4 ℃. The resulting supernatant was filtered through a 0.2 μm filter (Millipore, ma, usa). sEVs was then pelleted using a T-70i fixed angle rotor (Beckman Coulter, brea, calif.) at 110,000Xg ultracentrifugation for 90 minutes at 4 ℃. The supernatant was then washed with PBS to remove residual contaminating proteins and another round of ultracentrifugation was performed under the same conditions. Finally, the supernatant was discarded and sEV particles were collected.

EXAMPLE 9 purification of myogenic sEVs in circulation

To isolate the circulating cardiomyocyte-derived sEVs (Myo-sEVs), the specific marker CD172a was used to identify Myo-sEVs. First, 50. Mu.L of streptavidin-coated Dynabeads ^TM MyOne^TM STREPTAVIDIN T (1 μm, invitrogen, carlsbad, calif., USA) were washed three times, followed by three washes with 1mL of isolation buffer (0.1% bovine serum albumin in 0.1M physiological Phosphate Buffered Saline (PBS), pH7.4, consisting of 140mM sodium chloride, 2.7mM potassium chloride, 1.5mM potassium dihydrogen phosphate, and 8.1mM disodium hydrogen phosphate). Subsequently 10 μg of anti-CD 172a ⁺ antibody (eBioscience, usa) was added and gently swirled at room temperature for 4 hours to promote binding of the anti-CD 172a ⁺ antibody to Dynabeads. Excess primary antibody was removed by three washes with separation buffer. The resulting anti-CD 172a ⁺ -bound Dynabeads were resuspended in 50. Mu.L of isolation buffer. To isolate circulating Myo-sEV, serum sEV particles were resuspended in 100 μl of isolation buffer containing 5 μl of anti-CD 172a ⁺ -linked Dynabeads, and the mixture was then incubated overnight at 4 ℃ and spun slightly. After three additional washes in isolation buffer, the cycled Myo-sEV was resuspended and stored in 1.5mL PBS.

Example 10 exocrine experience

1. Negative-dyeing photograph of electron microscope

The size and shape of serum exosomes were first observed by electron microscopy negative staining. After resuspension of serum exosomes with PBS, exosomes were transferred onto a carbon-supported film covered copper mesh and stained with an equal volume of 2% uranyl acetate for 60 seconds. The copper mesh was then observed under FEI TECNAI electron microscope for the size and integrity of human serum exosomes.

2. Western blotting detection

Serum exosomes, whole serum and serum from which exosomes were removed were dissolved in RIPA buffer (25 mM Tris-HCl pH 7.6, 150mM nacl,1% np-40,1% sodium deoxycholate, and 0.1% SDS), and 5 x SDS loading buffer was added, denatured at 95 ℃ for 5min, subjected to SDS-PAGE electrophoresis and transfer, and after 5% skim milk blocking, primary antibodies against CD63 and CD81 (both from SBI) were hybridized overnight at 4 ℃ after dilution with primary antibody dilution 1:1000, and horseradish peroxidase-conjugated secondary antibodies were incubated at room temperature for 2 hours, and ECL chromogenic reactions were performed. Protein SDS-PAGE gel silver staining is used as an internal reference of protein loading. The enrichment of human serum exosomes samples with the marker proteins CD63 and CD81 was examined in this way.

3. Serum exosome concentration determination

Detecting the distribution of extracted human serum exosomes by means of a nanoparticle analyzer Delsa Nano C PARTICLE analyzer (Beckman-Coulter); nanoSight NS300 (Malvern Instruments, UK) detects serum exosome concentrations.

EXAMPLE 11 isolation of miRNAs and Total RNAs, detection of miRNAs, mRNA and pri-miRNAs

The small RNAs containing sEV were extracted using either the total exosome RNA and protein isolation kit (AM 1561, thermo FISHER SCIENTIFIC, usa) or the exoRNeasy serum/plasma initiation kit (Qiagen, 77023, usa) following the manufacturer's protocol. Expression of 15 mature miRNAs, including mmu-miR-30c(mmu483230_mir)、mmu-miR-143-5p(mmu480936_mir)、mmu-miR-181b-5p(245498_mat)、mmu-miR-193-3p(002250)、mmu-miR-194-5p(000493)、mmu-miR194-3p(002379)、mmu-miR-214-5p(002293)、mmu-miR-448-5p(464921_mat)、mmu-miR-539-5p(001286)、mmu-miR-574-5p(002349)、mmu-miR-466g(241015_mat)、mmu-miR-704(001639)、mmu-miR-1198-5p(002780)、U6 snRNA(001973)、cel-miR-39(000200) TaqMan ^TM MicroRNA assays (Thermo Fisher, 4427975) using TaqMan ^TM MicroRNA reverse transcription kit (Thermo Fisher, 4366596) and TAQMAN FAST ADVANCED MASTER Mix (Thermo Fisher, 4444557). U6 snRNA served as a reference control for sEVs in cells and tissues. For sEVs from serum, the cel-miR-39miRNA (Qiagen, 219610) was used as Spike-in control, as U6 snRNA may not be encapsulated in sEVs as well. Total RNA of tissues and cells was isolated using TRIzol reagent (Invitrogen, 15596018) according to the method provided by the manufacturer. Using Pri-miRNA Assay(Pri-let-7f、Pri-miR-181-1、Pri-miR-181-2、Pri-miR-194、Pri-miR-214、Pri-miR-30c、Pri-miR-448、Pri-miR-539、Pri-miR-574;GenePharma,E22001, china) 10 pri-mirnas were detected with 18s RNA as reference control. Using REVERTAID FIRST STRAND CDNA SYNTHESIS KIT (thermo Fisher, K1622) and PowerUp ^TM GREEN MASTER Mix (thermo fisher, a 25742) detected gene transcripts including pri-miRs and predicted target genes, respectively, on a QuantStudio Real-Time PCR system (ABI, 7500) in 96-well format, specific primer information is shown in table 2 below.

Table 2 qPCR Experimental primer sequences

/>

EXAMPLE 12 Experimental procedure for Western blot

SDS-PAGE separates the protein denatured samples and is transferred to a solid support by nitrocellulose membrane. The solid phase carrier can well adsorb denatured protein and can keep the polypeptide peptide fragments separated by electrophoresis and the biological activity thereof unchanged. The transferred nitrocellulose membrane is also called a blot, which is treated with a protein solution (e.g. 5% BSA or skimmed milk powder solution) in order to block the hydrophobic binding sites on the nitrocellulose membrane. Nitrocellulose membranes are incubated with antibodies to the target protein (i.e., primary antibodies) -only the target protein will specifically bind to the primary antibody to form an antigen-antibody complex, and washing can be performed to remove unbound primary antibody. The nitrocellulose membrane treated with the primary antibody is then treated with a secondary antibody carrying a label, which is an antibody against the primary antibody, such as an antibody against rabbit IgG, if the primary antibody is obtained from rabbit. After such treatment, the labeled secondary antibody and the primary antibody are combined to form an antibody complex, which can indicate the specific binding position and expression strength of the antigen and the primary antibody, namely the specific binding position and expression strength of the target protein, and the antibodies used in the experiment are shown in Table 3.

TABLE 3 details of antibodies used in the experiments

/>

Example 13 tissue section preparation

Tissue fixation: the collected heart tissue specimen of the mice is put into 4% (w/v) poly methanol solution for soaking for 12-24 hours. And (3) dehydration and transparency: the tissue of the mice is dehydrated in gradient alcohol (60% -70% -80% -90% -100%) after being fixed by 4% (w/v) poly-methanol solution, and each link is 2-3 hours. And (3) paraffin embedding: after the mouse tissue is dehydrated and transparent, the tissue is embedded in the hot wax, and when the temperature is reduced, the wax can change phase, a crystal structure is formed in the wax, and the mouse tissue block is fixed in the wax. Serial sections: after the wax block becomes cool and hard, the wax block is placed on a freezing machine for 30 minutes, then the wax block is placed on a slicing machine to cut a 4 mu m thick continuous sheet, sheet tissues are placed on the surface of hot water at 40 ℃, and after the tissue sheets are fully spread, the water surface tension effect is fully utilized to enable the tissue sheets to be adsorbed on a glass slide.

Example 14 dyeing of sirius red

Collagen fibers (CollagenFiber) are the most widely distributed fibers in connective tissues, and are widely distributed in various organs, among which skin, sclera and tendons are the most abundant. The type I collagen fibers are mainly bone, skin and tendon fibers; type II collagen fibers are mainly cartilage collagen; type III collagen fibers are mainly used in embryonic tissues, adult blood vessels and gastrointestinal tracts; IV collagen fibers are mainly in the basement membrane. The sirius scarlet and the lining dye liquor are strong acid dyes, are easy to combine with alkaline groups in collagen molecules, and are firmly adsorbed. When the polarizer is used for detection, the collagen fibers have the property of positive uniaxial double refraction, and after being combined with the sirius scarlet compound dyeing liquid, the double refraction can be enhanced, the resolution is improved, and therefore the two types of collagen fibers are distinguished.

EXAMPLE 15microRNA chip

MiRNA isolation kits (extraction of extracellular vesicle mirnas) were used. The specific method comprises the following steps: 100ng of total miRNA per sample was used as input material for the preparation of small RNA libraries. The library is used for(NEB, E7300L) in the preparation of a multiplex small RNA library. Library quality was assessed on Agilent Bioanalyzer 2100 systems using miRNA high sensitivity chips. The chip was sequenced on the Agilent Mouse miRNA 21.0.0 platform. By comparison with the mirbase21.0 data (http:// www.mirbase.org /), known mirnas can be identified. p values <0.05 and |log2 (fold change) >1 were set as thresholds for significant differential expression. Volcanic and hierarchical clustered heatmaps show different mirnas.

Example 16 Dual fluorescence reporter enzyme assay

The fluorescence reporter enzyme (Luciferase) reporter gene system is a reporter system for detecting the activity of firefly Luciferase (fireflyluciferase) by using luciferin (luciferin) as a substrate. The bioluminescence released during the oxidation of luciferases can then be determined by a fluorometer, also known as a chemiluminescent meter (luminometer) or a liquid flash meter. The bioluminescence system of luciferin and luciferase can detect gene expression extremely sensitively and efficiently. Is a detection method for detecting the interaction of transcription factors and target gene promoter region DNA.

EXAMPLE 17 statistical analysis

The variables were statistically analyzed using SPSS statistical software (SPSS STATISTICS software 19.0) and the statistical results were expressed as mean.+ -. Standard deviation (mean.+ -. SEM). The average comparison between the two groups uses independent sample t-test (INDEPENDENT SAMPLE T-tests); the mean value comparison among multiple groups adopts a single factor analysis of variance (one-way ANOVA); comparison between different germ line mice was performed using a multi-factor analysis of variance (two-way ANOVA). Histograms were made using GRAPHPAD PRISM (GraphPad Software inc., USA) software. When P-value <0.05, the group differences are considered statistically significant; in the thermogram analysis, differences were considered statistically significant when the ratio between the treated group and the control group was > 1.5.

The action and effect of the miR-194-3p was further verified according to the operating protocols in examples 1-17 described above.

Experimental example

Experimental example 1

In this example, the results of the effect of the normal myocardial cell exosome (Myo-sEVs ^Nor) and the high-sugar and high-fat treated myocardial cell exosome (Myo-sEVs ^HG/HL) are shown in FIG. 3. In the figures, all values are expressed as mean ± SEM, and P values are calculated by unpaired two-tailed student t test (B) or Tukey test (D-G) after one-way anova.

In this experimental example, the relevant abbreviations include: sEV: an exosome; myo: a cardiomyocyte; nor: normal glucose and normal lipid; HG/HL: high glucose and high lipid; sEV ^Nor: myo-sEV from normal glucose/normal lipid treated cardiomyocytes; sEV ^HG/HL: myo-sEV from high glucose/high lipid treated cardiomyocytes: alpha-SMA: alpha-smooth muscle actin.

In this experimental example, myo-sEVs was isolated by ultracentrifugation and its purity was determined.

As shown in fig. 3a, morphology features of the cardiac secreted exosomes sEV, bar were observed with a Transmission Electron Microscope (TEM): 100nm. Transmission electron microscopy revealed that most Myo-sEVs exhibited typical discoidal vesicles with an average diameter of about 100nm.

As shown in fig. 3B, which is the result of Nanosight trace analysis, nanoparticle trace analysis showed that the number of Myo-sEVs ^HG/HL from HG/HL treated primary cardiomyocytes was significantly higher than Myo-sEVs ^Nor (n=4) in one mouse heart; myo-sEVs had an average size of 114.0.+ -. 43.2nm and Myo-sEVs ^HG/HL was about 4 times that of the control group (Myo-sEVs ^Nor).

FIG. 3, C, shows Western blot analysis of cardiomyocyte lysates, myo-sEV, and fractions of cell culture medium with or without Myo-sEV, using cardiomyocyte-specific alpha-SA antibodies, exosome-labeled antibodies against CD63 and CD81, ESCRT protein antibodies against TSG101 and Alix, and endoplasmic reticulum protein antibodies against Calnexin, with column 1 being sEVs from primary cardiomyocytes, column 2 being cardiomyocyte culture medium without Myo-sEVs, column 3 being cardiomyocyte culture medium with Myo-sEVs, and column 4 being cardiomyocyte lysates. As can be seen Myo-sEVs is rich in EV markers, especially exocrine related proteins such as CD63, CD81, ALIX and TSG101, whereas the endoplasmic reticulum protein Calnexin is barely detectable in Myo-sEVs. In addition, the cardiomyocyte protein α -SA is also found in the Myo-sEV section.

In this example, the effect of Myo-sEVs on the phenotype of myocardial fibroblasts under normal and HG/HL conditions was further examined. Normal sugar/normal lipid (Nor) or HG/HL of fibroblasts were treated with TGF-beta 1 (10 ng/mL) (potent inducer of fibroblast to myofibroblast transformation) for 24 hours, then with the same amount (about 10 ¹⁰) of Myo-sEVs ^Nor or Myo-sEVs ^HG/HL for 24 hours. Representative images as shown in D in fig. 3 show that fibroblasts treated with HG/HL in combination with Myo-sEVs ^HG ^/HL show a more organized actin cytoskeleton, an increase in myofibroblast number, a scale bar of 40 μm, (n=10). Research results show that Myo-sEVs ^Nor can partially improve the transformation of HG/HL and TGF beta 1 induced myocardial fibrosis to myofibroblasts, and Myo-sEVs ^HG/HL can exacerbate the transformation, resulting in an increase in myofibroblast number and a higher degree of cytoskeletal organization of cell morphology.

As in figure 3, E is in vitro immunostaining (n=4) of α -SMA (green) in cardiac fibroblasts under Nor or HG/HL conditions, and Myo-sEV ^Nor or Myo-sEV ^HG/HL treatment conditions, scale bar 50 μm, it can be seen that Myo-sEVs ^Nor treatment improves HG/HL and tgfβ1-induced expression of α -smooth muscle actin (α -SMA), whereas Myo-sEVs ^HG/HL increases α -SMA expression in the presence of tgfβ1 under HG/HL and normal conditions (green, e.g. in figure 3).

Apoptosis of cardiac fibroblasts (n=4) was determined by TUNEL assay (red) under Nor or HG/HL conditions and under Myo-sEV ^Nor or Myo-sEV ^HG/HL treatment as in fig. 3, scale bar 100 μm. It can be seen that Myo-sEVs ^HG/HL did not affect the change in apoptosis (TUNEL assay, red) of cardiac fibroblasts.

As in fig. 3G is the assessment of cell proliferation of Nor or HG/HL treated fibroblasts by Ki67 staining (green) in the presence of Myo-sEV ^nor or Myo-sEV ^HG/HL (n=4), scale bar 100 μm. It can be seen that Myo-sEVs ^HG/HL does not affect the change in proliferation of cardiac fibroblasts (Ki 67 staining, green).

It can be seen that sEVs (Myo-sEVs ^Nor) from normal primary cardiomyocytes can alleviate the high sugar/high lipid (HG/HL) induced conversion of fibroblasts to myofibroblasts, whereas sEVs (Myo-sEVs ^HG ^/HL) from HG/HL treated cardiomyocytes exacerbates this conversion.

Taken together, these results strongly demonstrate that Myo-sEVs ^HG/HL accelerates the transformation of cardiac fibroblasts into myofibroblasts, while Myo-sEVs ^Nor inhibits this transformation.

Experimental example 2

The experimental example performs a related in vivo study to investigate the effect of Myo-sEVs on diabetic myocardial fibrosis. Mice model type 2 diabetes were induced with a combination of High Fat Diet (HFD) and medium dose Streptozotocin (STZ), and the specific procedure is shown in FIG. 4A. Schematic of the process of construction of mice model for induced type 2 diabetes by High Fat Diet (HFD) and micro-STZ intraperitoneal injection, and primary cardiomyocytes Myo-sEVs treated with Nor (Myo-sEV ^Nor) or HG/HL (Myo-sEV ^HG/HL) by tail vein injection, twice at 7 day intervals.

In this experimental example, all values are expressed as mean ± SEM, P-values are calculated by one-way analysis of variance, and Tukey test is performed. Abbreviations include: HW/BW: heart weight to body weight ratio; e: early mitral valve blood flow velocity; e': early tissue doppler velocity; nor: normal glucose and normal blood lipid; HG/HL: high glucose and hyperlipidemia; ND: normal diet; HFD: a high fat diet; col1 alpha: alpha-1; type I collagen; col1: type I collagen; GAPDH: glyceraldehyde-3-phosphate dehydrogenase.

After evaluation of the mouse model, the left ventricular diastolic function and myocardial fibrosis of HFD mice treated with Myo-sEVs secreted by the same number of cardiomyocytes injected in vivo were evaluated, and the results are shown in FIG. 4B. Wherein the E-wave is measured from a four-chamber tangential plane outside the mitral valve using Pulse Wave (PW) Doppler (upper graph), and the early diastole (E') velocity is derived from the tissue Doppler signal of the mitral valve annulus (lower graph). The results show that after treatment with Myo-sEVs ^HG/HL, the ratio of E peak to E 'peak increases significantly (n=6), tail vein injection of Myo-sEVs ^HG/HL aggravates the diastolic dysfunction of the left ventricle (E/E') in HFD and STZ treated C57BL/6 mice, while Myo-sEVs ^Nor improves the diastolic dysfunction of the left ventricle in HFD diabetic mice.

Furthermore, as shown in fig. 4C, after Myo-sEVs ^HG/HL treatment of HFD mice, the heart to body weight ratio (HW/BW) was increased (n=8) compared to Myo-sEVs ^Nor, and it was seen that HFD resulted in a significant increase in heart to body weight ratio (HW/BW), especially when used in combination with Myo-sEVs ^HG/HL, whereas Myo-sEVs ^Nor reversed the HFD-induced increase in HW/BW specific gravity.

Further, after in vivo treatment of ND or HFD mice using Myo-sEV ^Nor and Myo-sEV ^HG/HL, whole mice heart histological sections were stained with sirius scarlet. The representative image as shown in D in fig. 4 shows collagen deposition, bar:1 mm. As can be seen, sirius scarlet staining shows the size of heart cross section and collagen deposition area at the same location after the indicated treatment.

As shown in fig. 4E, representative images of heart histological sections of mice after in vivo treatment of ND or HFD mice with Myo-sEV ^Nor and Myo-sEV ^HG/HL and quantification of the sirius red stained areas showing collagen deposition (n=7), scale bar: 100 μm. It can be seen that Myo-sEVs ^HG/HL treated group aggravated the extent of HFD mice heart fibrosis, while Myo-sEVs ^Nor reduced HFD-induced heart fibrosis.

Further, heart sections of ND or HFD mice after in vivo treatment were immunostained with α -smooth muscle actin (α -SMA, green) (n=10), as shown by F in FIG. 4, scale bar: 100 μm. And the expression levels of Col 1a 1, col1 and a-SMA protein (G) and mRNA (H) in the hearts of mice receiving the indicated treatments were assessed by Western blotting and qPCR, respectively (n=4), as shown in G-H in fig. 4.

It can be seen that consistent with the foregoing findings, immunostaining and Western blotting of α -SMA as shown by F-G in fig. 4, myo-sEVs ^HG/HL promotes expression of col1 α1, col1 and α -SMA in cardiac tissue, while Myo-sEVs ^Nor reduces levels of these proteins, as compared to HFD alone. Further qPCR analysis showed (H in fig. 4) that the transcriptional expression patterns of col1 α1, col1 and α -SMA were similar to the protein expression changes in the mouse heart.

Taken together, myo-sEVs ^Nor prevents myocardial fibrosis in High Fat Diet (HFD) plus STZ treated mice, while Myo-sEVs ^HG/HL exacerbates myocardial fibrosis in these mice.

Experimental example 3

The experimental example conducted a related in vivo study to investigate the effect of Myo-sEVs ^Con in preventing myocardial fibrosis in db/db mice, while Myo-sEVs ^db/db exacerbates the myocardial fibrosis effects in these mice.

To demonstrate that Myo-sEVs effect on myocardial fibrosis is not limited to HFD-induced diabetes, the present experimental example used a hereditary type 2 diabetes model db/db mouse. All values are expressed as mean ± SEM. The P-value was calculated by one-way analysis of variance and then Tukey test was performed.

As shown in the results in fig. 5 a, myo-SEV ^db/db after treatment, an increase in the E to E' peak ratio of db/db mouse heart was observed (n=6); as shown in fig. 5B, the heart to body weight ratio (HW/BW) of db/db mice treated with Myo-SEV ^db/db was increased (n=7) compared to mice treated with Myo-sEV ^Con; as shown in the results of fig. 5C, representative images of collagen deposition in histological sections of mice hearts stained with sirius red, scale bar: 1 mm; as shown in the results of D in fig. 5, sirius scarlet staining shows collagen deposition (n=6) from db/db mouse hearts treated in vivo with Myo-sEV ^Con and Myo-sEV ^db/db, scale bar: 100 μm. It can be seen that, similar to the effects of Myo-sEVs ^Nor and Myo-sEVs ^HG/HL on HFD-induced cardiac fibrosis in the diabetic model, the experimental results show that Myo-sEVs ^Con significantly improves the diastolic dysfunction of db/db mice (see FIG. 5A), reduces relative cardiac weight and diabetic cardiac fibrosis (see FIG. 5B-D), while Myo-sEVs ^db/db exacerbates the diastolic dysfunction of db/db mice and exacerbates cardiac weight and diabetic cardiac fibrosis (see FIG. 5A-D).

Furthermore, as shown in the results of fig. 5E, heart sections of db/db mice after in vivo treatment were immunostained with Myo-sEV ^Con and Myo-SEV ^db/db for α -smooth muscle actin (α -SMA, green) (n=8), bar:100 μm; as shown in F-G of fig. 5, protein (F) and mRNA (G) expression levels (n=4) of Col1 α1, col1 and α -SMA in the hearts of mice receiving the indicated treatments were quantitatively detected using Western blotting and qPCR, respectively. It can be seen that Myo-sEV ^Con inhibited expression of col1α1, col1 and α -SMA in db/db mouse hearts, while Myo-sEVs ^db/db reversed this phenomenon (E-G in FIG. 5).

In summary, myo-sEVs ^db/db exacerbates diastolic dysfunction and diabetic cardiac fibrosis (see A-D in FIG. 5), and increases expression of col1α1, col1, and α -SMA in db/db mouse hearts (E-G in FIG. 5).

Experimental example 4

The experimental example is used for verifying the condition that the content of miR-194-3p in Myo-sEVs ^HG/HL or Myo-sEVs ^db/db is reduced. In this experimental example, all values are expressed as mean ± SEM. P values were calculated by unpaired two-tailed student t test (C-G) or Tukey test (H) after one-way anova. Abbreviations: MC: a cardiomyocyte; and (B): fibroblasts; ND: normal diet, HFD: high fat diet.

Although sEV carries a range of signaling molecules that mediate intercellular communication, SEV MIRNAS is considered one of the key mediators that target specific signaling pathways in receptor cells, particularly in regulating signaling pathways involved in cardiac function. Thus, this experimental example focused on the study to identify specific mirnas present in Myo-sEV that might contribute to the transformation of cardiac fibroblasts to myofibroblasts.

As shown in figure 6a and in table 4 below, differentially expressed mirnas were determined by microRNA microarray analysis, and it was further found that there were 10 up-regulated mirnas and 28 down-regulated mirnas in Myo-sEVs ^HG/HL compared to Myo-sEVs ^Nor (screening criteria: P <0.05, fold > 2.0).

TABLE 4 38 differentially expressed miRNAs identified in Myo-sEVs ^NG/NL and Myo-sEVs ^HG/HL by miRNA chip

/>

As shown in fig. 6B, of the 38 mirnas that exhibited different levels in Myo-sEVs ^HG/HL described above, we selected 11 differentially expressed mirnas that were identical in sequence in humans and mice (screening criteria, P <0.05, fold change >2.0, n=3) and performed gene ontology analysis using DAVID function annotation software (version 7.2).

As shown in the results of fig. 6C, the relative expression of mature mirnas in Myo-sEV ^Nor or Myo-sEV ^HG/HL was quantified using qPCR (n=4), and we confirmed by qPCR validation experiments that one miRNA, miR-194-3p, was identified that showed consistent decrease in both Myo-sEVs ^HG/HL chip and qPCR analysis compared to Myo-sEVs ^Nor.

Notably, as shown in the results of D in fig. 6, the relative expression of pri-miRs (n=4) in primary cardiomyocytes and fibroblasts was detected by qPCR, and we found that pri-miR-194 was enriched in cardiomyocytes cultured without sEV medium, but barely expressed in fibroblasts. This suggests that miR-194-3p is endogenously expressed in cardiac myocytes rather than fibroblasts.

Importantly, as shown by the results in fig. 6E-H, where E in fig. 6 is the relative expression of mature miR-194 family (miR-194-3 p and miR-194-5 p) in Myo-sEV, cardiomyocytes and fibroblasts under Nor or HG/HL treatment using qPCR was quantified (n=4); f in fig. 6 is the relative expression of miR-194-3p measured in Normal Diet (ND), high Fat Diet (HFD) and C57BL/6 mouse hearts, primary cardiomyocytes and fibroblasts of db/db mice (n=6); FIG. 6G is the relative expression levels of miR-194-3p in Myo-sEVs secreted from ND, HFD and db/db mouse cardiomyocytes (n=4); in fig. 6, H is the relative expression of miR-194-3p (n=4) measured when primary cardiac fibroblasts were treated with either Nor or HG/HL in the presence of Myo-sEV ^Nor or Myo-sEV ^HG/HL.

As can be seen, as shown in the results of E in fig. 6, we found that Myo-sEVs contained higher amounts of miR-194-3p than the cell source under normal conditions, suggesting that Myo-sEVs is a key pathway for cardiomyocyte miR-194-3p to function. At the same time, the miR-194-3p levels in the hearts of HFD mice or db/db mice, as well as the miR-194-3p levels in primary cardiomyocytes isolated from both diabetic mouse models (F in FIG. 6) or HG/HL-treated primary cardiomyocytes (E in FIG. 6), were significantly reduced. A decrease in miR-194-3p levels was also observed in Myo-sEVs ^HFD and Myo-sEVs ^db/db (G in FIG. 6). However, miR-194-3p levels in primary myocardial fibroblasts were barely detectable in sEVs-free medium, either HG/HL treatment (E in FIG. 6) or from HFD mice or db/db mice (F in FIG. 6). However, miR-194-3p was detectable in cardiac fibroblasts after treatment with Myo-sEVs ^Nor (24 hours), and levels of miR-194-3p were significantly higher compared to Myo-sEVs ^HG/HL treated group (H in FIG. 6).

These results all indicate that the endogenous miR-194-3p level of fibroblasts is naturally low, while Myo-sEVs plays a critical role in promoting miR-194-3p transport from cardiomyocytes to cardiac fibroblasts.

Experimental example 5

This example was used to demonstrate that agomiR-194-3p can reduce the effects of diabetic myocardial fibrosis in HFD and db/db mice.

To further elucidate the relationship of sEV miR-194-3p to diabetic myocardial fibrosis, we examined the levels of miR-194-3p and its correlation with myocardial fibrosis in HFD mouse serum sEVs and CD172a ⁺ serum sEVs (considered Myo-sEVs) treated with Myo-sEVs ^HG/HL. In this experimental example, all values are expressed as mean.+ -. SEM and P values are calculated by unpaired two-tailed student t test (see FIG. 7, A, C, E-H, J-K).

As shown in the results in fig. 7a, qPCR assays showed relative expression levels of miR-194-3p in Myo-sEV ^Nor or Myo-sEV ^HG/HL treated HDL mouse serum sEV, (cel-miR-39 miRNA as control, n=7). As a result, it was found that Myo-sEVs ^HG/HL secreted by an equivalent number of cardiomyocytes was significantly reduced in serum sEVs from HFD mice receiving Myo-sEVs ^Nor as compared to the respective control group.

As shown in fig. 7B, spearman correlation analysis found that the level of miR-194-3p in serum sEVs was inversely correlated with the heart fibrosis degree of Myo-sEVs treated HFD mice (n=14). It can be seen that miR-194-3p levels in serum sEVs are inversely correlated with the degree of cardiac fibrosis in Myo-sEVs treated HFD mice.

As shown in figure 7C, HFD mice were treated with equal amounts of Myo-sEVs ^HG/HL secreted by cardiomyocytes, and miR-194-3p levels were significantly reduced in CD172a ⁺ serum sEVs (cel-miR-39 miRNA as a control, n=6). As shown in fig. 7D, miR-194-3p levels in CD172a ⁺ serum sEVs were inversely correlated with changes in cardiac fibrosis area in Myo-sEVs treated HFD mice, as determined by Spearman correlation analysis (n=12). It can be seen that CD172a ⁺ serum sEVs was isolated using Dynabeads. Consistent with the results observed in serum sEVs, there was a significant decrease in miR-194-3p levels in CD172a ⁺ serum sEVs in HFD mice treated with Myo-sEVs ^HG/HL, and the decrease in miR-194-3p levels in CD172a ⁺ serum sEVs was inversely correlated with changes in cardiac fibrosis area in Myo-sEVs treated HFD mice.

Furthermore, as shown in the results of E in fig. 7, immunofluorescence assay results showed that miR-194-3p mimic agomiR-194-3p inhibited the expression of α -smooth muscle actin (α -SMA, green) in HG/HL plus Myo-sEV ^HG/HL treated fibroblasts (n=6), bar:100 μm; as shown in F in fig. 7, 194-3p mimic significantly improved tgfβ1 (10 ng/mL), HG/HL and Myo-sEVs ^HG/HL co-treatment for 24 hours induced conversion of fibroblasts to myofibroblasts (n=10), bar:40 μm. The direct evidence obtained above shows that transfection 194-3p mimic significantly reduces HG/HL in combination with Myo-sEVs ^HG/HL -induced fibroblast to myofibroblast transformation.

Based on these findings, the present example examined the effect of agomiR-194-3p on diabetic left ventricular diastolic dysfunction and myocardial fibrosis.

As a result shown in G in fig. 7, an E-wave was measured from a four-chamber tangential plane outside the mitral valve using Pulse Wave (PW) doppler (upper graph). Early diastole (e') velocity is derived from the tissue doppler signal of the mitral annulus (lower panel). After agomiR-194-3p in vivo treatment, the ratio of the E peak to the E' peak was significantly reduced in db/db mice (n=8). As shown in H in fig. 7, the cardiac weight ratio (HW/BW) of db/db mice was reduced (n=6) after in vivo treatment using agomiR-194-3p compared to Negative Control (NC). As a result of the results shown in FIG. 7I, in vivo tissue sections of db/db mice heart treated with agomiR-194-3p and NC were stained with sirius scarlet, and representative images showed collagen deposition (bar: 1 mm). As shown in J in fig. 7, the sirius scarlet staining showed collagen deposition (n=6), bar, of db/db mouse hearts treated in vivo with agomiR-194-3p and NC: 100 μm. As shown by K in fig. 7, NC and agomiR-194-3p alpha-SMA (green) immunofluorescence (n=8), bar, in vivo treated db/db mice heart sections: 100 μm. Taken together, agomiR-194-3p significantly relieves cardiac left ventricular diastolic dysfunction (E/E'), reduces HW/BW ratio, reverses myocardial fibrosis (as indicated by the sirius scarlet staining), and reduces fluorescence signal of α -SMA in db/db mouse heart slices.

Experimental example 6

The embodiment is used for verifying that TGF beta R2 is a new target of miR-194-3 p. In order to explore the potential mechanism of miR-194-3p for protecting the transformation of cardiac fibroblasts into myofibroblasts, we first performed bioinformatic analysis. In this experimental example, all values are expressed as mean ± SEM, and P-values are calculated by unpaired two-tailed student t-test (C-D in fig. 8) or one-factor analysis of variance, tukey's test (E, G in fig. 8).

As shown in FIG. 8A, three different databases (miRWalk, microT and TARGETSCAN) were used to predict potential targets for 1,181 miR-194-3p, and the Venn diagram shows the number of target genes for miR-194-3p predicted by the TARGETSCAN, MIRWALK and microT databases, respectively.

As shown in the results of FIG. 8B, we also used DAVID functional annotation analysis (version 7.2) to determine the signal pathway most likely associated with miR-194-3p, and analyzed the functional enrichment of 1181 identical predicted target genes of miR-194-3p using the KEGG pathway, with the result that the TGF-beta signal pathway was found to be the most important pathway.

To verify these predictions, we performed qPCR validation on fibroblasts treated with miR-194-3p mimics or Negative Control (NC) mimics to detect miR-194-3p modulation of expression of the first 17 predicted genes of interest, as shown in figure 8C. It can be seen that qPCR analyzed the expression levels of the first 17 target genes differentially expressed by miR-194-3p (n=4, ×p < 0.05) after treatment of cardiomyocytes with miR-194-3p mimic.

In addition, this example also uses qPCR and Western blotting assays to assess the relative expression of molecules involved in the TGF-beta signaling pathway in fibroblasts treated with miR-194-3p mimic or miR-194-3p inhibitor. As shown by the results D-E in fig. 8, the relative mRNA (D) and protein (E) expression levels of tgfβ signaling pathway related molecules (n=4) were assessed following treatment of fibroblasts with miR-194-3p mimics or miR-194-3p inhibitors. The research result of the invention shows that in the predicted target, only TGF beta R2 is regulated and controlled by miR-194-3p at the transcription and translation level, and is consistent with the chip result, namely, the expression quantity of the TGF beta R2 is reduced in the presence of miR-194-3p mimic, and the expression quantity of the TGF beta R2 is increased in the presence of miR-194-3p inhibitor.

To further explore the regulatory mechanisms, this example predicted the specific binding site of miR-194-3p in the 3'UTR region of TGF-. Beta.R2 mRNA using TARGETSCAN software, as shown by the predicted binding site of miR-194-3p to the 3' UTR region of TGF-. Beta.R2 as shown in FIG. 8F.

Subsequently, a luciferase reporter experiment was performed in this example, as shown in G in fig. 8, and the luciferase reporter gene results showed that miR-194-3p mimic inhibited the wild-type tgfβr2 'utr sequence in the reporter plasmid to mediate luciferase activity, while the mutant sequence of tgfβr2' utr reversed this effect (n=4). The results demonstrate that miR-194-3p does down-regulate TGF beta R2 at the transcriptional level.

Taken together, the results in this experimental example strongly indicate that tgfβr2 is a key target gene involved in regulating the transformation of myocardial fibroblasts into myofibroblasts by miR-194-3 p.

Experimental example 7

This experimental example was used to verify that tgfβr2 in fibroblasts was up-regulated by Myo-sEVs ^HG/HL or high-sugar high-fat treatment or diabetic status, but that overexpression of miR-194-3p reversed this effect.

Tgfβr2 is an important regulator in myofibroblast transformation. To further investigate the regulatory role of the miR-194-3 p-TGF-beta R2 axis in diabetic myocardial fibrosis, this example used fibroblast cells tested after HG/HL, myo-sEV ^HG/HL, miR-194-3p mimics, miR-194-3p inhibitors, TGF-beta R2 siRNA and TGF-beta R2 inhibitors treatment. In this experimental example, all values are expressed as mean ± SEM, and P-values are calculated by unpaired two-tailed student t-test (C-D in fig. 9) or Tukey test after one-way analysis of variance (a-B in fig. 9).

As shown in figure 9 a, western blotting analysis (n=4) was performed on molecules associated with tgfβ signaling pathways in cardiac fibroblasts after 24 hours of treatment with Myo-sEV ^HG/HL, miR-194-3p mimics or inhibitors and tgfβ pathway inhibitor SB431592 under normal or HG/HL conditions. As shown in the results in fig. 9B, fibroblasts were treated with tgfβr2siRNA, myo-sEV ^HG/HL and miR-194-3p mimics under HG/HL conditions and Western blotting analysis was performed on tgfβ signaling pathway related molecules (n=4). The above results indicate that miR-194-3p inhibitor, myo-sEV ^HG/HL and HG/HL up-regulate TGF beta R2, p-Smad2 and p-Smad3 expression. However, this up-regulation was significantly inhibited when TGF-beta R2 inhibitors SB431542, miR-194-3p mimic or TGF-beta R2siRNA were used.

Furthermore, the expression of TGF-. Beta.R2 in agomiR-194-3p treated db/db mouse hearts was studied in this example. As shown in C-D of fig. 9, protein (C) and mRNA (D) expression levels (n=4) of Col1 α1, col1, α -SMA and tgfβ signaling pathway related molecules were assessed by Western blotting and qPCR in db/db mouse heart tissue treated with agomiR-194-3p and Negative Control (NC). The above results show that agomiR-194-3p significantly reduced the protein expression levels of col1 α1, col1, α -SMA, p-Smad2, p-Smad3 and tgfβr2 in db/db mouse hearts (C in fig. 9). Similarly agomiR-194-3p also significantly inhibited the mRNA expression levels of col1 α1, col1, α -SMA and TGF βR2 in db/db mouse hearts (D in FIG. 9).

Experimental example 8

This experimental example was used to verify that the type 2 diabetes patient had reduced serum sEV miR-194-3p levels and promoted the transformation of cardiac fibroblasts to myofibroblasts.

In this experimental example, the levels of miR-194-3p in serum sEVs of type II diabetes (T2 DM) patients and non-T2 DM subjects were further evaluated. In this experimental example, all values are expressed as mean ± SEM, and P values were calculated by unpaired two-tailed student t-test.

In this experimental example, the serum sEVs from T2DM patients and matched non-T2 DM patients was isolated by using ultracentrifugation. Morphology of serum sEVs was observed using a Transmission Electron Microscope (TEM). And the particle size distribution of serum sEVs was determined using Nanosight tracking analysis. As a result (bar: 100 nm) shown in FIG. 10A-B, it was found that the isolated serum sEV had a round shape, a complete morphology and an average diameter of about 100nm.

Further, as shown in the results of C in fig. 10, nanosight follow-up analysis showed sEVs concentrations (n=30) in serum of diabetic and non-diabetic patients. It can be seen that the number of serum sEV from T2DM patients was significantly increased compared to the non-T2 DM group.

Further, as shown in the results D in fig. 10, western blotting results showed expression of albumin, CD63 and CD81 in serum, serum free of sEV and serum sEV, and Western blotting detection results showed that the exosome marker proteins CD63 and CD81 in the sEVs fraction of serum were higher but the albumin content was lower than in serum.

Further, as shown in the qPCR assay results of fig. 10E, it was shown that the expression of miR-194-3p (cel-miR-39 miRNA as a control, n=30) in serum sEV of diabetic (S-sEV ^DM) and non-diabetic (S-sEV ^non-DM) patients, and it was seen that the miR-194-3p level in serum sEVs of T2DM patient (S-sEVs ^DM) was significantly decreased compared to non-diabetic (S-sEVs ^non-DM).

Similarly, as shown in F in fig. 10, the expression of miR-194-3p was decreased in diabetic patients CD172a ⁺ S-sEV compared to non-diabetic patients (cel-miR-39 miRNA as control (n=30), and it was seen that the level of miR-194-3p was also decreased in CD172a ⁺S-sEVs^DM compared to CD172a ⁺S-sEVs^non-DM.

As shown in G in fig. 10, immunofluorescence results indicate that the S-sEV ^DM treated fibroblasts had stronger α -smooth muscle actin signal (green) (n=15), bar:50 μm.

As shown in H in fig. 10, S-sEV ^DM significantly aggravates tgfβ1 (10 ng/mL) combined treatment induced fibroblast to myofibroblast transformation (n=20), bar:40 μm. Experiments have shown that serum sEVs ^DM promotes the transformation of cardiac fibroblasts to myofibroblasts (10 ng/mL tgfβ1, 24 hours).

As shown by the results I-J in FIG. 10, mRNA (I) and protein (J) expression levels (n=4) of Col 1. Alpha.1, col1, alpha-SMA and TGF-beta signaling pathway related molecules in fibroblasts treated with S-sEV ^non-DM or S-sEV ^DM were evaluated by qPCR and Western blotting. The results show that mRNA and protein expression levels of col1 α1, col1, α -SMA and tgfβr2 in fibroblasts were correspondingly up-regulated after serum sEVs ^DM treatment compared to control.

As shown in the summary graph of K in fig. 10, the content of miR-194-3p in exosomes secreted by cardiomyocytes of type 2 diabetics is reduced, and the expression of tgfβr2 in cardiomyocytes is promoted to be increased after the cells are ingested by the cardiomyocytes, thereby promoting differentiation of the cardiomyocytes into myofibroblasts, resulting in diabetic cardiomyofibrosis.

In conclusion, the self-derived myocardial exosome miR-194-3p can be used as a potential drug target for treating diabetic myocardial fibrosis, the exosome derived from the myocardial cells can be homing and positioned on the myocardial cells by utilizing the homing property of the exosome, and the miR-194-3p mimic can be carried by the myocardial cells exosome or miR-194-3p expression promoter, so that the exosome acts on the heart to serve as a natural transport carrier of a targeting drug.

It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.

Claims

1. Application of miR-194-3p in preparation of medicine for treating diabetic cardiomyopathy.

2. Application of miR-194-3p in preparation of medicine for treating diabetic myocardial fibrosis is provided.

3. Application of miR-194-3p in preparation of medicine for improving diabetic left ventricular diastolic dysfunction is provided.

4. Application of miR-194-3p in preparation of medicine for reducing diabetic myocardial fibrosis area is provided.

5. The use of any one of claims 1-4, wherein the medicament comprises an agent that overexpresses miR-194-3 p.

6. The use of claim 5, wherein the agent that overexpresses miR-194-3p comprises a miR-194-3 p-overexpressing vector, a miR-194-3 p-overexpressing mimetic, a miR-194-3p expression promoter, and/or a miR-194-3 p-overexpressing exosome.

7. Use of a reagent for detecting miR-194-3p in the preparation of a diabetic cardiomyopathy predictive product, a diagnostic product, or a prognostic evaluation product.

8. The use of claim 7, wherein the miR-194-3p is derived from blood exosomes miR-194-3p or from cardiomyocyte exosomes in blood miR-194-3p.

9. Use of a miR-194-3p mimetic, analog, exosome, or expression promoter for preparing a medicament for treating diabetic cardiomyopathy, a medicament for treating diabetic myocardial fibrosis, a medicament for improving diabetic left ventricular diastolic dysfunction, or a medicament for reducing diabetic myocardial fibrosis area.

10. Use of miR-194-3p and its mimics, analogs, or expression promoters for the preparation of a medicament or formulation for modulating tgfβr2 expression or modulating tgfβ pathways.

11. A miR-194-3p, wherein the nucleotide sequence of miR-194-3p is as follows: CCAGUGGGGCUGCUGUUAUCUG.

12. A vector, mimetic, exosome, or expression enhancer that overexpresses the miR-194-3p of claim 11.