CN114304192B - Preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt - Google Patents
Preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt Download PDFInfo
- Publication number
- CN114304192B CN114304192B CN202111524832.XA CN202111524832A CN114304192B CN 114304192 B CN114304192 B CN 114304192B CN 202111524832 A CN202111524832 A CN 202111524832A CN 114304192 B CN114304192 B CN 114304192B
- Authority
- CN
- China
- Prior art keywords
- bacteriocin
- resistant
- lysine
- analogue
- boron
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a preparation method of a boron-resistant lysine-resistant bacillus bacteriocin analogue and application of the boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt. The boron-resistant lysine bacillus bacteriocin analogue is obtained by heterologously expressing a bacteriocin gene cluster through a chassis host cell; the nucleotide sequence of the bacteriocin gene cluster is shown in SEQ ID NO. 1. The preparation method of the B-lysine-resistant bacillus bacteriocin analogue provided by the invention is beneficial to quickly obtaining bacteriocin and improving the yield of the bacteriocin, and is low in cost. Experiments prove that the obtained bacteriocin analogue has obvious inhibition effect on pathogenic varieties of carpet grass xanthomonas salmonicida.
Description
Technical Field
The invention belongs to the technical field of microbial synthetic biology, and particularly relates to a preparation method of a boron-resistant lysine-resistant bacillus bacteriocin analogue and application of the boron-resistant lysine-resistant bacillus bacteriocin analogue in preventing and treating cassava bacterial wilt.
Background
1. Standardized and modular design of disease-resistant metabolic pathways
With the increasing of drug-resistant strains, a green and safe antibiotic substitute is urgently needed to be found at present, and microorganisms can generate various natural secondary metabolites with biological activity, so that the microbial preparation has wide application prospects in the fields of medical treatment, agriculture, food and the like, and is expected to be one of main sources for generating new drugs. However, the problems that the biosynthesis gene cluster of certain secondary metabolites is in a silent state, the products are not easy to prepare, the yield is low and the like exist at present.
The transportation of synthetic organisms will help to solve the above problems. Synthetic biology is based on the study of system biology, introducing engineering principles and methods to construct artificial biological devices and systems with predictable behavior de novo, including computational models and modular DNA, to establish metabolic pathways and to construct biological circuits to control cellular behavior through standard design and interconnections between modular components. Therefore, the design and development of the microbial underpan cells based on the system biology and the synthetic biology can realize the construction and the modification of an excellent cell factory.
2. Cassava
Cassava is a major economic crop in tropical regions such as south america, africa and asia, and is widely used for producing starch, feed, alcohol, drugs, cosmetics, biopolymers, and the like, in addition to being a major source of food. The cassava has high starch content, is rich in vitamin C, carotenoid and mineral substances, and has important edible and industrial values. However, with the enlargement of the planting area, bacterial diseases, in particular cassava bacterial wilt caused by Xanthomonas axonopodis pv. manihotis Xam, can cause cassava yield losses of up to 75%. After the infection, the cassava has the symptoms of angular leaf spots, withered leaves, resin exudation, necrosis of vascular tissues of stems, withered branches and the like.
The existing control method can reduce the incidence and severity of diseases in cassava planting by using clean planting materials and managing insect media, and carrying out methods such as intercropping, crop rotation, fallow and weeding. Secondly, cassava varieties with enhanced disease resistance are developed. But currently, the disease lacks a truly particularly effective prevention and control measure.
3. Bacteriocin
Bacteriocins are a class of proteins or polypeptides with bacteriostatic activity produced by bacteria during the metabolic process by the ribosome synthesis mechanism. Synthesis of bacteriocins generally requires multiple module interactions. Bacteriocin has the advantages of small molecular weight, easy degradation by protease without residue, no toxic or side effect on human body and the like, and can be used for food preservation, human disease control, biological control and the like at present.
4. B-lysine resistant bacillus
In the early stage, the applicant separates and obtains a lysine-resistant bacillus strain with the preservation number of CCTCC NO. M2019773, and researches show that the bacillus strain has good bacteriostatic activity on pathogens such as betel nut root rot, rice sheath blight and rice blast (see patent documents CN111100806A, CN111100805A and CN 111187726A). However, the research on the boron-resistant lysine-resistant bacillus in the aspects of inhibiting the cassava bacterial wilt pathogen, the bacteriocin gene and the synthetic biology has not been related.
Disclosure of Invention
In view of the defects of the prior art, the invention provides a preparation method of a boron-resistant lysine bacillus bacteriocin analogue and application of the boron-resistant lysine bacillus bacteriocin analogue in preventing and treating cassava bacterial wilt.
The invention takes a potential antagonistic biocontrol bacterium boron-resistant lysine bacillus which is stored in a laboratory and can resist various pathogenic bacteria and pathogenic fungi as a research object, wherein the boron-resistant lysine bacillus (lysine bacillus boronolans) is stored in a China typical culture collection center (CCTCC) in 2019, 10 and 8 months, the CCTCC is abbreviated as CCTCC, the preservation address is Wuhan university, and the preservation number is CCTCC NO. M2019773. The relevant deposited information is also known from patent documents (e.g., CN111100806A) previously filed and published by the applicant.
The invention mainly analyzes the genome, excavates the bacteriocin gene cluster, uses colon bacillus as a chassis host cell, expresses the bacteriocin gene cluster heterologously, and finally produces the bacteriocin antibacterial active substance with biological activity by using a method of redesigning a system aiming at a specific target by using synthetic biology.
The technical scheme of the invention mainly comprises the following contents:
on the one hand, the invention provides application of a boron-resistant lysine bacillus bacteriocin analogue in preventing and treating cassava bacterial wilt.
Preferably, the B-lysine-resistant Bacillus bacteriocin analogue is obtained by heterologously expressing a bacteriocin gene cluster by a chassis host cell; the nucleotide sequence of the bacteriocin gene cluster is shown in SEQ ID NO. 1.
Preferably, the underpan host cells comprise E.coli cells.
Preferably, the pathogenic bacteria of the cassava bacterial wilt disease are xanthomonas carpi cassava wilt pathogenic varieties.
In another aspect, the invention also provides a method for preparing the boron-resistant lysine bacillus bacteriocin analogue, which comprises the following steps:
(1) b-lysine resistant bacillus genome DNA extraction;
(2) performing PCR amplification on the gene cluster;
taking the extracted B-lysine resistant bacillus whole genome DNA as a template, and carrying out PCR amplification on a bacteriocin gene cluster; the nucleotide sequence of the bacteriocin gene cluster is shown as SEQ ID NO. 1;
(3) purifying and recovering PCR products to obtain DNA fragments;
(4) double enzyme digestion and gel recovery of the P15A plasmid to obtain a cloning vector;
(5) carrying out seamless cloning connection on the DNA fragment obtained in the step (3) and the cloning vector obtained in the step (4);
(6) e, E.coli competent cells are transformed by electric shock;
(7) and (3) fermenting and culturing the successfully transformed escherichia coli containing the recombinant plasmid to obtain fermentation liquor, and extracting the bacteriocin analogue from the fermentation liquor.
Preferably, the extraction in step (7) is: extracting bacteriocin analogue from the fermentation liquor by ammonium sulfate precipitation. More preferably: adding ammonium sulfate into the fermentation liquor to make the saturation degree of the ammonium sulfate be 80%, and obtaining precipitate which is the bacteriocin analogue.
Some of the terms appearing in this application have the following definitions:
the bacteriocin is a protein or polypeptide with bacteriostatic activity produced by bacteria in a metabolic process through a ribosome synthesis mechanism. Bacteriocin has the advantages of small molecular weight, easy degradation by protease without residue, no toxic or side effect on human body and the like, and can be used for food preservation, human disease control, biological control and the like at present.
The fermentation liquor refers to liquid with bacteriocin analogues produced by fermentation of bacteria. For example, the fermentation broth of E.coli BL21 containing the recombinant plasmid is 250mL of the bacterial liquid (initial OD is about 0.02 OD)600The resulting fermentation product was cultured at 37 ℃ for about 28 hours at a rotation speed of 150r/min per 1000mL of LB medium. After fermentation, centrifuging at 9000r/min for 30min to remove precipitate, collecting fermentation supernatant, and filtering with 0.22 μm filter membrane to obtain sterile fermentation filtrate.
The ammonium sulfate precipitation method refers to a technology for precipitating and separating protein by using ammonium sulfate solutions with different concentrations. Ammonium sulfate precipitation can be used to concentrate and partially purify proteins from bulk crude preparations. High concentration salt ions compete with protein for water molecules in protein solution, thus destroying hydrated film on protein surface, reducing its solubility and making it precipitate out of solution. The solubility of each protein is different and thus different proteins can be precipitated using different concentrations of salt solution. This method is called salting out. Salt concentration is usually expressed in terms of saturation. Ammonium sulfate is most widely used because of its high solubility, low temperature coefficient and low tendency to denature proteins.
The filter paper sheet method is that a sterilized filter paper sheet is placed on the surface of an LB solid culture medium coated with indicator bacteria, a substance to be tested is dripped, and the antibacterial activity of the substance to be tested is evaluated by observing the size of a transparent ring around the filter paper sheet.
The invention has the following effects:
(1) compared with the traditional antibiotics, the bacteriocin has the advantages of small molecular weight, easy degradation by protease without residue, no harm to human health and environment, and the like. According to the invention, the boron-resistant lysine bacillus bacteriocin analogue is obtained by a biosynthesis method, and experiments prove that the bacteriocin analogue has an obvious inhibition effect on pathogenic varieties of carpet xanthomonas verticillata cassava wilt.
(2) Usually, the bacteriocin is isolated and purified from the original strain, which is time-consuming and laborious, and the yield of bacteriocin is generally low. The invention provides a bacteriocin production method which can effectively replace the traditional method, is beneficial to quickly obtaining the bacteriocin and improving the yield of the bacteriocin and has low cost.
(3) The invention aims at the characteristic that the target fragment is larger, constructs the vector by seamless cloning, and has high success rate and simple and convenient operation.
Drawings
FIG. 1: and (3) constructing a recombinant plasmid vector. A, obtaining a clear PCR product band with the size of about 8932bp which is consistent with the expected size by a PCR amplification gel electrophoresis picture of a Bacteriocin analogue biosynthesis gene cluster, and indicating that the gene cluster is successfully amplified from a B-lysine-resistant bacillus genome; and B, carrying out colony PCR gel electrophoresis on the gene cluster heterologous expression recombinant plasmid, and carrying out colony PCR amplification verification by using a verification primer to obtain a verification fragment of about 581bp, wherein the size of the verification fragment accords with the expected fragment size, and the successful construction of the vector is indicated.
FIG. 2: and (3) detecting the inhibition effect of the fermentation liquor ammonium sulfate precipitation purification on pathogenic varieties of carpet grass xanthomonas salmonicida cassava wilt by using a filter paper method. Wherein, A is a control group, the carpet grass xanthomonas cassava wilt pathogenic variety is treated by the fermentation liquid of E.Coli BL 2128 h containing empty plasmids, B is an experimental group, the carpet grass xanthomonas cassava wilt pathogenic variety is treated by the ammonium sulfate precipitation purification compound of the fermentation liquid of E.Coli BL 2128 h containing recombinant plasmids of gene clusters, an obvious inhibition zone appears in the figure, and the inhibition zone shows that the carpet grass xanthomonas cassava wilt pathogenic variety is inhibited by the ammonium sulfate precipitation purification compound of the fermentation liquid of the recombinant escherichia coli and can not grow around the filter paper, and finally a transparent zone appears.
Detailed Description
In order that the technical contents of the invention may be better understood, specific examples are provided below to further illustrate the invention.
Example 1 prediction and analysis of Bacteriocin analog Gene Cluster
And uploading the genome file of the B-lysine-resistant bacillus to an anti SMASH website for gene cluster prediction. The website can accept annotated GenBank, EMBL, and fasta formatted files. After the gene cluster prediction is completed, downstream analysis including structural domain analysis and annotation and core chemical structure prediction are carried out. Then, Cluster blast gene cluster comparison analysis and smcAG (second assay Cluster of organic Groups of Groups) analysis are performed. The gene cluster sequence is shown in SEQ ID NO. 1.
Example 2 construction of Gene Cluster heterologous expression vector Using seamless cloning method
(1) B-lysine-resistant bacillus genome DNA
5mL of overnight-cultured B.borandii-resistant Bacillus subtilis solution was used to extract genomic DNA according to the instructions of the Vazyme Biotech bacterial genome extraction kit.
(2) PCR amplification of Gene clusters
And (3) performing PCR amplification on a target gene cluster by taking the extracted boron-resistant lysine bacillus whole genome as a template and Bac (10) -F and Bac (10) -R as primers respectively, and performing gel electrophoresis detection. Finally, a DNA fragment with clear bands and the expected size (8932bp) is obtained, which indicates that the gene cluster is successfully amplified from the B.boragenes-resistant genome. Bac (10) -F: TAAGGATGATTTCTGGAATTCGGCTAAGTTTTTATATGAGTAATGTCAC (SEQ ID NO. 2); bac (10) -R: GTTCCACAGGGTAGCGGATCCGCCTTCTGTTACCACTTCATCAAG (SEQ ID NO. 3).
The PCR reaction system and the amplification procedure are shown in tables 1 and 2:
TABLE 1 PCR amplification System
TABLE 2 PCR amplification procedure
(3) Purification and recovery of PCR product
And purifying and recycling the product according to the specification of a Vazyme Biotech product purification kit to obtain the DNA fragment.
(4) Double enzyme digestion and gel recovery of P15A plasmid
The p15A plasmid was double digested with BamHI and EcoRI restriction enzymes and reacted at 37 ℃ for 6 h. After separation of the cleavage products by electrophoresis on a 1% agarose gel, the gel was recovered and placed in a 1.5mL EP tube, and the subsequent purification steps were performed according to the Vazyme Biotech product purification kit instructions. Obtaining the cloning vector. The double enzyme system is shown in Table 3:
TABLE 3 restriction enzyme double digestion System
(5) Seamless clonal joining
According to
The Ultra One Step Cloning Kit was used for the procedures. The attachment system is shown in table 4:
TABLE 4 seamless clonal ligation System
The use amount of the fragment and the vector is calculated according to the following formula, and the single fragment homologous recombination reaction is carried out.
The optimum amount of the cloning vector used was [0.02 Xthe base number of the cloning vector ] ng (0.03pmol), and the optimum amount of the inserted DNA fragment used was [0.04 Xthe base number of the DNA fragment ] ng (0.06 pmol).
② preparation of connecting System according to Table 4
③ reacting at 50 ℃ for 5 min; cooled to 4 ℃ or immediately placed on ice to cool.
Note: if the number of bases of the insert is much greater than that of the cloning vector, the cloning vector is counted as the insert.
(6) Electric shock transformation of BL21 competent cells
The shock conversion program was set to Bacteria. Taking out the sterilized and precooled electric rotating cup. And (3) placing the competent cells on ice for about 1min to dissolve the competent cells, adding 1-2 mu L of the ligation product or plasmid, blowing and uniformly mixing, quickly transferring the bacterial liquid into a groove of the electric rotating cup, slightly shaking for 3-5 times, quickly wiping water drops on the outer wall of the electric rotating cup, and performing electric shock transformation. After the electric transfer is finished, 1mL of LB liquid culture medium is added, the mixture is evenly blown and beaten, and the mixture is revived at 37 ℃ and 150rpm for 1 h. The cells were collected by centrifugation at 6000rpm for 3min, the supernatant was discarded, 100. mu.L of LB liquid medium was added, the cells were suspended and spread on spectinomycin-resistant plates, and the cells were cultured at 37 ℃ for 12 to 16 hours.
(7) Screening and identification of recombinant plasmids
A single colony on the resistant plate was picked up and placed in a 1.5mL EP tube containing 40. mu.L of sterile water, and heated in a 100 ℃ metal bath for 10min to completely lyse the thallus. Centrifugation was carried out at 12000rpm for 1min, and 1. mu.L of the supernatant was used as a template for colony PCR and PCR-amplified using F3(CCTTCTGCCACTGGTCGTTTATC) and R3(GGCTTTACAGAACCGACACCAAT) primer set. The PCR product was size-judged by 1% agarose gel electrophoresis. And (4) taking the positive clone to extract plasmids, and sending the plasmids to Shanghai Processingenuity Limited company for sequencing identification. The results are shown in FIG. 1.
Example 3 preparation of crude recombinant protein extract containing bacteriocin analogs by ammonium sulfate precipitation
Taking 400mL of Escherichia coli fermentation liquor containing gene cluster recombinant plasmid or no-load plasmid, adding ammonium sulfate into the fermentation liquor while stirring to make the saturation degree reach 50%, 60%, 70% or 80%, and precipitating overnight at 4 ℃. Centrifuging at 8000rpm for 10min, collecting precipitate, dissolving the precipitate with PBS (pH7.0), diluting to 10mL, and determining its antibacterial activity, wherein the control solvent is PBS (pH7.0). The result shows that in different ammonium sulfate saturation precipitation experiments, the crude extract of the recombinant escherichia coli fermentation liquor containing the gene cluster recombinant plasmid with the ammonium sulfate saturation of 80% has the most obvious effect of inhibiting the growth of the pathogenic variety of the verticillium carpeting grass xanthomonas cassava wilt, while the control recombinant escherichia coli containing the no-load plasmid does not have the inhibiting activity, so that the bacteriocin analogue derived from the boron-resistant lysine bacillus can endow the recombinant escherichia coli with the biocontrol activity of inhibiting the pathogenic variety of the verticillium carpeting grass xanthomonas cassava wilt after heterologous expression.
Example 4 detection of antibacterial Activity of ammonium sulfate precipitation-purified fermentation broth against pathogenic strains of Xanthomonas carpi cassava wilt using filter paper sheet method
A single colony of a target bacterium, namely xanthomonas carpi, cassava wilt pathogenic variety is picked and cultured in 5mL of LB liquid medium at 37 ℃ and 150rpm for 12 h. By OD600Initial inoculum size of 0.02 was transferred to 20mL LB liquid medium and cultured to OD6000.4-0.6. Get 108The bacterial solution was centrifuged at 6000rpm for 3min in a 1.5mL EP tube, the supernatant was discarded, 1mL of fresh LB medium was added, and the mixture was blown up and mixed well. Pipette 500. mu.L onto LB solid medium and spread well with sterile cotton swab. A 6mm sterile filter paper sheet (5 layers) was placed on the surface of the medium coated with the target bacteria. The purified product of E.coli BL21 fermentation broth ammonium sulfate precipitation containing gene cluster recombinant plasmid or no-load plasmid (i.e., the solution obtained by dissolving the solution with PBS and fixing the volume after the ammonium sulfate precipitation with saturation of 80% in example 3) prepared in advance was dropped onto a filter paper sheet, the total amount was 80. mu.L (a small amount of drops were added many times), and the purified product of E.coli BL21 fermentation broth ammonium sulfate precipitation containing no-load plasmid was dropped as a control, and three parallel plates were set. After culturing at 30 ℃ for 12h, the growth of the target bacteria is observed. The results are shown in FIG. 2.
The above description is only exemplary of the present invention and should not be taken as limiting the invention, as any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> university of Hainan
<120> preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 8932
<212> DNA
<213> B-tolerant lysine bacillus (Lysinibacillus boronolans)
<400> 1
ggctaagttt ttatatgagt aatgtcacac tttatgcaga tttaataaaa aaagatgctt 60
gaacaaggtc tattgaccca tcaaacatct actgtttttt atataaaatc aatatatttt 120
tatacatttc tattgaaagc aaaattgtta ttacattgaa tggaatacac agaccaattg 180
tttcaatttt agcttcatgt cacttaacaa gcttcaaaat ggttttaaaa tgttcatgat 240
ctgcacgttg taatagctca tacaagatca tttcggtgct agttggataa ataccaaggg 300
cattcatctt cgtaagccca atttctttat ttgcctttgt tcgagaagat acggcgtcta 360
caacaacctc tacttcaaat ccttgttctt tcagttgtct agccgtttga tacacacaaa 420
tatgtgtttc gatacctgtg acaatgaatt gagaacgtcc attttccttt atcgcttcta 480
caaatgcctc ttcttggcac gcactaaagg ccattttggc aataggttgc ccttgtaaat 540
gctgtgcaat atcaagtgcc gttccgccta atcgacttgg attttgttct agccacaaaa 600
taggtacttc gagtgccttc atcgcttgta ctagctttgc tacattttca attaccgttt 660
cactgtcatc aacaattgtt gctaactttc cttgcacatc tacaactact aaacaagctt 720
tctctacagt aaacatcctg aacacctctt tttcttttct taataatatt atacaaaaac 780
ttgcttacct ctcgtaaagt aataaggaac tttctctaac aatcgattgg atagttttgc 840
tttagcctgt ccatttcacg cttctaccaa ggaaatattt gcaagcaaaa acacgaacaa 900
tatcattttt attgcaataa aaaatattta atatacggaa aatataactt aatttcaaaa 960
atacctttct atttgttcgt ttttaatgaa aaatacctgc ttaaatgtgt acattttgtt 1020
gcgagcctgt cgccattctg ctcaaatatt aagaatttta ttttttctct tgaaaattag 1080
gttataatcc agtaaagttc tgttattaac caaacaagga gtgtaccact ttgacacaac 1140
gtgcatacaa tttcaacgca ggtccatctg ctctaccaca agaagtatta gaaaatgctc 1200
aacagcaatt agtaaacttc cgtgattcag gtatgtccat tatggaaatg agtcaccgta 1260
gtgccatttt cgatgaagta cataatgaag ctattacttt attaaaaaaa ctttatgcta 1320
ttccagaaaa ctatgaggta ctattcttac agggtggagc aagccttcag tttacaatgg 1380
tgcctatgaa cttcttaaca actgagcaaa aagctagcta tgtattatca ggctcatggt 1440
ctgagaaagc ttttaaggaa gctaaattat ttgggacacc tgttgaagct gcaagcacaa 1500
aagaaaacca ataccgcaat attcctgctt tagaagatat tcaattcaat gaagatgatg 1560
catatgttca catcacatcc aataatacga tatatggtac acaatggaaa aatttcccta 1620
gcacaggaaa tgttccatta gtggcggata tgtcaagtga catcctatca aaaccagtgg 1680
atattgaaaa attcggtatc atctatgcag gagctcaaaa aaaccttggc ccttcaggtg 1740
taacggtcgt gattattcgc aaagatttac ttgaaaaagc aaataaaaat ataccaacga 1800
tgttaaagta tacaacacat gctgatagta attctcttta taatacacct ccgacattcg 1860
gaatctatat gctcggcgag gtattaaaat gggtagaagc taaaggcggc gtagcagcaa 1920
ttgaaaaaca taatgaatta aaggcaaaag tgatttatga tgccattgac aatagtaatg 1980
gtttctacaa aggccatgcc acacctgaaa gccgttcttt aatgaacatt acattccgtg 2040
ttgcagatga ggagctagaa aaacaattcc ttgcagaggc aaaggcagca ggttttatcg 2100
ggctaaatgg acatcgttct gttggcggct gtcgtgcttc cacttataat gcagtgccac 2160
ttgaggcttg cgaagcttta cgagatttca tggtaaattt ccaacaaaaa catcaataaa 2220
cttctattta aaagatgagt ctttccattt cggtaaagac tcatcttttt ttcgcgcttt 2280
tcgaaggaaa tatgaaatct atccccatac aattagcttg attagatgtt tatagcaata 2340
tttcagctta gggctttaca cattgcaaaa gtttttgaga aaaatataga tttttaagct 2400
gcctatcgga catatcgcca gtctctagct atgcaccaaa catagattat tactgtaagg 2460
gttaccttta cgaaactaga ggaagggagg tctagacaat ggaagataaa agatatatgt 2520
cacatatgaa ctggcaaggc tgtaaatgtc ctaaaaaaga ggaaaaatgc tgtcaacgta 2580
aagttgaaaa atgtcattgc caaaaagagg aaaaatgcca ttgtaaaaaa gaagaaaaat 2640
gtacaccaag aatgagcagc cactgtagag gctgtatttg tcaccaatta agaaaattag 2700
agctagctac tacactagat atcttcttat ctggaggtat tagcttctta ggtgtgactt 2760
tcatttccct cgatcaaaga aattgctgtg catacttcct tgagccaggt gcagctgctg 2820
cttctccttt aatcgtagat tgcaataaaa ttgttgcgat tcgtcgagta gtgtagctta 2880
attaatatag agggtagcct tatacaggca ccctcttctt acatagaaaa aacgctgtca 2940
tatttaaagt gacagcgttt catgcttaca atccgggcat ttaccatata tttcaaactt 3000
atgattttca atttcataat caggtaattt ttcacctaac atttccattg gacaaagatt 3060
aagctctttg acgttgccac aatccataca gataaaatga tggtgatgat gcgcagattc 3120
acagtgcata cggaaattac gttcccctga tagctctgtt tcttctaata tcccaagttt 3180
cacaaaagta gcaaggttac gataaatggt atcaaaactc attcccggaa aatccttttt 3240
tagaacatcc aataaatcac gggctgttag atatttatct gttgctgcaa acatatctaa 3300
tattaactcc cgtttatctg tttttttata gccattttcc tttaatattt cccacgctct 3360
tgaaatattc attgcgctac ctccccctgc tttgcagcca ttttaaatgc tactttcttt 3420
cctaggatta caagtaacaa aatcaaaata gaagtgacaa caattgtgcc tcccggtgct 3480
aaatccatat aaaatgcact aattagacca attagtacag cagtttctcc aaaaacaata 3540
gcataaatga tggtttgctt aaagcccttt gccaagcgca ttgctgctgc gacaggtaat 3600
gtcatcagag atgatacaag taaaatacct actatgcgca tacttgccgc aatgacaagc 3660
gcagtcacaa tcataaataa aagatgaacc caacgagctg gaagtccact agcttttgca 3720
tattcctcat caaaagacaa aacaaataat tctttaaaaa ataaaaataa aaaaataatt 3780
acaatggcag caattccgat caccacccat aaatcttgac gagatacagc agaaaccgag 3840
ccaaacaaat aactcattaa atctgtgcta aagccactgg caagtgagat aaagatggcg 3900
ctaatcccaa taccacctga cataatgatt ggaatggcaa gctcctcata gtgcttatat 3960
aaacgtctta aacgctcaat caaaatagag ccactaacag aggctagtat acctaaataa 4020
ataggattga gcattgctaa ggctgataca gattgactga tgtataaact cccagcgatt 4080
ccagcgagtg ttacatgtga caaagcatcg gcaatcaagg acagcctacg tacaacaata 4140
aacaccccca gcagtggtgc aagtatgcca attaataatc cagagaaaaa ggcattttgt 4200
aaaaattcat aatgtaaaat tgcttcaatc atgtgcctac tccttctaat gaatctttct 4260
cacggaatgg ccataccaag catctagcgc gtcctgagaa atattatcaa attcattttt 4320
atagccgtgg aagtgaatgg tttgatttaa acatgccaca tgactaatac gatttgatac 4380
cgtatcgaca tcgtgtgtga caagaatcat cgtaattcct tgttcccgat ttaatttcgc 4440
cagcatatca taaaatgact gcacgttctc gtgatcaatg ccgacagttg gctcatctaa 4500
aatgagcagt ttaggatcac tgactaaagc tcttgcaata aaaacacgtt gttgttgtcc 4560
accagataat tctccaatat tgcgattcat ataagcatcc atgccaactg cctttaaagc 4620
ttcttgaact ttgtctttgg cgtctcggcc aggtctttta aaaagcccta atttttttgt 4680
taatccactt ttcacgacct cttgcacggt tgctgggaac ccagaattaa aggcattgga 4740
tttttgtgag acatagccaa tccattcacg gtgcttaaag ttcgcgcttg tttcaccaaa 4800
tagctttatt tcaccagata aaggtttcaa caaacctaaa ataattttta ataatgttga 4860
ttttcccgaa ccatttggac cgagaagtgc taaaaaatct ccctcttcta cacgaaaaga 4920
aatgtttttt aaaacttgcg tatagtcata ttgaaatgac acattttcaa tgtcaataag 4980
tgttgttttc atgcatgatc gcttctttct aattcaaaat cattacgatt tacaaattgt 5040
aagtataaag gaaagtgcag tttttgtaaa gaaaagaaga tggatgcttt ttcgaatagg 5100
ctgatggcaa gtgtgtaaaa cgtgaaaata aaatggggta aaggaggatt gactttgagt 5160
attcaatttt tacagcaatt agcacaaagc acggataagg aaattgtcgc gattgctcgt 5220
gaagaaggtt ttagcattac gacttctgaa gtaaaaaaac ttcgacctta tttggagcaa 5280
ttctcatttt cttggctatt tttaggtatt cctaaagata ttcttgttga agtggaagct 5340
gttttaggga gaaagcgctc tcgccaactg attgccttgt ttacaaaata aaaaaagccc 5400
gaaatcagaa ccagcctgat ttcgggttag ttatattagc cctttaaagc ttcaatatgc 5460
tcaggcttaa atgtaccgtt tcgtaacata tcgatttcca ctttatacgg agctacctta 5520
gatttagcgt cactagtgag agggacaaac ggtgtctcta aaattttagg aacatccatt 5580
aattgtggat ggtgtactac atagttgagg gcatcaaagc caatatgacc aaagccaata 5640
ttttcgtggc gatccttacc tgcaccgcgc acatttttgg agtcattgat atgcaatact 5700
ttaatgcgtt ccacacctat tattttatca aattcgttta ataccccatc aaaatcttcc 5760
acaatattat agccagcatc atgtgtatga caagtatcaa agcatacaga aagtcgctcg 5820
ttatttgtta caccatcaat aattttagca agctcttcaa aggaacgtcc acattctgtc 5880
cccttccctg ccatggtttc taatgcaatt tgaacgggat agtcttgaga taaaacctca 5940
tttaaacctt caataatttt agcaatacca gcatcagcac cagctcctac atgggcacca 6000
ggatgtaaca caatttgcgt tgcctccagt gctgcagtac gttcaatttc cgattgtagg 6060
aaatctacac cgagacggaa tgtttctggt ttttctgtat tgccaatatt aataatgtaa 6120
ggtgcatgta caacaatatt ggtcatacca tgctctttca tatgcaggag tccattcatg 6180
atgtttaagt cagcaatggc tttgcgacgc gtattttgcg gtgctccagt ataaatcata 6240
aatgtattgg ctccgtatga cagtgcctct ttactagagc caagtagcat ttctttcccg 6300
ctcatcgaaa catgtgagcc aagtaacatg taaaagcccc cttatttttt acctcgtgct 6360
tttaagcgac gttcacgttt tttaattttt tccatttccc acttcatatt acgtttgtat 6420
ccaggtttta cctttttagg cttacgtacc aacgcttttg ctttcacatc aatttcattt 6480
tcttgcttca cacgattttt acgtgcatga cgctctttta actctgacca ttcgccatct 6540
tttacatctt tttgcacaaa aggaatgccc attttttcta cgcgaactac tgcatcctcg 6600
tctgatggct caaataatgt aatggctgtc cctttattgc ctgcacgcgc tgttcgacca 6660
acacggtgaa taaagaattc taagtcctct ggaatctcgt agttaataac atgagaaatg 6720
ccttggatat caataccacg agcagctaag tcagttgcta caatgtattg gtagtcaagc 6780
tcacggattt gcttcatcat ttttttacga tcacgtggac ttaagtcacc atgaatttga 6840
ccacaacgga taccatgctc atttaagtag ccagcaacgt gttctgctgt tttacgtgtg 6900
ttggtaaaga taacagctaa aaagggatta atgccctcaa tgacttctaa taaacgttta 6960
ttacgcgatt ttgagcgcac tggtacaagc acaaaatcga tgccttctgc cactggtcgt 7020
ttatcattca tatggacgtg cactggcgct tccatatatt tctttaaaaa tggctgaagt 7080
ttttctggaa ttgttgcaga aaaaacatac atttcaagct tttctggcat ctgtgaagca 7140
aatccatcaa tctcttcaat gaagcccata tcaaaagcta gatccgcttc atcaacaact 7200
aagattggtg ctgtatgcac aaataacgct tgtgctgaaa caaggtcacg aatacgtcct 7260
ggtgttccaa caacaatttg tggctgtgtt tttaatttat caatggagcg ttgtttgtcc 7320
gtacccccaa taaatagttt tgcttgaatc gcagttcctt ctattaattg atttaatgca 7380
tcaaaaattt gttgtgctaa ctctcgagta ggagaagtaa taacagcctg tacttcctgt 7440
ttttctacat caatacgttg aacaatcggg attaaaaaac tatgtgtttt ccctgttcct 7500
gtatgtgcct gtccaatagc actttttcct tttaataaaa gcggaataat ttctttttga 7560
attggtgtcg gttctgtaaa gcctagattt gcaatggcgt cctgcaaaaa tggctgaaaa 7620
ttataatcag tatattttga catcattcgt tcctcctaac atctttttca ttgtaccatg 7680
attcgaactt taaggtatat ttacgttcta tttcttacta gcataaacat atttttaatg 7740
ttttattatc accgtaacaa agcccttatc aaaggtactt gaaatacgca gaatatgcaa 7800
tcaaaaaagc gctgcaacaa tgttcgaaaa cgcttgtaat atgtaatttt tatgtcaatt 7860
tatagggaac taatgattag cagatttccc acatgttatg atagagctgt aagatattat 7920
gggaggttgg tagattatga aagcagcaag atggtataaa gcaaaagaca tccgtgtaga 7980
aaacattgaa gaaccagtca tcgcacctgg aaaagtaaaa attaaagtac attggacagg 8040
gatttgtggc agtgatttac atgaatacgc agctgggcca atctttattc cagtggagca 8100
acctcactat gtaagtaaag acatcgcacc cattgtgatg ggacatgaat tttcaggaga 8160
agtagttgaa attggcgatg gtgtaacatc tgttcaaata ggagatcctg tagtagtaga 8220
accaatcctt gcatgtggcg aatgtgctgc ttgtaaaaaa ggtaaatata atatttgtaa 8280
acatttaggt ttccacggtc tttcaggcgg tggcggagga ttctccgaat atacaatggt 8340
agatgaaaaa atggttcaca aaatgccaga agggctttct tatgagcaag gagcacttgt 8400
agaaccagcg gcagtcgctt tacatgccgt gcgtcaaagt aaattaaaag ccggtgacaa 8460
agctgccgtc tttggaacag gaccaatcgg gcttcttgtt attgaagcat tacgtgcagc 8520
aggcgcagca gaaatctatg ctgtagagct ttcagcagag cgtgccgcaa aagctttaga 8580
acttggtgca acagccgtca ttaaccctaa agaggaagat gccgttgtgc gtctgcatga 8640
attaacaaat ggtggtgtag atgttgcctt tgaagtaacg ggcgttcctg tggttttaca 8700
acaagctatt gactcaacaa cttttgaagg tgaaacaatc attgtgtcga tttgggagtc 8760
tacagctgct atccaaccga acaatattgt tctatcagag cgaacagtca aaggaattat 8820
tgcctaccgt gatattttcc cagccgtgat ggagctaatg acacaaggtt acttcccagc 8880
agacaagctt gttacaaaac gaattgctct tgatgaagtg gtaacagaag gc 8932
<210> 2
<211> 49
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
taaggatgat ttctggaatt cggctaagtt tttatatgag taatgtcac 49
<210> 3
<211> 45
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
gttccacagg gtagcggatc cgccttctgt taccacttca tcaag 45
<210> 4
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccttctgcca ctggtcgttt atc 23
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
ggctttacag aaccgacacc aat 23
Claims (5)
1. The application of the boron-resistant lysine bacillus bacteriocin analog in preventing and treating cassava bacterial wilt is characterized in that the boron-resistant lysine bacillus bacteriocin analog is obtained by heterologously expressing a bacteriocin gene cluster through a chassis host cell; the nucleotide sequence of the bacteriocin gene cluster is shown as SEQ ID NO.1, and the pathogenic bacteria of the cassava bacterial wilt disease are xanthomonas carpi cassava wilt pathogenic varietiesXanthomonas axonopodis pv. manihotis。
2. The use of claim 1, wherein the underpan host cells comprise E.
3. The method of preparing a borotolerant lysine bacillus bacteriocin analog of claim 1, comprising the steps of:
(1) b-lysine resistant bacillus genome DNA extraction;
(2) performing PCR amplification on the gene cluster;
taking the extracted B-lysine resistant bacillus whole genome DNA as a template, and carrying out PCR amplification on a bacteriocin gene cluster; the nucleotide sequence of the bacteriocin gene cluster is shown as SEQ ID NO. 1;
(3) purifying and recovering PCR products to obtain DNA fragments;
(4) double enzyme digestion and gel recovery of plasmid to obtain cloning vector;
(5) carrying out seamless cloning connection on the DNA fragment obtained in the step (3) and the cloning vector obtained in the step (4);
(6) e, E.coli competent cells are transformed by electric shock;
(7) and (3) fermenting and culturing the successfully transformed escherichia coli containing the recombinant plasmid to obtain fermentation liquor, and extracting the bacteriocin analogue from the fermentation liquor.
4. The process according to claim 3, wherein the bacteriocin analogue is extracted from the fermentation broth by ammonium sulfate precipitation.
5. The method according to claim 4, wherein ammonium sulfate is added to the fermentation broth to a saturation level of 80% and the precipitate is a bacteriocin analog.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111524832.XA CN114304192B (en) | 2021-12-14 | 2021-12-14 | Preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111524832.XA CN114304192B (en) | 2021-12-14 | 2021-12-14 | Preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114304192A CN114304192A (en) | 2022-04-12 |
| CN114304192B true CN114304192B (en) | 2022-06-14 |
Family
ID=81051120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111524832.XA Active CN114304192B (en) | 2021-12-14 | 2021-12-14 | Preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114304192B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020077042A1 (en) * | 2018-10-10 | 2020-04-16 | AgBiome, Inc. | Compositions and methods for controlling plant pests and improving plant health |
| CN111187726A (en) * | 2019-10-11 | 2020-05-22 | 海南大学 | Rice blast bactericide prepared by using lysine-resistant bacillus borreliensis as chassis cells |
| CN113416670A (en) * | 2021-06-10 | 2021-09-21 | 江苏省农业科学院 | Boron-resistant lysine bacillus with bacteriostatic ability and application thereof |
-
2021
- 2021-12-14 CN CN202111524832.XA patent/CN114304192B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020077042A1 (en) * | 2018-10-10 | 2020-04-16 | AgBiome, Inc. | Compositions and methods for controlling plant pests and improving plant health |
| CN111187726A (en) * | 2019-10-11 | 2020-05-22 | 海南大学 | Rice blast bactericide prepared by using lysine-resistant bacillus borreliensis as chassis cells |
| CN113416670A (en) * | 2021-06-10 | 2021-09-21 | 江苏省农业科学院 | Boron-resistant lysine bacillus with bacteriostatic ability and application thereof |
Non-Patent Citations (3)
| Title |
|---|
| Bishnu K. Shrestha et al..Biological Control Activities of Rice-Associated Bacillus sp. Strains against Sheath Blight and Bacterial Panicle Blight of Rice.《PLOS ONE》.2016,1-18. * |
| Varish Ahmad et al..Efficacy of a novel bacteriocin isolated from Lysinibacillus sp. against Bacillus pumilus.《LWT - Food Science and Technology》.2018,第102卷第260-267页. * |
| 崔亚青 等.一株高效MC-RR降解菌的分离鉴定及其降解特性.《环境工程学报》.2013,第7卷(第2期),第783-790页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114304192A (en) | 2022-04-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Huddedar et al. | Isolation, characterization, and plasmid pUPI126-mediated indole-3-acetic acid production in Acinetobacter strains from rhizosphere of wheat | |
| CN111793591B (en) | Salmonella mutant strain capable of efficiently stimulating immune response and construction method and application thereof | |
| Tamura et al. | Role of phaseolotoxin production by Pseudomonas syringae pv. actinidiae in the formation of halo lesions of kiwifruit canker disease | |
| CN108865900B (en) | Isaria javanicus strain and application thereof | |
| CN102181420A (en) | Expression method of lactococcus lactis of porcine streptococcus phage catenase | |
| CN108441462A (en) | One bacillus subtilis and preparation method thereof | |
| CN114403158B (en) | B-lysine-resistant bacillus bacteriocin analogue and application thereof in inhibition of pseudomonas syringae tomato pathogenic varieties | |
| CN114304192B (en) | Preparation method of boron-resistant lysine-resistant bacillus bacteriocin analogue and application of boron-resistant lysine-resistant bacillus bacteriocin analogue in prevention and treatment of cassava bacterial wilt | |
| CN111117942B (en) | Genetic engineering bacterium for producing lincomycin and construction method and application thereof | |
| CN110468143B (en) | Preparation method and application of antibacterial peptide NZX | |
| CN104531656A (en) | Phosphomannose isomerase from chlorella variabilis and application thereof | |
| CN107012110A (en) | A kind of entomopathogenic nematode symbiotic bacteria and its application with inhibition of potato late blight | |
| CN102120997A (en) | Method for hydrolyzing RNA by grape pathogenesis-related (PR) protein PR10-1 and improving bacteriostatic activity | |
| CN102659933A (en) | Bacillus thuringiensis gene cry8like and cry8G combination and application thereof | |
| CN114209811B (en) | Preparation method of boron-resistant lysine bacillus bacteriocin analogue and application of boron-resistant lysine bacillus bacteriocin analogue in inhibition of bacillus pumilus | |
| CN111139208B (en) | High-yield engineering bacterium for producing ivermectin and preparation method and application thereof | |
| CN109251936B (en) | Smooth turtle shell serine protease inhibitor fusion protein and preparation and application thereof | |
| CN111139207B (en) | Brevibacillus brevis gene recombinant strain and preparation method and application thereof | |
| US20120015404A1 (en) | Gene cluster for thuringiensin synthesis | |
| CN103013980A (en) | Method for extracting bacillus subtilis genetically engineered bacterium plasmid | |
| CN105753958A (en) | Novel moronecidin mutant, and preparation method and application thereof | |
| CN115433682B (en) | Barnyard grass biocontrol bacterium B-48 and application method thereof | |
| CN113980945B (en) | Trichoderma viride histone deacetylase and encoding gene and application thereof | |
| CN111171122B (en) | Antibacterial peptide PtR946 derived from pinellia ternata and application thereof | |
| CN110105433A (en) | The application of novel lactic acid bacteria antibacterial peptide and high efficient expression and antibacterial anticancer activity |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |