CN114317288B - Pitaya endophytic fungus HLB-1 and application thereof - Google Patents

Abstract

The invention discloses a pitaya endophytic fungus HLB-1 and application thereof, belonging to the technical field of microbial application. The strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and is classified and named as Fusarium fujikuroi (CGMCC No. 23819), the preservation address is No. 3 of Xilu No.1 of Beijing Kogyo of Chaoyang, and the preservation date is 22 days at 11 months in 2021 year. Experiments prove that the strain fermentation liquor is used for soaking the dragon fruit seeds, so that the seed germination rate can be improved, the germination time can be shortened, the variation and pollution rate can be reduced, and meanwhile, the strain fermentation liquor has a promoting effect on the growth of the dragon fruit seedlings and has a wide market application prospect in the field of dragon fruit planting.

Description

Pitaya endophytic fungus HLB-1 and application thereof

Technical Field

The invention relates to the technical field of microbial application, in particular to a dragon fruit endophytic fungus HLB-1 and application thereof.

Background

The dragon fruit is rich in nutrition and has multiple health care functions. In recent years, the dragon fruit develops rapidly in provinces such as Guangxi, Guangdong, Fujian and Hainan provinces in China. However, the dragon fruit seeds are small and numerous, like sesame seeds, and are uniformly distributed in the pulp, so that the phenomena of slow germination, irregularity, low germination rate, variation and the like are easily caused when the dragon fruit seeds germinate, and the dragon fruit seeds are adhered to the pulp, are easily infected with mixed bacteria and are mildewed when the dragon fruit seeds germinate, and the germination effect of the seeds is influenced. Therefore, obtaining a method for promoting the healthy germination of the pitaya seeds is extremely important. However, no study has been made in the prior art to date on the use of fungi to promote germination of pitaya seeds.

Disclosure of Invention

The invention aims to provide a dragon fruit endophytic fungus HLB-1 and application thereof, so as to solve the problems in the prior art, and the strain fermentation liquid is used for soaking dragon fruit seeds, so that the seed germination rate can be improved, the germination time can be shortened, the variation and pollution rate can be reduced, and the strain fermentation liquid has wide market application prospect in the field of dragon fruit planting.

In order to achieve the purpose, the invention provides the following scheme:

the invention provides a dragon fruit endophytic fungus HLB-1 which is preserved in the common microorganism center of China Committee for culture Collection of microorganisms and is named as Fusarium fujikuroi (CGMCC) in classification, wherein the preservation number is CGMCC No.23819, the preservation address is No. 3 of Beijing Kogyao No.1 Hospital in Chaoyang district, and the preservation date is 22 days at 11 months in 2021.

The invention also provides an application of the pitaya endophytic fungus HLB-1 in seedling raising of plant seeds.

Further comprises the step of soaking and culturing plant seeds by using the fermentation liquor of the pitaya endophytic fungi HLB-1.

Further, the fermentation liquor is obtained by the following steps: inoculating the dragon fruit endophytic fungi HLB-1 into a liquid PDA culture medium, performing shake fermentation culture at 28 ℃ in a dark place for 10 days, and filtering after the fermentation culture is finished.

Further, the soaking culture is to add the fermentation liquor into the plant seeds until the seeds are wet, and to culture the treated plant seeds in a constant temperature environment of 28 ℃ until no seeds germinate.

Further, the raising of the plant seed seedling comprises promoting germination of the plant seed and/or promoting growth of the plant seedling.

Further, the promotion of plant seed germination is specifically to shorten the germination time of plant seeds, increase the germination rate and/or reduce the pollution rate.

Further, the promotion of the growth of the plant seedling is specifically an increase in the height, root length and/or fresh weight of the plant seedling.

Further, the plant comprises a dragon fruit.

The invention discloses the following technical effects:

experiments prove that the strain fermentation liquor has the effects of improving the germination rate of seeds, shortening the germination time and reducing the variation and pollution rate by soaking the pitaya seeds in the strain fermentation liquor, and meanwhile, the strain fermentation liquor has a promotion effect on the growth of pitaya seedlings and has a wide market application prospect in the field of pitaya planting.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 is a colony morphology diagram of the endophytic fungi HLB-1 of pitaya according to the present invention;

FIG. 2 is a diagram showing the spore and hyphal morphology of the dragon fruit endophytic fungus HLB-1 of the present invention;

FIG. 3 shows the effect of the fermentation broth of the endophytic fungi HLB-1 of the dragon fruit on the germination of the dragon fruit seeds, wherein the left graph is the fermentation stock solution and the right graph is the control;

fig. 4 is a situation of field planting of pitaya endophytic fungi HLB-1 on roots of pitaya seedlings, wherein the left picture is a fermentation stock solution, and the right picture is a control.

Detailed Description

Reference will now be made in detail to various exemplary embodiments of the invention, the detailed description should not be construed as limiting the invention but as a more detailed description of certain aspects, features and embodiments of the invention.

It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. Further, for numerical ranges in this disclosure, it is understood that each intervening value, between the upper and lower limit of that range, is also specifically disclosed. Every smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in a stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference herein for the purpose of disclosing and describing the methods and/or materials associated with the documents. In case of conflict with any incorporated document, the present specification will control.

It will be apparent to those skilled in the art that various modifications and variations can be made in the specific embodiments of the present disclosure without departing from the scope or spirit of the disclosure. Other embodiments will be apparent to those skilled in the art from consideration of the specification. The description and examples are intended to be illustrative only.

As used herein, the terms "comprising," "including," "having," "containing," and the like are open-ended terms that mean including, but not limited to.

Example 1 separation, purification and characterization of the Pitaya endophytic fungus HLB-1

1. Separation and purification of bacterial strain

The Pitaya endophytic fungus HLB-1 is separated from the root of Pitaya in the West-village region of Guangxi Nanning city. The method comprises the following steps: and (3) washing the collected soil on the surface of the dragon fruit root sample with sterile water, sucking surface water with sterile filter paper, and airing at room temperature. Cutting root system into 5mm root segments with sterile blade, soaking in 75% alcohol for 1min, soaking in 5% sodium hypochlorite solution for 5min, washing with sterile water for 3 times, drying the surface water of root sample with sterilized filter paper, transferring to PDA culture medium, and placing 3 root segments in each dish. And (3) coating the sterile water washing liquid with the surface sterilized for the last 1 time on a PDA (personal digital assistant) flat plate to detect whether the foreign bacteria pollution exists. After culturing for 7d in a constant temperature incubator at 25 ℃. Separating and purifying by tip mycelium method, and repeatedly purifying until obtaining purified colony. And respectively transferring the purified strains to a slant culture medium for storage and standby.

2. Identification of strains

2.1 morphological characteristics

The colony morphology of the strain on PDA plate is shown in figure 1, the diameter of colony after culturing at 28 deg.C for 5d is 85-90mm, the colony is circular, the hypha is white, the bottom of the colony is coffee. The conidia produced by this strain are shown in FIG. 2.

2.2 molecular biological methods for identifying the above isolated species

The genome of the isolated species was extracted using a fungal genome DNA extraction kit from solibao corporation, according to the kit instructions. The extracted DNA is used as a template, and the universal primers ITS1 and ITS4 are used for PCR amplification to identify the species.

Wherein the primer sequences are as follows:

ITS1 is TCCGTAGGTGAACCTGCGG;

ITS4 is TCCTCCGCTTATTGATATGC.

PCR amplification conditions: pre-denaturation at 94 ℃ for 5.0min, denaturation at 94 ℃ for 50s, annealing at 50 ℃ for 50s, extension at 72 ℃ for 1min for 45s, 30 cycles, and extension at 72 ℃ for 10 min.

And recovering PCR amplification products and then sequencing. The sequencing results are as follows (SEQ ID No. 1):

TCCTCCGCTTATTGATATGCTTAAGTTCAGCGGGTATTCCTACCTGATCCGAGGTCAACATTCAGAAGTTGGGGGTTTAACGGCTTGGCCGCGCCGCGTACCAGTTGCGAGGGTTTTACTACTACGCAATGGAAGCTGCAGCGAGACCGCCACTAGATTTCGGGGCCGGCTTGCCGCAAGGGCTCGCCGATCCCCAACACCAAACCCGGGGGCTTGAGGGTTGAAATGACGCTCGAACAGGCATGCCCGCCAGAATACTGGCGGGCGCAATGTGCGTTCAAAGATTCGATGATTCACTGAATTCTGCAATTCACATTACTTATCGCATTTTGCTGCGTTCTTCATCGATGCCAGAACCAAGAGATCCGTTGTTGAAAGTTTTGATTTATTTATGGTTTTACTCAGAAGTTACATATAGAAACAGAGTTTAGGGGTCCTCTGGCGGGCCGTCCCGTTTTACCGGGAGCGGGCTGATCCGCCGAGGCAACAATTGGTATGTTCACAGGGGTTTGGGAGTTGTAAACTCGCGTAATGATCCCTCCGCAGGTTCACCCTACGGA。

the sequencing results are subjected to BLAST (www.ncbi.nlm.nih.gov /) comparison on an NCBI website, and the result of morphological identification is combined to confirm that the pitaya endophytic fungus HLB-1 is Fusarium graminearum (Fusarium fujikuroi).

The classification name of the dragon fruit endophytic fungi HLB-1 is Fusarium canceolatum (Fusarium fujikuroi), the Fusarium cancescens is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.23819, the preservation address is No. 3 of Xilu No.1 of Beijing Kogyo Hongyao, and the preservation time is 22 days at 11 months in 2021.

Example 2 verification of the Effect of Pitaya endophytic fungi HLB-1

1. Preparation of strain fermentation liquor of dragon fruit endophytic fungi HLB-1

Culturing the endophytic fungi HLB-1 of dragon fruit on PDA plate at 28 deg.C for 5d under aseptic condition, beating 3 blocks of fungus cake with diameter of 0.5cm at the colony edge, inoculating into sterilized and cooled 200ml liquid PDA culture medium, and inoculating into sterile agar block with the same size as control group. Keeping the temperature at 28 ℃, shaking the bed for 180r/min, and culturing in the dark for 10 days to ensure that the culture medium is fully fermented. After the fermentation is finished, filtering the liquid fermentation product by using 5 layers of sterilized gauze to obtain a fermentation liquor stock solution, and storing at 4 ℃ for later use.

2. Effect of fermentation broth on Pitaya seed germination

2.1 selecting healthy and mature red-skin pitaya fruits in an orchard, peeling, putting the pulp into a small-aperture nylon mesh bag, rubbing and washing, cleaning the pulp, and putting the seeds in a shade place for air drying for later use.

2.2 uniformly placing the dragon fruit seeds in a culture dish paved with two layers of sterile filter paper, diluting the endophytic fungi fermentation stock solution by 100 times, setting the fermentation stock solution, the fermentation liquor dilution solution by 100 times and a control for three treatments, wherein the control uses sterile water, 2ml of liquid is added into each flat plate every day at regular time, and the filter paper is kept moist. The culture dish is placed in a constant temperature artificial climate box at 28 ℃ for carrying out a seed germination test. The number of germinated seeds (based on the fact that the seeds are exposed to white during germination and the length of radicle is not less than the radius of the seeds) of each treatment is observed and recorded every day until no seeds germinate for 3 days (as shown in figure 3), and finally the number of days required for 50 percent germination, the final germination rate and the pollution rate are calculated (see table 1).

And (4) observing whether the seeds are polluted or not through a dissecting mirror, and counting the pollution if the seeds are observed to have mould growth on the surfaces. The contamination rate is the number of contaminated seeds/total number of seeds × 100%.

3. Effect of fermentation broth on growth of dragon fruit seedlings

After the seeds of the dragon fruits germinate, the seedlings are moved into a tray and cultured for 15d again, the growth condition of the seedlings is observed, and the height, the root length and the fresh weight of 20 seedlings are measured (see table 1). The colonization of the endophytic fungi at the roots of the seedlings treated differently was examined microscopically (as shown in FIG. 4).

TABLE 1 influence of Pitaya endophytic fungi HLB-1 fermentation broth on seed germination and seedling growth of Pitaya

According to the experimental data in the table 1, the pitaya endophytic fungus HLB-1 can advance the germination of seeds of the pitaya by 2 days, compared with a contrast, the germination rate is improved by 20.42%, the pollution rate is reduced by 97.16%, the seedling height is 0.37cm higher than the average height of the contrast, the root length is 0.71cm higher than the contrast, and the fresh weight is 0.32g higher than the contrast, so that the seed germination rate can be improved, the germination time is shortened, the variation and the pollution rate are reduced by soaking the pitaya seeds in the pitaya endophytic fungus HLB-1 fermentation liquid obtained by screening through the method, and meanwhile, the strain fermentation liquid has a promoting effect on the growth of the seedlings of the pitaya and has a wide market application prospect in the field of pitaya planting.

The above-described embodiments are merely illustrative of the preferred embodiments of the present invention, and do not limit the scope of the present invention, and various modifications and improvements of the technical solutions of the present invention can be made by those skilled in the art without departing from the spirit of the present invention, and the technical solutions of the present invention are within the scope of the present invention defined by the claims.

Sequence listing

<110> Guangxi Zhuang nationality college of autonomous region agro-sciences

<120> pitaya endophytic fungus HLB-1 and application thereof

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 560

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tcctccgctt attgatatgc ttaagttcag cgggtattcc tacctgatcc gaggtcaaca 60

ttcagaagtt gggggtttaa cggcttggcc gcgccgcgta ccagttgcga gggttttact 120

actacgcaat ggaagctgca gcgagaccgc cactagattt cggggccggc ttgccgcaag 180

ggctcgccga tccccaacac caaacccggg ggcttgaggg ttgaaatgac gctcgaacag 240

gcatgcccgc cagaatactg gcgggcgcaa tgtgcgttca aagattcgat gattcactga 300

attctgcaat tcacattact tatcgcattt tgctgcgttc ttcatcgatg ccagaaccaa 360

gagatccgtt gttgaaagtt ttgatttatt tatggtttta ctcagaagtt acatatagaa 420

acagagttta ggggtcctct ggcgggccgt cccgttttac cgggagcggg ctgatccgcc 480

gaggcaacaa ttggtatgtt cacaggggtt tgggagttgt aaactcgcgt aatgatccct 540

ccgcaggttc accctacgga 560

Claims (5)

1. The application of the dragon fruit endophytic fungus HLB-1 in plant seed seedling raising is characterized in that the dragon fruit endophytic fungus HLB-1 is preserved in the common microorganism center of China Committee for culture of microorganisms and is classified and named as Fusarium fujikuroi, the preservation number is CGMCC No.23819, the preservation address is No. 3 of Xilu 1 of North Chen of the Korean district in Beijing, and the preservation date is 22 days 11 months at 2021; the pitaya endophytic fungus HLB-1 is separated from the root of the pitaya;

the application comprises the step of soaking and culturing plant seeds by using fermentation liquor of the pitaya endophytic fungi HLB-1; the fermentation liquor is obtained by the following steps: inoculating the pitaya endophytic fungi HLB-1 into a liquid PDA culture medium, performing shake fermentation culture at 28 ℃ in a dark place for 10 days, and filtering after the fermentation culture is finished;

the plant is dragon fruit.

2. The application of claim 1, wherein the soaking culture is carried out by adding the fermentation liquid into the plant seeds until the seeds are wet, and culturing the treated plant seeds in a constant temperature environment of 28 ℃ until no seeds germinate.

3. The use according to claim 1, wherein raising the plant seed comprises promoting germination of the plant seed and/or promoting growth of the plant seedling.

4. Use according to claim 3, wherein the promotion of germination of plant seeds is in particular a reduction of the germination time of plant seeds, an increase of the germination rate and/or a reduction of the contamination rate.

5. Use according to claim 3, wherein the promotion of young plant growth is in particular an increase in young plant height, root length and/or fresh weight.

Images