CN114306608A

CN114306608A - Tumor treatment target adapted to hypoxic or anoxic microenvironment and application thereof

Info

Publication number: CN114306608A
Application number: CN202210004820.2A
Authority: CN
Inventors: 刘雪松; 赵翔宇
Original assignee: ShanghaiTech University
Current assignee: ShanghaiTech University
Priority date: 2022-01-04
Filing date: 2022-01-04
Publication date: 2022-04-12
Anticipated expiration: 2042-01-04
Also published as: CN114306608B

Abstract

The invention discloses a therapeutic target spot of tumor adapting to hypoxic or anoxic microenvironment and application thereof. According to the invention, by constructing a FLAD1 gene-deleted tumor cell line, the FLAD1 deletion is found to obviously inhibit the proliferation of tumor cells in a hypoxic state. According to the invention, by extracting the pathway related to FAD metabolism in the KEGG database and analyzing the gene expression of the sample in the TCGA database, the riboflavin metabolism of the hypoxic tumor, especially the anabolism of FAD is obviously enhanced. By supplementing the cell culture medium of tumor cells with photopigment, a riboflavin degradant, proliferation of cells under hypoxia was found to be significantly inhibited. The invention provides a brand new treatment target for clinically targeted treatment of hypoxic or anoxic tumors, can solve the technical problems of poor treatment effect and poor prognosis caused by tumor adaptation to hypoxia at present, and has good application prospect.

Description

Tumor treatment target adapted to hypoxic or anoxic microenvironment and application thereof

Technical Field

The invention relates to a tumor treatment target suitable for a hypoxic or anoxic microenvironment and application thereof, belonging to the technical field of molecular biology and biomedicine.

Background

Tumor Microenvironment (TME) is an important component of tumor tissue. Hypoxia is an important feature of the tumor microenvironment, of which there is about oneThe characteristic exists in the solid tumor¹. Tumor hypoxia and poor clinical prognosis are observed in a variety of cancer types^2,3And hypoxia and genomic instability^4,5Resistance to chemotherapy and radiotherapy⁶Immunosuppression⁷And immune escape⁸Are closely related. Current studies indicate that tumor hypoxia is a major factor in the resistance to anticancer therapy⁹. Targeted therapy of hypoxic tumor cells has been an important scientific problem for clinical applications. However, no corresponding treatment is currently developed for the vast majority of tumors. This is due to a number of reasons, one of which is that the molecular mechanisms of adapting tumors to hypoxic environments are not known.

In human cells, the FLAD1 gene encodes Flavin adenine dinucleotide synthase (FAD synthsase, FADS). Riboflavin obtained from food needs to be catalyzed by riboflavin kinase (RFK) and FLAD1 to produce FAD. No study has been done to date to show that FLAD1, and the FAD anabolic pathway, have an important role in adapting tumor cells to hypoxic microenvironments, nor has it been proposed to selectively target killing tumor cells in a hypoxic state by targeting FLAD1, and the FAD anabolic pathway.

Reference documents:

1.Weber,C.E.&Kuo,P.C.The tumor microenvironment.Surgical Oncology 21,172–177(2012).

2.Lassen,P.et al.HPV-associated p16-expression and response to hypoxic modification of radiotherapy in head and neck cancer.Radiotherapy and Oncology 94,30–35(2010).

3.Hoskin,P.J.,Rojas,A.M.,Bentzen,S.M.&Saunders,M.I.Radiotherapy With Concurrent Carbogen and Nicotinamide in Bladder Carcinoma.JCO 28,4912–4918(2010).

4.Bhandari,V.et al.Molecular landmarks of tumor hypoxia across cancer types.Nature Genetics 51,308–318(2019).

5.Bhandari,V.,Li,C.H.,Bristow,R.G.&Boutros,P.C.Divergent mutational processes distinguish hypoxic and normoxic tumours.Nature Communications 11,737(2020).

6.Eliasson,P.&

J.-I.The hematopoietic stem cell niche:low in oxygen but a nice place to be.J Cell Physiol 222,17–22(2010).

7.Chen,Z.et al.Ligand-receptor interaction atlas within and between tumor cells and T cells in lung adenocarcinoma.Int J Biol Sci 16,2205–2219(2020).

8.Donato,C.et al.Hypoxia Triggers the Intravasation of Clustered Circulating Tumor Cells.Cell Reports 32,(2020).

9.Ye,Y.et al.Characterization of hypoxia-associated molecular features to aid hypoxia-targeted therapy.Nature Metabolism 1,431–444(2019).

disclosure of Invention

The technical problem to be solved by the invention is as follows: at present, no effective medicine capable of treating hypoxic or anoxic tumors in a targeted manner exists in clinic.

In order to solve the technical problems, the invention provides an agent for inhibiting expression or activity of FLAD1 and/or an agent for inhibiting FAD anabolism in preparation of a medicament for treating tumors adapting to hypoxic or anoxic microenvironments.

Preferably, the agent for inhibiting expression or activity of FLAD1 comprises siRNA or shRNA for inhibiting expression of FLAD1 in a targeted manner.

Preferably, the agent that inhibits FAD anabolism comprises an agent that inhibits expression or activity of a characteristic molecule of interest in the FAD anabolic pathway; the FAD anabolic pathway related characteristic molecules include at least one of SLC52A1, SLC52A2, SLC52A3 and RFK.

Preferably, the agent for inhibiting FAD anabolism further comprises riboflavin degradants.

Preferably, the riboflavin degradant comprises riboflavin.

Preferably, the tumor adapted to hypoxic or anoxic microenvironment comprises any one of lung cancer, prostate cancer, breast cancer, esophageal cancer, liver cancer, pancreatic cancer, stomach cancer, thyroid cancer, thymus cancer, endometrial cancer, sarcoma and melanoma.

Compared with the prior art, the invention has the beneficial effects that:

the invention starts from the genome characteristics of the tumor, finds a key gene FLAD1 of the tumor adapting to a hypoxic or anoxic environment, and the action mechanism of the FLAD1 is completely independent of a classical hypoxia adapting HIF passage; the invention discovers that FLAD1 participates in riboflavin metabolism for the first time, especially FAD anabolism is more active under the anoxic condition of tumors, when FAD anabolism is inhibited, proliferation inhibition of tumor cells under hypoxia occurs, and the proliferation inhibition can be recovered after FAD is supplemented; the invention provides a brand new treatment target for clinically targeted treatment of hypoxic or anoxic tumors, can solve the technical problems of poor treatment effect and poor prognosis caused by tumor adaptation to hypoxia at present, and has good application prospect.

Drawings

FIG. 1 shows the expression and copy number characteristics of FLAD1 gene; a: expression of FLAD1 was significantly elevated in multiple tumor types compared to adjacent normal tissues in the TCGA database; b: a number of hypoxic tumors had significantly increased expression of FLAD1 compared to the corresponding non-hypoxic tumors in the TCGA database; c: the expression level of FLAD1 in the lung cancer in an independent data set in the Oncoine database is obviously higher than that of normal lung tissues; d: copy number variation of FLAD1 in normal lung tissue, hypoxic lung cancer and non-hypoxic lung cancer samples; wherein all data are shown as median (Q1, Q3);

FIG. 2 shows that FLAD1 knockout inhibited tumor growth under hypoxia; a: illustrating CRISPR technology targeting a sgRNA targeting the FAD synthesis domain of FLAD1, knockout FLAD1, and a pair of FLAD synthesis domains designed using Benchling (www.benchling.com); b: detecting FLAD1 knock-out results of three tumor cell lines of PC9, H1299 and A549 by using Western blot; c: PCR detection of FLAD1 knock-out results of three tumor cell lines PC9, H1299 and A549; d: wild type WT and FLAD1 knock-out cells of tumor cells H1299 (upper panel) and PC9 (lower panel) in normal oxygen concentrationsDegree and hypoxia (1% O)₂) The proliferation result of (a), wherein the cell viability (%) is 100% x relative number of cells under hypoxia/relative number of cells under normal oxygen concentration; e: nude mice were inoculated subcutaneously with wild type PC9 and FLAD1 knock-out cells, and tumor volumes and tumor weights were compared 35 days post inoculation, scale: 1 cm; wherein all data are presented as mean ± SEM;

FIG. 3 is a graph showing that over-expression of FLAD1 promotes proliferation of lung cancer cell line A549 in hypoxia; a: qPCR detects lung cancer cell line A549 over-expressed by FLAD1 constructed by lentivirus and human embryo lung fibroblast WI 38; b: western blot detection of a lung cancer cell line A549 over-expressed by FLAD1 constructed by lentivirus and a human embryo lung fibroblast WI38, wherein the number represents the standardized gray value of each group of FLAD1 relative to the reference protein beta-actin; c: wild Type (WT) and FLAD1 overexpression (FLAD1 OE) of the lung cancer cell line A549 at normal oxygen concentration and hypoxia (1% O)₂) Proliferation results under conditions where cell viability (%) — 100% x relative number of cells in hypoxia/relative number of cells in normal oxygen concentration; d: lung cancer cell line PC9 wild type, FLAD1 knockout cell and FLAD1 knockout post-complementation of 2uM FAD in normoxia and hypoxia (1% O)₂) (ii) proliferation results; e: knockdown of HIF1A or targeted inhibition of HIF2A hypoxia (1% O)₂) mRNA levels of FLAD1 under conditions; wherein all data are presented as mean ± SEM;

FIG. 4 shows FAD anabolic hyperactivity in hypoxic lung cancer samples; a: the KEGG comprises main genes participating in FAD metabolism, wherein the genes participating in FAD anabolism are shown in bold font, and the genes participating in FAD catabolism are shown in italics; b: proliferation results of Wild Type (WT) and FLAD1 knock-out cells (KO) of lung cancer cell line a549 after addition of 5 μ M photopigmin (Lumiflavin); c: expression of FAD metabolism-related genes in the TCGA database in tumors compared to normal tissues; d: expression of FAD metabolism-related genes of hypoxic tumors compared to non-hypoxic tumors in the TCGA database; wherein all data are shown as median (Q1, Q3);

in each of the above figures, a indicates that significant difference exists between the two groups by statistical analysis, and the P value is less than 0.001, and a indicates that significant difference exists between the two groups by statistical analysis, and the P value is less than 0.01; indicates that the two groups have significant difference by statistical analysis, and the P value is less than 0.05; ns means that there was no significant difference between the two groups by statistical analysis.

Detailed Description

In order to make the invention more comprehensible, preferred embodiments are described in detail below with reference to the accompanying drawings.

The invention provides an application of FAD anabolic pathway participated by FLAD1 and FLAD1 as a target point in targeted therapy of hypoxic or anoxic tumors:

firstly, the invention finds out a gene FLAD1 closely related to tumor hypoxia adaptation by systematically analyzing the genomic DNA variation and the gene expression difference of tumors (pan-cancerous tumor, including lung cancer, breast cancer, prostate cancer, liver cancer, brain glioma and the like) in and out of a hypoxia state. The gene copy number and mRNA expression of FLAD1 are obviously up-regulated in hypoxic tumors (including lung cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, melanoma, esophageal cancer, gastric cancer, thyroid cancer and the like) compared with non-hypoxic tumors.

Further, the invention discovers that the FLAD1 deletion obviously inhibits the proliferation of the tumor cells under the hypoxic condition by constructing a tumor cell line with the FLAD1 gene deletion. Experiments show that the FLAD1 can be a molecular target for targeted therapy of tumors in hypoxic or anoxic microenvironments for the first time. Furthermore, from the data in the GEO database, it was found that FLAD1 mRNA levels did not change significantly under hypoxic conditions after knockout of HIF1A or inhibition of HIF 2A. It can be seen that FLAD1 regulates tumor hypoxia adaptation independently of known HIF (hypoxia-absorbent factors) signaling pathways.

Further, the invention finds that the riboflavin metabolism of the hypoxic tumor, especially the anabolism of the FAD is obviously enhanced by extracting pathways related to the FAD metabolism in the KEGG database and analyzing the gene expression of samples in the TCGA database. Among them, the genes SLC52A1, SLC52A2, SLC52A3, RFK, FLAD1 are involved in FAD anabolism, and the genes ENPP1, ENPP3 and ACP5 are involved in FAD catabolism. Among these genes involved in FAD anabolism are ubiquitous in tumors, and are significantly upregulated, especially in hypoxic tumors. By supplementing the cell culture medium with photopigment, a riboflavin degradant, proliferation of cells under hypoxia was found to be significantly inhibited. Growth inhibition was partially restored after FAD supplementation of tumor cell lines with FLAD1 knockout.

Example 1

This example provides the use of FLAD1 in the targeted treatment of hypoxic or anoxic tumors:

(1) analysis of the expression and copy number characteristics of FLAD1 Gene

Based on a cancer genome map (TCGA) and an Oncoine database, the gene copy number of FLAD1 and the expression of mRNA in hypoxic tumors (including lung cancer, breast cancer, prostate cancer, liver cancer, pancreatic cancer, melanoma, esophageal cancer, gastric cancer, thyroid cancer and the like) are analyzed, and the results are shown in FIGS. 1A-D, and compared with non-hypoxic tumors, the gene copy number of FLAD1 and the expression of mRNA in the hypoxic tumors are both obviously increased.

(2) The knockout of FLAD1 can inhibit the proliferation of hypoxic tumor cells and reduce the tumorigenicity of hypoxic tumor cells in vivo

Constructing sgRNA plasmid, designing sgRNA targeting FLAD1 by using Benchling website, as shown in fig. 2A, the sequences of the grnas of the present invention are the following 2 (FLAD1-sgRNA):

A(5’-3’)：AAACAGCTCACTGTTCTCGT(SEQ ID NO：1)；

B(5’-3’)：CAGAAGTAGGGGTCGGGCGT(SEQ ID NO：2)；

the synthetic primers (shown in Table 1) were subjected to PCR with the template plasmid pUC57 kan-T7-gRNA-U6V 2(Addgene, 115520) and the PCR product was recovered by a general purpose DNA purification recovery kit (TIANGEN, DP 214-03). The recovered PCR product and the pGL3-U6-sgRNA-ccdB-EF1a-Puromycin plasmid were digested with BsmBI (BioLabs, R0739S) and ligated with T4 ligase (BioLabs, M0202). The ligation products were transformed into DH 5. alpha. competent cells, incubated on ice for 30min, heat-shocked in a water bath at 42 ℃ for 90sec, rapidly incubated on ice for 2min, and then cultured with shaking at 37 ℃ for 1h (150r/min) in 800uL of LB medium. And (4) centrifuging, coating a plate, and picking, cloning and sequencing. The resulting plasmid was pGL3-2U6-2sgRNA-EF1a-Puromycin (pGL3-sgRNA) and was used for the construction of FLAD1 knockout lung cancer cell lines H1299, A549 and PC9, described below.

TABLE 1 sgRNA sequence of targeting FLAD1 (synthesized by Beijing Ongzhike Biotech Co., Ltd.)

pGL3-sgRNA plasmid and pST1374-NLS-flag-linker-Cas 9-bleastidin plasmid (Addgene, 44758) were transfected in lung cancer cell lines H1299, A549 and PC9, according to

2000(Invitrogen, 11668019) reagent, the day before transfection, target cells H1299, PC9 and A549 were transferred to a 6-well plate, respectively, to achieve 70-90% confluency at the time of transfection. For each transfected sample, 2. mu.g of pGL3-sgRNA plasmid and 2. mu.g of pST1374-NLS-flag-linker-Cas 9-blestic idin plasmid were diluted into 250. mu.L of serum-free Opti-MEM medium and gently mixed. Mixing 10 μ L of

2000 to 250. mu.L of serum-free Opti-MEM medium, gently mixed, incubated at room temperature for 5min, and diluted

2000 was mixed with the previously diluted plasmid and gently mixed and incubated at room temperature for 20 min. The mixture was added to the medium of the cells of interest, mixed gently, incubated in a carbon dioxide incubator at 37 ℃ for 6h and replaced with fresh complete medium.

Screening and sorting FLAD1 knockout monoclonal cells, and simultaneously screening two medicaments with final concentrations of 1.25, 1.5, 1.25 mu g/mL puromycin (Biyunyan, ST551) and 20, 10 and 10 mu g/mL blasticidin (YEASEN, 60218ES10) after 48 hours for transfected H1299, A549 and PC9 cells. Adding puromycin and pyricularia grisea with corresponding concentrations respectivelyWhen all control groups had been completely killed, the remaining cells from the transfected group were digested and BD FACSAria was used^TMIII sorting single cells into 96-well plates. After a sufficient number of single cells have been grown, their DNA is extracted using a rapid DNA extraction reagent (EPICENTRE, QE0905T) and tested by PCR (primer sequences are shown in Table 2). A band of about 500bp appears after PCR of a wild cell, and a band appears at a position of about 300bp of a successfully knocked-out cell. For the correct cells to be verified by PCR, the cultures were expanded and the proteins were extracted using protease inhibitors (Sigma-Aldrich, P8340-1ML) and RIPA lysates (formulation: 150mM NaCl, 50mM Tris-HCl (1M, pH 8.0), 1% NP-40, 0.5% Sodium deoxyholate (10%), 0.1% SDS (10%). And carrying out protein detection according to a Western blot general flow. Protein quantification was performed using the Bradford protein concentration assay kit (detergent compatible type) (petunia, P0006C) with a 15 μ g loading of protein per well. Antibodies used include Anti-beta Actin antibody (Abcam, ab6276), Anti-FLAD1 antibody (Abcam, ab95312), Goat Anti-Rabbit IgG HRP (abart, M21002) and Goat Anti-Mouse IgG HRP (abart, M21001). The results are shown in FIGS. 2b and 2C.

TABLE 2 primer sequences used for PCR detection of FLAD1 knocked out monoclonal cells (synthesized by Beijing Ongke Biotech Co., Ltd.)

Primer name	Sequence (5 '-3')
		FLAD1_KO_Forward	AAGGGGTGAGAGTCTGTCCT(SEQ ID NO：5)
FLAD1_KO_Reverse	GGTGATAAACCCTCTTCCCCA(SEQ ID NO：6)

Cell proliferation assay wild-type and FLAD1 knock-out cell lines H1299 and PC9 were seeded at 5000 per well in 24-well plates (Thermo/Nunc, 142475) with three biological replicates per group and at normal and low oxygen (1% O), respectively₂) Then, the culture was carried out. After 96h, the cells were fixed with 4% paraformaldehyde at room temperature for 15min and then rinsed 3 times with 1 × PBS for 2min each. Add 500. mu.L of 0.1% crystal violet staining solution (BBI, A600331-0025) and incubate at room temperature for 60min, wash the cells with distilled water 3 times for 2min each time, and dry overnight. Before measurement, 500. mu.L of 10% acetic acid was added to each well to decolorize the mixture, and after sufficient shaking, the mixture was detected at 595nm by a microplate reader (MD SpectraMax i 3). As shown in FIG. 2D, it is clear from FIG. 2D that both FLAD1 knockout H1299 and PC9 cell lines exhibited proliferation inhibition under hypoxic conditions, relative to their wild-type.

Nude mice subcutaneous tumor formation experiment: wild-type PC9 and FLAD1 knock-out cell lines were prepared, the cells were digested and centrifuged, and then 1 XPBS was used to wash the cells 1 time, after centrifugation, the cells were resuspended in 1 XPBS, and the cell suspension was adjusted to a concentration of 500 ten thousand cells/100 μ L, and 100 μ L was injected subcutaneously into BALB/c nude mice (Shanghai Ling Biotech Co., Ltd.). Three biological replicates. The longest side of the subcutaneous tumor was measured using a vernier caliper every other day and is designated as L (mm) and the shortest side as W (mm). By the formula V ═ L × W²0.52 calculate the volume of tumor (mm)³). After 35 days, the tumor was removed by surgery, weighed and photographed. As a result, as shown in fig. 2E, it was found from fig. 2E that the cells obtained by knocking out FLAD1 had significantly decreased tumorigenic ability in vivo.

(3) FLAD1 overexpression promotes proliferation of tumor cells under hypoxia

Lentivirus was used to construct FLAD1 over-expressed lung cancer cell line a549 and human embryonic lung fibroblast cell line WI 38. RNA from the lung cancer cell line PC9 was first extracted (magenta, R4111-03) and then reverse transcribed into cDNA (YEASEN, 11123ES60) and PCR amplified using primers for FLAD1 cDNA (primer sequences shown in Table 3) and the PCR product recovered by a universal DNA purification recovery kit (TIANGEN, DP 214-03). The recovered PCR product and the pCDH-CMV-MCS-EF1-Puromycin plasmid were digested with BamH I (Takara, 1605) and EcoR I (Takara, 1611) and ligated with T4 ligase (BioLabs, M0202). The ligation products were transformed into DH 5. alpha. competent cells, incubated on ice for 30min, heat-shocked in a water bath at 42 ℃ for 90sec, rapidly incubated on ice for 2min, and then cultured with shaking in 800. mu.L of LB medium at 37 ℃ for 1h (150 r/min). And (4) centrifuging, coating a plate, and picking, cloning and sequencing. The resulting plasmid was pCDH-CMV-FLAD1-EF1-Puromycin (pCDH-FLAD1) and was used for the construction of FLAD1 overexpressing lung cancer cell line A549 and human embryonic lung fibroblast cell line WI38 as described below.

TABLE 3 primer sequences for PCR amplification of FLAD1 cDNA (synthesized by Beijing Ongzigaku Biotech Co., Ltd.)

Packaging of lentiviruses and infection. 293t cells were plated onto 10cm cell culture dishes (FALCON, 353003) one day prior to transfection to a density of approximately 80% at the time of transfection according to the protocol provided by EZ trans cell transfection reagent (Liji, AC04L 092). For cells in a 10cm cell culture dish, 1.5. mu.g of plasmid pMD2.G (Addge, 12259), 4.5. mu.g of plasmid psPAX2(Addge, 12260) and 6. mu.g of plasmid pCDH-FLAD1 were diluted into 500. mu.L of OPTI-MEM I medium and gently mixed. 40uL of EZ trans transfection reagent was diluted into 500uL of OPTI-MEM I medium and gently mixed. The diluted EZ Trans transfection reagent was added to the diluted plasmid DNA all as soon as possible, mixed gently and left at room temperature for 20min to form EZ Trans-DNA complexes. The EZ Trans-DNA transfection complex was dropped into a dish containing cells uniformly and gently shaken. At 37 ℃ 5% CO₂Culturing for 10h in an incubator, removing the culture solution containing the EZ Trans-DNA compound, replacing a fresh complete culture medium, and continuing culturing. After 48h of transfection, the viral supernatant was collected and filtered through a 0.22 μm filter. The medium was discarded one day earlier with target cells A549 and WI38 (10-20% confluency) plated in 6-well plates, and 2mL of filtered viral supernatant and 0.5mL of fresh complete medium were added. After 48h of infection, the cells were screened using medium with puromycin final concentrations of 1.5 and 5. mu.g/mL, respectively, until all uninfected control cells died. The remaining cells were the target cells that over-expressed FLAD1 after viral infection.

qPCR and WB detection of the constructed cell line over-expressed with FLAD 1. The constructed RNA of A549 and WI38 (magenta, R4111-03) was extracted and then reverse-transcribed into cDNA (YEASEN, 11123ES 60). The relative expression level of FLAD1 was calculated on Life Technologies Quantstudio 7 using the Δ Δ Ct method according to the protocol provided by 2 × SYBR Green qPCR Master Mix (Low ROX) (bimake, B21702) and the reference gene was chosen for β -actin. The primer sequences used are shown in Table 4. The proteins of the well-constructed overexpressing cells were extracted using protease inhibitors (Sigma-Aldrich, P8340-1ML) and RIPA lysates (formulation: 150mM NaCl, 50mM Tris-HCl (1M, pH 8.0), 1% NP-40, 0.5% Sodium deoxyholate (10%), 0.1% SDS (10%)). And (3) carrying out protein detection according to a Western blot general flow. Protein quantification was performed using the Bradford protein concentration assay kit (detergent compatible type) (petunia, P0006C) with a 15 μ g loading of protein per well. Antibodies used include Anti-beta Actin antibody (Abcam, ab6276), Anti-FLAD1 antibody (Abcam, ab95312), Goat Anti-Rabbit IgG HRP (abart, M21002) and Goat Anti-Mouse IgG HRP (abart, M21001). The detection results are shown in fig. 3A and 3B.

TABLE 4 primer sequences for qPCR (synthesized by Beijing Ongzike Biotech Co., Ltd.)

Primer name	Sequence (5 '-3')
		β-actin-Forward	AATCTGGCACCACACCTTCTAC(SEQ ID NO：9)
β-actin-Reverse	ATAGCACAGCCTGGATAGCAAC(SEQ ID NO：10)
		FLAD1-qPCR-Forward	GAAGAAGGACCCCTGGAGGA(SEQ ID NO：11)
FLAD1-qPCR-Reverse	TGAGCCAGGGAGGTCTCAAT(SEQ ID NO：12)

Cell proliferation assay overexpressing FLAD 1. Wild type and FLAD1 over-expressed cell line A549 were seeded at 5000 per well in 24-well plates (Thermo/Nunc, 142475) and at normal and low oxygen (1% O), respectively₂) The culture was performed (three biological replicates per group). After 96h, the cells were fixed with 4% paraformaldehyde at room temperature for 15min and then rinsed 3 times with 1 × PBS for 2min each. Add 500. mu.L of 0.1% crystal violet staining solution (BBI, A600331-0025) and incubate at room temperature for 60min, wash the cells with distilled water 3 times for 2min each time, and dry overnight. Before measurement, 500. mu.L of 10% acetic acid was added to each well to decolorize the mixture, and after sufficient shaking, the mixture was detected at 595nm by a microplate reader (MD SpectraMax i 3). As shown in fig. 3C, it is seen from fig. 3C that overexpression of FLAD1 increased the proliferation rate of a549 under hypoxia. Thus, FLAD1 is important for tumor cell growth, especially under hypoxic or anoxic conditions.

Example 2

This example provides the use of FAD anabolic pathways for targeted treatment of hypoxic or anoxic tumors:

(1) the number of gene expressions of lung cancer samples in the TCGA database was analyzed by bioinformatics techniques:

based on the KEGG database, FAD metabolic pathway is extracted, as shown in FIG. 4A, as can be seen from FIG. 4A, the main product of riboflavin metabolism is FAD, and the whole metabolism can be divided into two parts, namely the anabolism of FAD and the catabolism of FAD, wherein the genes SLC52A1, SLC52A2, SLC52A3, RFK and FLAD1 are involved in FAD anabolism, and the genes ENPP1, ENPP3 and ACP5 are involved in FAD catabolism. By analyzing the gene expression data of the lung adenocarcinoma patients on TCGA, compared with the normal tissues, hypoxic tumors and non-hypoxic tumors, it was found that the anabolism related genes SLC52A1, SLC52A2, SLC52A3, RFK and FLAD1 of FAD are more highly expressed in tumors, especially hypoxic tumors, and the catabolism related genes ENPP1, ENPP and ACP5 of FAD are also less highly expressed in tumors, especially hypoxic tumors, as shown in FIGS. 4C and 4D. This suggests that intracellular riboflavin metabolism favors the production of more FAD in tumors, especially hypoxic tumors.

(2) Targeting FAD inhibits or promotes proliferation of hypoxic or anoxic tumor cells

Proliferation assay of cells after addition of Lumiflavin and FAD. The photopigment can prevent the conversion of riboflavin into FAD by antagonizing riboflavin to enter cells, thereby realizing the interference of the riboflavin metabolism of cells. Wild type cells (WT) of A549 and FLAD1 knock-out cells (KO) were seeded in 24-well plates (Thermo/Nunc, 142475) at 5000 cells per well and complete medium containing 5. mu.M final concentration of photopigmenin (Bigde, BD136849) was added in normal and low oxygen (1% O), respectively₂) Cultures were performed individually under conditions (three biological replicates per group). The results are shown in fig. 4B, where the addition of the photopigment inhibited the growth of lung cancer cells under hypoxic conditions. Wild type cells (WT) of PC9 and FLAD1 knock-out cells (KO) were seeded in 24-well plates (Thermo/Nunc, 142475) at 5000 cells per well and complete medium containing FAD (Wokay, XW843668141) at a final concentration of 2. mu.M was added in normal and low oxygen (1% O), respectively₂) Cultures were performed individually under conditions (three biological replicates per group). After 96h, the cells were fixed with 4% paraformaldehyde at room temperature for 15min and then rinsed 3 times with 1 × PBS for 2min each. Add 500. mu.L of 0.1% crystal violet staining solution (BBI, A600331-0025) and incubate at room temperature for 60min, wash the cells with distilled water 3 times for 2min each time, and dry overnight. Before measurement, 500. mu.L of 10% acetic acid was added to each well to decolorize, and after sufficient shaking, the mixture was subjected to microplate reader (MD SpectraMax) at 595nmi3) And (6) detecting. The results are shown in fig. 3D and show that growth was partially restored by replenishing FAD to FLAD1 knockout PC9 cells. The experimental results show that FAD is important in the hypoxia or anoxia adaptation process of tumor cells, and the inhibition of the anabolism of FAD through targeting can become a new method for treating hypoxia or anoxia solid tumors.

The above-described embodiments are only preferred embodiments of the present invention, and are not intended to limit the present invention in any way and substantially, it should be noted that those skilled in the art may make several modifications and additions without departing from the scope of the present invention, which should also be construed as a protection scope of the present invention.

Sequence listing

<110> Shanghai science and technology university

<120> tumor treatment target spots adapting to hypoxic or anoxic microenvironment and application thereof

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaacagctca ctgttctcgt 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

cagaagtagg ggtcgggcgt 20

<210> 3

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgcgtctcg accgaaacag ctcactgttc tcgtgtttta gagctagaaa tagcaag 57

<210> 4

<211> 57

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

atgcgtctcg aaacacgccc gacccctact tctgcggtgt ttcgtccttt ccacaag 57

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

aaggggtgag agtctgtcct 20

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

ggtgataaac cctcttcccc a 21

<210> 7

<211> 36

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cggaattcgc caccatgggt tgggatttgg gaacac 36

<210> 8

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cgcggatcct ttcatgtgcg ggagttccgc tcctcttct 39

<210> 9

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

aatctggcac cacaccttct ac 22

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

atagcacagc ctggatagca ac 22

<210> 11

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

gaagaaggac ccctggagga 20

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

tgagccaggg aggtctcaat 20

Claims

1. Use of an agent that inhibits the expression or activity of FLAD1, and/or an agent that inhibits FAD anabolism, in the manufacture of a medicament for treating a tumor that is adapted to a hypoxic or anoxic microenvironment.

2. The use of claim 1, wherein the agent that inhibits expression or activity of FLAD1 comprises an siRNA or shRNA that targets the expression of FLAD 1.

3. The use of claim 1, wherein said agent that inhibits FAD anabolism comprises an agent that inhibits expression or activity of a characteristic molecule of interest in a FAD anabolic pathway; the FAD anabolic pathway related characteristic molecules include at least one of SLC52A1, SLC52A2, SLC52A3 and RFK.

4. The use of claim 1, wherein said agent that inhibits FAD anabolism further comprises riboflavin degradants.

5. The use of claim 4, wherein the riboflavin degradant comprises riboflavin.

6. The use of any one of claims 1 to 5, wherein the tumor that is adapted to a hypoxic or anoxic microenvironment comprises any one of lung cancer, prostate cancer, breast cancer, esophageal cancer, liver cancer, pancreatic cancer, stomach cancer, thyroid cancer, thymus cancer, endometrial cancer, sarcoma and melanoma.