CN102659933A - Bacillus thuringiensis gene cry8like and cry8G combination and application thereof - Google Patents
Bacillus thuringiensis gene cry8like and cry8G combination and application thereof Download PDFInfo
- Publication number
- CN102659933A CN102659933A CN2012101198311A CN201210119831A CN102659933A CN 102659933 A CN102659933 A CN 102659933A CN 2012101198311 A CN2012101198311 A CN 2012101198311A CN 201210119831 A CN201210119831 A CN 201210119831A CN 102659933 A CN102659933 A CN 102659933A
- Authority
- CN
- China
- Prior art keywords
- gene
- cry8like2
- grub
- hbf
- albumen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
The invention relates to a bacillus thuringiensis gene cry8like and cry8G combination and application thereof and belongs to the technical field of biological control. A gene cry8like1 is separated from HBF-18, the nucleotide sequence of the gene cry8like1 is shown as SEQ ID NO1, the gene cry8like1 is connected with cry8E to obtain a synthetic gene cry8like2, and the nucleotide sequence of the synthetic gene cry8like2 is shown as SEQ ID NO2. The synthetic gene has high toxicity on coleopteran pests, and particularly has high toxicity on grubs. Besides, the invention further provides a protein combination. The cry8like2 and cry8G have a synergistic effect on the coleopteran pests and are of vitally important significance for biological control of main underground pests like the grubs and green sustainable development of Chinese agriculture, and gene sources are further provided for developing anti-grub Bt engineering strains and genetically modified crops.
Description
Technical field
The present invention relates to the biotechnology prevention and control field, particularly relate to a kind of new thuringiensis gene cry8like and cry8G combination, reach and use.
Background technology
Grub is the general name of Scarabaeoidea (Scarabaeoidea) larva, belongs to Coleoptera, and gill Scarabaeidae is a most species in the subterranean pest-insect, also is that harm is maximum, causes the maximum kind of plant loss.Scarabaeoidea is of a great variety; Record has a kind more than 30,000 in the world, and China has write down kind more than 1800 at present, and these class pest feeding habits are assorted, it is wide to distribute, life is hidden, flexibility is strong, the life history is different in size; Wherein the cause harm kind more than 100 that has of agricultural herbage, control is difficulty very.Topmost have Holotrichia parallela (Holotrichia parallela), holotrichia oblita (Holotrichia obeita) and anomala corpulenta (Xu Jianguos such as (Anomala carpulenta); The model favour; Zhang Mingkao, Yang Enhua, and Guo Lin. (2002) Holotrichia parallela life habit is observed and Study of Prevention Technology; Plant protection technology and popularization, 9-10; Li Encai, Chen Jinhuan. (1998) FARMLAND GRUB population distributes and Prevention Technique, Shaanxi agricultural sciences, 48-49; Jiang Changsong, Jiang Fujun, and bag letter is flat. (2008) peanut grub a drug in sowing time control techniques in the time of infertility, modern agriculture science and technology, 121-123).Grub life habit complicacy is various, and harm worm attitude is also different, and what have endangers with adult, and what have endangers (Hu Qiongbo, 2004) with larva.Grub adult happiness food crop, woods fruit tree (poplar, elm, willow, apple, pears etc.) blade, tender stem and bud, fruit ears etc. work the mischief.Grub larva harm is even more serious, under the larva habitat, gets the seed that food sprouts and bites the seedling rhizome broken, and moth food root stem tuber etc. cause the disconnected ridge that gently then is short of seedling, and is heavy then ruin kind of a total crop failure.Larva not only damaging range is wide, and the time of causing harm is long, from the spring to the autumn, from being seeded into results bigger harm is arranged all.Grub gnaws underground root, stem tuber, makes plant growth weak, directly influences yield and quality, is injured seriously spring and autumn like peanut, Ipomoea batatas, yam, radish kind.Not only influence the exterior quality of product after grub gnaws, also be prone to cause germ and invade, the preserved vegetable storage is brought very big inconvenience from wound.Along with urban development, the turf green coverage strengthens year by year in recent years, and the maintenance of afforestation vegetation has been become an important process in the urban development.The grub larva stings food turf rhizome, and the disease that further causes invasion become one of main harm of urban afforestation turf (Xie Mufa. (1999) lawn subterranean pest-insect grub and control, the gardens, Guangdong, 46-47.).In addition, grub still endangers parasitosis (Macracanthorhychus hirudinaceus) intermediate host and the communication media of swinery, and acanthocephala parasitizes the small intestine of pig, and muck imposes on the field, grub be wherein between the host.Therefore, grub is the important pests of harm agricultural, forestry, urban afforestation.
Grub is the subterranean pest-insect that is difficult to prevent and treat of generally acknowledging both at home and abroad, and 86% of the part of a crop which is beneath the ground loss is caused by grub, and about 7,000,000 hectares of area takes place long-term according to statistics national grub, the general underproduction 20%~30%.The whole nation grub generation of serious time area once reached 2,000 ten thousand hectares; The underproduction reach more than 50% (and bag letter is flat for Jiang Changsong, Jiang Fujun. (2008) peanut grub a drug in sowing time control techniques in the time of infertility; Modern agriculture science and technology; 121-123), even total crop failure, present most important subterranean pest-insect become.Peanut causes the underproduction 20%~40% because of the grub generalized case that causes harm; But the underproduction 70%~80% when serious, even total crop failure, and peanut quality is descended dampen greatly the masses to plant the enthusiasm (Liu Shusen of peanut; Li Kebin; Yin Jiao, Cao Yazhong (2008) grub biological study on prevention progress. Chinese biological control, 168-173; Perhaps graceful, Jiang Chen, Gong Qingxuan, Chen Jinfeng, and is bent bright quiet. and (2010) Qingdao City peanut field grub is taken place and non-environmental pollution control research, peanut journal, 42-44; Wang Zhenjun, Guo Zhigang, Lei Xiaotian, and eats the Deping. (2010) peanut field grub occurrence cause and Prevention Technique, agricultural science and technology communication, 198-200,2010; ).In mid or late August, 2007 digs in the Heze Prefecture, Shandong Province and looks into, 8.7/m of grub population density average out to
2, be up to 22/m
2(Wang Aidong. (2008) FARMLAND GRUB takes place and integrated control technique, modern agriculture science and technology).2003~2007 years, take black lamp to lure the method that investigation combines of cutting the earth in collection and spring, summer, 3 seasons of autumn in the Wudi County.Field crop has been carried out random searching, and soybean field, corn field chafer reach 5.63 and 3.00/m2 respectively.The most species that soybean field chafer is taken place is 7 kinds.Wherein Chinese arc rutelian is maximum, accounts for 50.2%, and anomala corpulenta takes second place, and accounts for 25.1%.Holotrichia oblita the 3rd accounts for 13.0%, and other kinds are less.The corn field holotrichia oblita is maximum, accounts for 38.7%, and anomala corpulenta takes second place; Account for 29.5%, Holotrichia parallela the 3rd accounts for 14.6%; Other kinds less (Tian Fangwen, Peng Yanming, Zhang Weihua; The few English of Cui and. investigation of farmland, (2008) Wudi County, Shandong Province chafer kind and pests occurrence rule research, the Anhui agricultural sciences, 12322-12323).At present, since the popularization of mechanized, the change of the cropping system of agriculture prodn; Such as the popularization of technology such as no-tillage cropping system, straw-returning, brought comfortable living environment and abundant food to grub, increased the insect population number of unit surface; Make grub harm increase the weight of day by day, particularly northeast, North China and Central China have brought difficulty (Pei Guiying for the control of grub; The Marseille flies; Liu Jian, Liu Baocai. the different farming patterns in (2010) soybean field are to the influence of grub generation and output, science breeding).
The new Bt bacterial strain that screening has the specificity insecticidal spectrum is Bt research most active fields all the time.Since the nineties, people find that when summary and review Bt insecticide control insect historical existing Bt sterilant mainly is to be used to prevent and treat susceptibility lepidoptera pest on the ground, is used to prevent and treat Coleoptera class Diabrotica insect seldom.But play under parasporal crystal protein and the uviolizing of gemma in sunlight of main insecticidal activity effect and be easy to inactivation; The forfeiture insecticidal activity (just upright good, Zheng Guiling, Zhou Hongxu; Li Changyou; Li Guoxun. the biological activity of two killing coleotera pests Bt bacterial strains and insecticidal protein gene are identified, North China agronomy newspaper, 2010 (3)).Application of B t preparation control of grubs has certain advantage, because grub living environment is hidden, has avoided parasporal crystal and gemma to receive ultraviolet irradiation, can prolong the desinsection lasting period, improves insecticidal effect.Therefore, some Bt investigators turn to screening to main subterranean pest-insect research emphasis---and cockchafer subclass larva has on the bacterial strain of insecticidal activity, and makes a breakthrough.At present; Existing many report is about to effective bacterial strain of grub and gene; 1992; Ohba etc. filter out the new bacterial strain of a strain Bt (Bt.subsp.japonensis BuiBui) that anomala corpulenta, Japan popillia flavosellata fairmaire larva is had special insecticidal activity in the world first, and this is that Bt is used for the study on prevention to grub first.Sato equal 1994 from this bacterial strain the clone obtain new killing gene-cry8Ca1.1994, U.S. Mycogen company had tangible insecticidal activity from isolating cry8Aa1 of Bt bacterial strain PS50C and cry8Ba1 to brevitarsis Cotinis sp.The Bt bacterial strain SDS-502 that contains cry8Da that Shin-ichiro Asano etc. found in 2003 has high reactivity to the verdigris different beetle.
It is to begin later in 2002 that the genes involved of China is excavated.The Plant Protection Office of Hebei Academy of Agricultural Sciences filters out the Bt bacterial strain that many strains have special insecticidal activity to yellowish-brown rutelian (Anomala.exoleta) and anomala corpulenta (Anomala..corpulenta) larva.2004, this laboratory was cloned from bacterial strain HBF-1 and is obtained anomala corpulenta cry8Ca2 gene has efficiently been carried out mutation research subsequently, has improved the insecticidal activity to anomala corpulenta.2006; This laboratory finds that again Bt bacterial strain Bt185 has better insecticidal activity to Holotrichia parallela; This is first strain found has the gene of insecticidal activity to Holotrichia parallela, 2008 from this bacterial strain the clone obtained pattern gene cry8Fa1 and to the pattern gene cry8Ea1 of the high vigor of Holotrichia parallela.2009, this laboratory was found again simultaneously the Bt bacterial strain HBF-18 of Holotrichia parallela with the big black high insecticidal activity of gill cockchafer is separated to the new gene cry8Ga1 to big black gill cockchafer and effective second classification grade of Holotrichia parallela from this bacterial strain.Result of study shows that there be bacterial strain and the gene that grub is had special insecticidal activity in occurring in nature, through screening efficient insecticide bacterial strain and gene, can utilize Bt to come grub to carry out effective biological control.Finding at present has the Bt gene of insecticidal activity that genoids such as cry3, cry8, cry23, cry18, cry37, cry43 are arranged to grub.Studying more is the cry8 genoid, and the cry8 genoid is made up of 1160-1210 amino acid, and molecular weight is between 128-137kDa.The clone of these bacterial strains and gene provides the quality strains resource for the grub control of China, also for further developing anti-grub genetically modified crops genetic resources is provided.
After the nineties in 20th century; The problem that produces along with the large-scale application of chemical pesticide is more and more outstanding; China has limited the use of relevant riskiest pesticide gradually, from January 1st, 2007, has completely forbidden height such as SRA-5172 and has poisoned the medicine of learning to farm in application in agriculture.Height poisons withdrawing from the arena gradually of the medicine of learning to farm has vacateed the huge market space to biological pesticide undoubtedly.Plan " 12 " according to China's pesticide industry is confirmed; The agricultural chemicals industry will continue the alternative work of in-depth riskiest pesticide; Expect 2015; The riskiest pesticide proportion will be reduced to about 5% by present 20%, will be increased to more than 30% by present less than 10% and biological pesticide accounts for the share of all agricultural chemicals.In order to obtain best society, economy and ecological benefits; Improve agroecological environment; Realize the Sustainable development of China's rural economy; Ensure grain, food safety production, strengthen the agricultural products in China international competitiveness, research and development and popularization are that the grub integrated control technique of core is present main flow trend with the biological control.
Bacterial strain HBF-18 has better insecticidal activity to big black gill cockchafer and Holotrichia parallela, and this project team therefrom is separated to Holotrichia parallela and the big black all activated cry8Ga1 gene of gill cockchafer.The cry8Ga gene also be present unique report to the activated cry gene type of big Holotrichia parallela.Yet cry8Ga expression of gene product is compared with starting strain (HBF-18), and bigger difference is arranged, and the result shows that the no crystal mutant strain that contains the cry8Ga gene is low with the specific activity starting strain of dark gill cockchafer to big black gill cockchafer, its LC
50Exceed respectively 50 times with 70 times (Shu et al.2009) (table 1-1).At other of this seminar clone activated gene of grub then there is not this phenomenon.The isogenic Bt of cry8Ca, cry8Ea, cry8Ha and cry8Ia does not have crystal mutant strain tool and its starting strain HBF-1, Bt185 and BtSU4 have suitable insecticidal effect (to show 1-2,1-3) changing over to.These phenomenons show, except containing the cry8Ga gene, also contain some other new killing genes among the bacterial strain HBF-18.
Table 1-1 bacterial strain HBF-18 and HD8G (having only cry8Ga expression of gene expression strain) compare the insecticidal activity of big black gill cockchafer and Holotrichia parallela
aIt in the bracket 95% fiducial interval
bMV ± standard error
Table 1-2. bacterial strain HBF-1 and HD8C (having only cry8Ca expression of gene expression strain) compare the insecticidal activity of anomala corpulenta
aIt in the bracket 95% fiducial interval
bMV ± standard error
Table 1-3. bacterial strain Bt185 and HD8E (having only cry8Ea expression of gene expression strain) compare the insecticidal activity of Holotrichia parallela
aIn the bracket 95% fiducial interval.
bMV ± standard error
The research of this project team finds that also the collaborative use of several genes can improve the control effect of Bt to grub.People's results of study such as Yan Guixin show that cry3Aa gene and cry8Ca gene co expression can improve the insecticidal effect (Yan et al.2009) (table 1-4) to anomala corpulenta; People's results of study such as Liu Jingjing show that cry8Ea and cry8Ca coordinate expression can significantly improve the control effect (Liu et al.2010) (table 1-5) of bacterial strain to Holotrichia parallela.These results of study show employing polygene co expression, can improve insecticidal effect.And the no crystal mutant strain that contains the cry8Ga gene to big black gill cockchafer and Holotrichia parallela specific activity starting strain all to hang down 50 times with 70 times, explain in the HBF-18 bacterial strain and except containing the cry8Ga gene, also possibly contain some other new killing genes.These new killing genes can not be identified out through traditional authentication method, identify these genes so we need use the method for the new new gene of evaluation.Solexa order-checking be a kind of new, effectively identify the method for new gene.
Table 1-4. bacterial strain HBF-1, Bt22 and 3A-HBF be to colorado potato beetles, big daikon leaf beetle, the insecticidal activity comparison of anomala corpulenta
Table 1-5. bacterial strain HBF-1, Bt185 and BIOT185 compare the insecticidal activity of anomala corpulenta and Holotrichia parallela
Summary of the invention
The present invention separates from HBF-18 and obtains cry 8like1 gene, and obtains cry 8like2 synthetic gene after cry 8E is connected, and the high virulence of this gene pairs coleopteran pest particularly has high virulence to grub.
The present invention simultaneously provides a kind of protein combination, and Cry8like2 and Cry8G have synergy on coleopteran pest.
Cry 8like1 albumen, it has the aminoacid sequence shown in the SEQ ID NO3.
Said albumen is Cry8like2 albumen, and its aminoacid sequence is shown in the SEQ ID NO4.
The proteic gene of coding Cry 8like1, it has the nucleotide sequence shown in SEQ ID NO1.
The proteic gene of coding Cry 8like2, its nucleotide sequence is shown in SEQ ID NO2.
A kind of carrier contains said gene.
Said carrier is pSTK 8like2, and is as shown in Figure 13.
A kind of protein composition is made up of Cry 8like2 and Cry8Ga1 albumen.
The application in anti-coleopteran pest of above-mentioned albumen or protein composition.
Said application is albumen or protein composition to be processed sterilant be used to kill coleopteran pest.
Said application is in the gene transferred plant or mikrobe with proteins encoded, makes it express the characteristic of anti-coleopteran pest.
Said coleopteran pest is a grub.
This research is studied the Bt bacterial strain HBF-18 (cry8Ga1) of the isolating cry8Ga of containing gene.Target is to being separated to the new type disinsection gene except that the cry8Ga gene the highly active HBF-18 bacterial strain of big Holotrichia parallela, and analyzes new proteic function.At first utilize the Solexa high throughput sequencing technologies to measure the genome sequence of bacterial strain; Predict all encoding soxs, obtain the possible encoding amino acid sequence of bacterial strain, and utilize the insecticidal proteins DB of existing report to carry out sequence alignment; From the HBF-18 bacterial strain, be separated to the new type disinsection gene 8like1 except that the cry8Ga gene; And analyze new proteic function, and syntheticly simultaneously obtaining the cry8like2 gene, it is to the Holotrichia parallela high reactivity; The experiment proof; Cry8like2 has identical synergy with the 8G assortment of genes, and the biological control of main subterranean pest-insect grub and China's green Sustainable development of agricultural are all had extremely important meaning, and further Bt engineering strain, the genetically modified crops for the anti-grub of exploitation provide gene source.
Description of drawings
Fig. 1 cry8like1 sequential analysis
Fig. 2 Cry8like1BlastP result
The transcription analysis of Fig. 3 candidate gene in HBF 18 bacterial strains, A is Cry8like1 RT-PCR result, B is Cry8Ga RT-PCR result, M:BM2000 Marker; 1:HBF-183h cDNA; 2:HBF-18 3h RNA; 3:HBF-18 5h cDNA; 4:HBF-18 5h RNA; 5:HBF-18 8h cDNA; 6:HBF-18 8h RNA; 7:HBF-18 12h cDNA; 8:HBF-18 12h RNA; 9:HBF-18 24h cDNA; 10:HBF-18 24h RNA; 11:HBF-18 genome positive control; 12: no template negative control
Fig. 4 cry8like1PCR product
M: λ DNA/Eco130 I; The 1:cry8like1PCR product, the 2:cry8like1 negative control
The pulsating pcr amplification in the overlapping primer PCR of Fig. 5 two ends
1:cry8like1N end PCR product; 2:cry8like1N end PCR negative control; 3:cry8EaC end PCR product; 4:cry8EaC end PCR negative control; M: λ DNA/Eco130I
The overlapping PCR product of Fig. 6
M: λ DNA/Eco130I; 1: the cry8like2 full-length gene that overlapping PCR obtains
Fig. 7 construction of recombinant plasmid schema
Fig. 8 cry8 bacterium liquid PCR identifies
M: λ DNA/Eco130I; 1,2:cry8like1 bacterium liquid PCR product; The 3:cry8like1 positive control; The 4:cry8like1 negative control; 5:cry8like2 bacterium liquid PCR product; The 6:cry8like2 positive control; The 7:cry8like2 negative control
Fig. 9 plasmid enzyme restriction is identified
M-BM10000; The 4-cry8like1-pEB-JM109 plasmid enzyme restriction is identified; The 5-cry8like2-pEB-JM109 plasmid enzyme restriction is identified;
The soluble component of Figure 10 cry8like1 expression product
1-Marker,2-Cry8like1
The enzyme-added site PCR that cuts of Figure 11 cry8like2
M-λ DNA/Eco130 I, 1-cry8like2 PCR product
Figure 12 shuttle vectors pSTK double digestion product
M-λ DNA/Eco130I, 1-pSTK double digestion product
Figure 13 expression vector pSTK makes up
Figure 14 cry8like2 expression vector establishment PCR identifies
M:BM5000,1:cry8like2-pSTK-HD73-PCR identifies
Figure 15 plasmid enzyme restriction is identified
M-BM10000, the 1:cry8like2-pSTK-JM109 plasmid enzyme restriction is identified
Figure 16 cry8 expressing protein
The 1-cry8like2 expressing protein, M-BM10000
Figure 17 average and standard deviation
Embodiment
1 experiment material
1.1 bacterial strain and plasmid
Bacterial strain uses therefor and plasmid are seen table 2-1, and following formula bacterial strain and plasmid preservation that the applicant all has can be provided the public.
Table 2-1 bacterial strain and plasmid
1.2 reagent
1.2.1 substratum
Liquid LB substratum: 0.5%yeast extract, 1.0%trytone, 1.0%NaCl, 7.0,121 ℃ of sterilizations of pH 20mim.
Solid LB substratum: in liquid LB substratum, add 1.3% agar powder, 121 ℃ of sterilization 20mim.
BH substratum: 3.7%Brain and heart infusion broth, 121 ℃ of sterilization 20mim.
Beef-protein medium: the 3g Carnis Bovis seu Bubali cream, the 5g soy peptone, dissolved in distilled water, NaOH transfers pH to 7.2, is settled to 1000mL, 121 ℃ of sterilization 20min.
1.2.2 microbiotic
Penbritin aqueous solution 100mg/ml ,-20 ℃ of preservations, 1000 times of time spent dilutions; Paraxin ethanol solution 34mg/mL ,-20 ℃ of preservations, dilution is 1000 times during use.Kantlex aqueous solution 50mg/ml ,-20 ℃ of preservations, 1000 times of time spent dilutions.
1.2.3 enzyme and biochemical reagents
1) pcr amplification reagent is available from rich Deco skill Development Co., Ltd and the TaKaRa company of stepping in Beijing;
2) restriction enzyme and 2x connect test kit available from TaKaRa company;
3) plasmid extraction and DNA reclaim test kit available from Axygen company;
4) the M-MLV first chain synthesis system that is used for qRT-PCR is available from Invitrogen company;
5) DNA standard molecular weight Marker is available from the rich Deco skill Development Co., Ltd that steps in Beijing;
6) microbiotic is available from the prosperous great achievement bio tech ltd in Beijing.Other reagent is commercially available homemade or import analytical pure or electrophoresis level pure chemistry reagent.
7) the PCR primer is synthetic by the living worker in Shanghai Bioisystech Co., Ltd, and sequencing is accomplished by Institute of Crop Science, Chinese Academy of Agricultural Science's farm crop genetic resources and improvement of genes specific national scientific development project open laboratory.
8) molecular weight of albumen standard: Precision Plus Protein
TMStandards (kDa): 250,150,100,75,50,37,25,20,15,10.
9) DNA standard molecular weight:
λDNA/Eco130I(λ/E):19329、7743、6223、4254、3472、2690、1882、1489、925、421(bp)。
BM2000:2000、1000、750、500、250、100(bp)
BM5000:5000、3000、2000、1000、750、500、250、100(bp)
1.2.4 solution commonly used and damping fluid
1) Bt total DNA extraction liquid
Solution I: 0.3% sucrose, 25mmol/L TrisCl (pH 8.0), 25mmol/L EDTA (pH 8.0), 50mg/mL Lysozyme.
Solution II: 0.1mol/L Nacl, 0.1%SDS, 0.1mol/L TrisCl (pH 8.0).
2) Bt protein extraction reagent:
Lysate: 50mM Na
2CO
3, 50mM EDTA.Compound method: the 5.30g soda ash light, 18.61g EDTA ultrapure water is settled to 1000ml, after the 121 ℃/20mim sterilization, transfers pH to 9.5, and the adding final concentration is 3% β mercaptoethanol before using.
Sodium-acetate acetate buffer solution: 4M anhydrous Na Ac.Compound method: the 65.61g sodium acetate, anhydrous transfers to 4.5 with HAc with pH after dissolving with a small amount of distilled water again, is settled to 200ml again.
Protein dissolution damping fluid: 50mM Na
2CO
3Compound method: anhydrous Na
2CO
35.30g ultrapure water is settled to 1000ml, pH9.5
1M NaCl:NaCl 58.44g, ultrapure water is settled to 1000ml.
3) agarose gel electrophoresis damping fluid:
50 * TAE Buffer (pH8.5): 242g Tris, Na
2EDTA2H
2O 37.2g adds the 800ml deionized water, fully after the stirring and dissolving, adds the 57.1ml glacial acetic acid again, is settled to 1000ml after fully stirring, 50 times of time spent dilutions.
4) protein electrophorese reagent and damping fluid:
3 * sample-loading buffer: Tris 3.63g, tetrabromophenol sulfonphthalein 0.3g, SDS 6.0g, glycerine 30.0ml, beta-mercaptoethanol 15ml transfers pH 6.8, and ultrapure water is settled to 100ml;
30% acrylic amide (Acr)/methylene diacrylamide (Bis): acrylic amide 29.2g, methene acrylic amide 0.8g, ultrapure water is settled to 100ml;
10 * electrode buffer: Tris 30.3g, glycocoll 144.1g, SDS 10.0g, zero(ppm) water is settled to 1000ml, and pH 8.3,10 times of time spent dilutions;
The separation gel damping fluid: Tris 27.23g, 0.4%SDS, the dissolving of 100ml ultrapure water, HCl transfers pH to 8.8, and ultrapure water is settled to 150ml.
Concentrate the glue damping fluid: Tris 6.0g, 0.4%SDS, the dissolving of 100ml ultrapure water, HCl transfers pH to 6.8, and ultrapure water is settled to 150ml.
Coomassie brilliant blue R250 staining: SI:50% ethanol, 10% acetate
SII:5% ethanol, 7.5% acetate
95% ethanolic soln of SIII:0.25% coomassie brilliant blue R250
Annotate: 50ml solution two adds 200 μ l solution three.
Other reagent: TEMED; 10%Ammonium persulfate (newly joining).
1.2.5 other reagent
1) 1M Tris-HCl (PH8.0): 121.1gTris is dissolved in the 800ml deionized water, fully transfers PH to 8.0 after the stirring and dissolving, is settled to 1L, autoclave sterilization.
2) 0.5M EDTA (PH8.0): 186.1g Na
2EDTA2H
2O adds the 800ml deionized water, after fully stirring, transfers PH to 8.0 (about 20gNaOH) with NaOH, and deionized water is settled to 1L, autoclave sterilization.
3) TE damping fluid: 1M Tris-HCl (PH8.0) 10ml, 0.5 M EDTA (PH8.0) 2ml, deionized water is settled to 1L.
4) PBS damping fluid: 8.006g NaCl, 0.201g KCl, 1.540g Na
2HPO
4, 0.191g KH
2PO
4, pH to 8.0 is transferred in the dissolving of 800ml distilled water, is settled to 1000mL, and autoclave sterilization is stored in 4 ℃.
5) carbolfuchsin dye liquor: basic fuchsin (Basic Fuchsine) ethanol saturated solution (about 10%) 10mL, aqua carbolisata solution 5%, 100mL, two liquid phases are mixed, and dilute 10 times of dyeing.
6) 20mg/ml X-Gal:1g X-Gal, DMF (N) is settled to 50ml, is sub-packed in 1.5mlEp pipe back and keeps in Dark Place for-20 ℃.
7) 24mg/ml IPTG:IPTG1.2g, aqua sterilisa is settled to 50ml, and 0.22 μ m filter filtration sterilization is sub-packed in-20 ℃ of preservations in back of 1.5mlEp pipe.
8) 0.1M CaCl
2: 2.94g CaCl
22H
2O, zero(ppm) water is settled to 200ml, autoclave sterilization.
1.3 supply the examination insect
Anomala corpulenta (Anomala corpulenta), holotrichia oblita (Holotrichia oblita), Holotrichia parallela (Holotrichia parallela) are provided by plant protection institute of Hebei province Cangzhou City Academy of Agricultural &. Forestry Sciences; Sensitive population small cabbage moth (Plutella xylostella) is the stdn examination worm by this laboratory rearing.
1.4 plant and instrument
1) shaking table D250: U.S. NBS company;
3) high-speed vertical whizzer: du pont company, RC-5 type;
4) desk centrifuge: German Eppenddorf, 5415C;
5) Ultrasonic Cell Disruptor: Noise Isolating Tamber, Ningbo Scientz Biotechnology
6) PCR appearance: U.S. AmpGene 4800.
6) protein electrophoresis appearance: U.S. Bio-Rad company, Mini protein III.
7) gel imaging system: U.S. STRAGENE company, Eagle EyeII System.
8) nucleic acid electrophoresis apparatus: DYY-5 type, Beijing Liu Yichang.
9) opticmicroscope: Japanese OLYMPUS CX21.
10) electric shock conversion instrument: Bio-Rad Gene Pulser;
11) Beckman supercentrifuge Avanti J-26xp;
12) water-bath: the Changjiang river, Yuyao thermometer Watch Factory, DHW-420;
13) high-pressure steam sterilizing pan: Japanese SANYO company;
14) electronic balance: German Sai Duolisi Sartorius BP 310S;
15) ultraviolet spectrophotometer UV-2100: UNICO(Shanghai) Instruments Co., Ltd.;
16 :) Bechtop: Suzhou Decontamination Equipment Plant;
17) DNA concentration determination appearance: Nanodrop spectrophotometer, U.S. Thermo Finnigan;
18) biochemical incubator: spire medical apparatus and instruments factory, LRH-150B type.
19) constant incubator: Shanghai laboratory apparatus head factory, DHP120 type.
20) DNA Dryer: U.S. Disco company;
2 research methods
2.1Bt genomic extraction
1) pours 5mL culture bacteria liquid into EP pipe, 12, the centrifugal 2min of 000r/min.
2) add 200 μ L solution I, add 20~25mg/10mL N,O-Diacetylmuramidase, mixing is placed 10min for 37 ℃.
3) add solution II 300 μ L, add phenol 100 μ L (4 ℃ of preservations) again, mixing.70 ℃ of water-baths one hour, every 30min jog once.
4) treat that temperature is cooled to room temperature after, add chloroform 100 μ L, mixing, 12, the centrifugal 5min of 000r/min.Be divided into three layers, get the superiors' supernatant.Shift supernatant, with equal-volume isopropanol precipitating 20min.12, the centrifugal 8min of 000r/min gets deposition.
5) after absolute ethyl alcohol washes twice, dry, be dissolved in 50 μ LddH
2O (containing RNase).
2.2 the extraction of e. coli plasmid dna (Axygen plasmid extraction kit)
1) be taken at the bacterium liquid 1-4ml of overnight cultures in the LB liquid nutrient medium, 12, the centrifugal 1min of 000rpm abandons supernatant;
2) add the damping fluid S1 that 250 μ L contain 50mg/ml RNase A, suspension bacterial precipitation;
3) in above-mentioned suspension, add 250 μ L bacterial lysate S2, gentleness also spins upside down 4-6 time until forming evenly bright solution fully;
4) add 350 μ L neutralizer S3 again, gentleness also spins upside down 6-8 time fully.12, the centrifugal 10min of 000rpm;
5) draw the supernatant in the step 4 and transferring in the preparation pipe (placing the 2ml centrifuge tube), 12, the centrifugal 1min of 000rpm abandons filtrating;
6) the preparation pipe is put back in the centrifuge tube, adds 500 μ L washings W
1, 12, the centrifugal 1min of 000rpm abandons filtrating;
7) preparation pipe is put back in the centrifuge tube, adds the 700 μ L liquid W that desalts
2, 12, the centrifugal 1min of 000rpm abandons filtrating.Repeat once;
8) will prepare pipe and put back in the 2ml centrifuge tube, 12, the centrifugal 1min of 000r/min.
9) the preparation pipe moves in the new 1.5ml centrifuge tube, and central authorities add 60-80 μ L deionized water (be heated to 65 ℃ and can improve elution efficiency) at the preparation film, leave standstill 1min, and 12, the centrifugal 1min of 000rpm.
2.3 obtain the HBF-18 genomic dna sequence
Extract the genome of HBF-18 bacterial strain, utilize Solexa high-flux sequence system to carry out gene order-checking, utilize order-checking instrument accompanying software to carry out sequence assembly, finally obtain the genomic information of bacterial strain.
2.4 obtaining novel pesticidal proteins gene-gene infers
Utilizing the Genemark software package to carry out encoding sox the HBF-18 genome sequence infers, obtains all encoded protein sequences of above-mentioned bacterial strains.
Killing gene local data base (all Bt killing gene information that comprise present report) through genome sequence and project team carries out the BlastX comparison, and program is carried out the comparison of protein rank with genome all sequences that obtains (comprising coding and non-coding sequence) and killing gene local data base.Comparison will obtain in the bacterial strain dna sequence dna that all and killing gene proteins encoded have similarity, and these sequences possibly comprise the gene fragment that produces in silencer and the evolutionary process.
The protein sequence of inferring the strain gene group coding of gene through Genemark carries out the BlastP comparison with killing gene local data base (all Bt insecticidal proteins amino acid sequence informations that comprise present report) with project team; What comparison will obtain the strain gene group coding has the protein sequence of similarity with insecticidal proteins, further obtains the respective coding gene.These sequences possibly comprise silencer.
2.5 new Gene Sequence Analysis
Gene and two terminal sequences thereof with software Vector NTI Suite 9 (Invitr (Yan, Song et al.2009) ogen, Carlsbad, CA, USA) and online information biology software analyze.
2.6RNA extraction and purification
Based on 30 ℃, 230rpm cultivation 3.5h, 5h, 8h, 12h, 24h's HBF-18 bacterial strain take a sample respectively, extract total RNA with Trizol reagent with the LB liquid culture, and the RNA leaching process is following:
1) get 2ml Eppendorf (EP) pipe that 2ml bacterium liquid places RNase free,, 12, the centrifugal 1min of 000rpm collects thalline;
2) add 500 μ l Trizol reagent in the thalline, one spoonful of silica sand, the broken 1min of cytoclasis appearance;
3) add 500 μ l Trizol reagent in the sample of fragmentation back, the vibration mixing, room temperature is placed 5min;
4) add 1/5 volume chloroform (about 200 μ l), thermal agitation, room temperature is placed 5min, 4 ℃, the centrifugal 10min of 12000rpm;
5) get the superiors' supernatant, add equal-volume Virahol mixing, precipitation at room temperature 10min;
6) 4 ℃, 12, the centrifugal 10min of 000rpm abandons supernatant;
7) 75% pre-cooled ethanol washing tube wall and deposition are abandoned supernatant;
8) after the deposition seasoning, add 20 μ l DEPC water ,-70 ℃ of preservations are subsequent use.
The removal of DNA in the RNA sample:
1) residual DNA is with the DNase I processing of the RNase-free in the Ferment test kit among the RNA that extracts.
The removal system of DNA (50 μ l):
2) 37 ℃ handle behind the 30min to, add 2 μ 1EDTA (test kit provides) in the above-mentioned system, handle 10min for 70 ℃.
3) purity of RNA and concentration are measured with spectrophotometer.
2.7RT-PCR
According to the method that Superscript Ш reverse transcriptase specification sheets provides, get 1ng-5 μ g RNA as template, oligo (dT) is a primer, utilizes the M-MLV ThermoScript II to synthesize the cDNA chain.
1) the cDNA first chain synthesis reaction system (20 μ l) is as follows:
Get 1ng-5 μ g purified RNA, add 1 μ l oligo (dT), mixing, 70 ℃ of insulation 4min add reactant by following system then
Behind the mixing, place 2min on ice.Hatch 1h for 42 ℃;-20 ℃ of preservations are subsequent use.
2) RT-PCR: get 2 these cDNA of μ l as template, with cry8Ga1, the special primer 16S rRNA-F/16S rRNA-R of the primer of cry8like1 gene specific and 16S rRNA carries out pcr amplification.Pcr amplification circulates as follows: 94 ℃ of preparatory sex change 5min; 94 ℃ of sex change 1min, 65 ℃ of annealing 1min, 72 ℃ are extended 40s, 30 circulations; 72 ℃ are extended 10min eventually.Wherein the 16S rDNA of 16S rRNA-F and 16S rRNA-R amplification is interior mark; The HBF-18 strain gene group DNA is as positive control; As negative control, guarantee that the RT-PCR reaction is not because the pollution of DNA causes, and establishes a negative control that does not add template in addition with the RNA that does not carry out reverse transcription.
2.8 the new clone of gene in intestinal bacteria
2.8.1PCR primer and sequence
According to known new full length gene sequence, designed following total length primer to (table 2-2), candidate gene increases from the HBF-18 wild strain.
Table 2-2 primer sequence
2.8.2PCR reaction system and condition
1) reaction system:
2×PrimerSTAR?Mix 25μL
Primer is to each 1 μ L
ddH
2O 22μL
Total 50μL
The PCR reaction conditions is: 94 ℃ of preparatory sex change 5 minutes, and 94 ℃ of sex change 1 minute, 56 ℃ of annealing 1 minute, 72 ℃ were extended 3 minutes, 30 circulations, last 72 ℃ were extended 10 minutes eventually.
2) because the HBF-18cry8like1 sequence that we are cloned into is the sequence of one and half length; Find that behind compare of analysis its 2143-2169 bit base and cry8Ea1 corresponding sequence have high similarity (as follows); Still consider 8like15 ' terminal sequence and cry8Ea 3 ' terminal sequence to be recombinated according to the overlapping PCR primer of this zone design, obtain the cry81ike2 sequence of a total length.
CCAAATGAAAAACGGTTGTTATGGGATGCAGCAAAAGAGGCAAAACGCCTCA
||||||||||||||?|||||||?|||||||?||||||||||||||?||||
CCAAATGAAAAACGCTTGTTATTTGATGCAGTGAAAGAGGCAAAACGACTCA
At first exchange R and exchange the F/cry8EaR primer to cry8like1N end and the cry8EaC terminal sequence of increasing respectively with cry8-like1F/, former and later two fragments are recombinated in the extension through overlapping chain in the amplified reaction subsequently.
Reaction system 1:
The PCR reaction conditions is: 94 ℃ of sex change 1 minute, and 58 ℃ of annealing 1 minute, 72 ℃ were extended 2.5 minutes, 30 circulations, last 72 ℃ were extended 10 minutes.
For the second time PCR is a template with two dna fragmentation mixtures that the first time, PCR obtained, use Cry8-like1F and cry8EaR as primer to carrying out pcr amplification.Because in first time PCR, it is reverse complemental that one section sequence is arranged between the overlapping primer, so 2 fragments can be matched in the PCR annealed process in the second time; Combine; Add the primer at two,, amplify a complete gene that contains 2 gene fragments through the extension process.
Reaction system 2:
The PCR reaction conditions is: 94 ℃ of sex change 1 minute, and 56 ℃ of annealing 1 minute, 72 ℃ were extended 4 minutes, 30 circulations, last 72 ℃ were extended 10 minutes.
2.8.3DNA recovery
1) under long-wave ultra violet lamp, downcut the sepharose that contains target DNA fragment, paper towel is washed most gel surface liquid, places 2mL EppendorfTube, calculated for gel weight (taking by weighing Guan Chong in advance), and this weight is as a gel volume.
2) add the Buffer ED-A of 3 times of gel volumes, mixing, 75 ℃ of heating in water bath mix several times therebetween, melt fully to gel;
3) the Buffer ED-B of 0.5 Buffer ED-A volume of adding, mixing;
4) mixed solution in the step 3 is transferred to DNA preparation pipe, and is centrifugal 12, and the centrifugal 1min of 000rpm abandons filtrating;
5) preparation pipe places the 2ml centrifuge tube, adds 500 μ L elution buffers, and is centrifugal 12, and the centrifugal 30s of 000rpm abandons filtrating;
6) the preparation pipe is put back the 2ml centrifuge tube, adds 700 μ L elution buffer W
2, the centrifugal 30s of 12000rpm abandons filtrating.Repeat once;
7) pipe be will prepare and 2ml centrifuge tube, the centrifugal 1min of 12000rpm put back;
8) will prepare pipe and place clean 1.5ml centrifuge tube, central authorities add 25-30 μ L deionized water at the preparation film, leave standstill 1min.12, the centrifugal 1min of 000rpm, eluted dna.
2.8.4 the plasmid vector enzyme is cut system
Cut system 200 μ L, 37 ℃ of insulation 1h according to following standard preparation pEB carrier enzyme.
Carry out the electrophoresis detection analysis with 0.7% agarose, 120V voltage is electrophoretic buffer with 1 * TAE, electrophoresis 30min.
2.8.5 ligation
Carrier DNA 0.1~0.2 μ g
Purpose sheet segment DNA 0.5~1.0 μ g
Connect test kit Solution I 5 μ L
Use ddH
2O supplies volume to 10 μ L, abundant mixing, and 16 ℃ of connection 4h or 4 ℃ of connections are spent the night.
2.8.6 the preparation of competent escherichia coli cell
1) the single bacterium colony of the E.Coli that picking is fresh is connected in the 5mL LB liquid nutrient medium, and 37 ℃, 220rpm shakes overnight cultures;
2) transfer in the triangular flask that 100mL liquid LB substratum is housed by 1% inoculum size, 37 ℃, 2~3h is cultivated in the 220rpm concussion, makes OD
600Value reach between 0.4~0.6;
3) 4 ℃, 5, the centrifugal 10min of 000rpm;
4) abandon supernatant, add the 0.1M CaCl of 1/2 volume (50mL) ice precooling
2The solution suspension cell places on ice more than the 30min;
5) 4 ℃, 5, the centrifugal 10min of 000rpm reclaims cell;
6) with the 0.1M CaCl of 2~4mL ice precooling
2Re-suspended cell adds the glycerine of 1/2 volume 50%, is distributed in the 200 μ L/1.5mL centrifuge tubes, and is subsequent use in-70 ℃ of preservations.
2.8.7 colibacillary heat shock transforms
The DNA or the 5 μ L connection product that 1) 1 μ g will be transformed join in the 200 μ L competent cells mixing;
2) 42 ℃ of thermal shock 90s behind the ice bath 30min take out ice bath 3min immediately;
3) add 800 μ L liquid LB substratum and cultivate 1h for 37 ℃;
4) get the LB solid plate that 200 μ L coating has corresponding resistant, add IPTG 4 μ L as required, X-Gal 40 μ L.
5) screen positive transformant behind 37 ℃ of cultivation 16h.
2.8.8 the screening of positive transformant
2.8.8.1PCR identify
With aseptic toothpick hickie is transferred to new solid plate and insert the LB test tube simultaneously, cultivate 8h for 37 ℃, with the positive contrast of starting strain genome, screening positive clone.Carry out PCR with vector expression district forward primer pEBF and full-length gene reverse primer and identify, filter out positive transformant in the right direction.
Reaction system:
The PCR reaction conditions is: 94 ℃ of preparatory sex change 5 minutes, and 94 ℃ of sex change 1 minute, 58 ℃ of annealing 1 minute, 72 ℃ were extended 2.5 minutes, 30 circulations, last 72 ℃ were extended 10 minutes.Get 3 μ l amplified productions carry out agarose electrophoresis detect (120V, 30min).
2.8.8.2 enzyme is cut evaluation
Positive transformant in the right direction extracts DNA (Axygen plasmid extraction kit, operating process see say), carries out enzyme with insertion site upstream and downstream restriction enzyme site Sal I and Sma I again and cuts evaluation.
Reaction system:
Reaction conditions: the reaction system mixing is placed on 37 ℃ of enzymes and cuts 2-4h, gets 5 μ l enzymes and cuts the product electrophoresis detection.
2.8.9 sequencing and analysis
Identify that correct positive transformant is by Chinese Academy of Agricultural Sciences's major scientific projects vertical test preface.Dna sequence analysis is to use Vector NTI Suite 9 software packages of DNAMAN and Invitrogen.
2.9 the new expression study of gene in intestinal bacteria
2.9.1 the structure of expression vector
Utilize high-fidelity DNA polymerase amplification gene full length fragment; Reclaiming the back is connected with the flat end that expression vector pEB cuts generation through the Ecl136II enzyme; Transformed into escherichia coli competence JM109 carries out PCR with vector expression district forward primer pEBF and full-length gene reverse primer and identifies, filters out positive transformant in the right direction; Extract plasmid, carry out enzyme and cut evaluation.Identify that correct positive transformant extracts plasmid, transformed into escherichia coli Rosetta (DE3) bacterial strain., bacterium colony PCR, enzyme carry out induction expression of protein after cutting evaluation correctly.
2.9.2 the new abduction delivering of gene in intestinal bacteria
1) the single bacterium colony of picking E.coli is in the 5mlLB liquid nutrient medium, 37 ℃, 220rpm activation 12h;
2) be inoculated in the 200mL liquid LB substratum by 1% inoculum size, 37 ℃, about 2 hours of 220rpm shaking culture is to OD
600=0.6;
3) add 100 μ L 1M IPTG to final concentration be 0.5mM;
4) 18 ℃, the 150rpm shaking culture, cold temperature induced protein is expressed.
5) the centrifugal 10min of 8000rpm collects thalline, is suspended in 20mL 20mmol/L Tris-HCl (pH 8.0) damping fluid;
6) ultrasonication thalline 10min;
7) 4 ℃, the centrifugal 20min of 12000rpm collects supernatant and deposition respectively;
8) deposition goes up cleer and peaceful precipitation and does not carry out the SDS-PAGE electrophoresis detection with 20mmol/L Tris-HCl (pH 8.0) dissolving.
2.9.3 the SDS-PAGE of expressing protein detects
Table 2-3 is seen in the polyacrylamide gel configuration.
Electrophoresis: get the 20uL sample and add appearance buffer on the 10uL 3x, boiling water boils 10min, and 12000rpm is centrifugal, gets appearance on the 5 μ L supernatants, 80V prerunning 10min, 120V constant voltage electrophoresis 1h.
Dyeing: carefully take off gel behind the electrophoresis, add 50mL SI microwave oven heating 30s, outwell behind the 60rpm vibration 10min, add the SII that 50mL contains 200 μ L SIII, microwave oven heating 30s, the 60rpm 1h that vibrates.
The preparation of table 2-3SDS polyacrylamide gel
2.10 new gene does not have the expression in the crystal mutant strain at Tribactur
2.10.1PCR primer and sequence
According to known new full length gene sequence, it is right to have designed among the table 2-4 primer, and wherein S8like15/S8E3 primer two ends are introduced SacI, SalI restriction enzyme site respectively, from the HBF-18 wild strain, carry out the amplification of cry8like1 gene.The cry8like2 gene increases from the coli expression carrier pEB-cry8like2 that makes up.
Table 2-4 primer and sequence
2.10.2DNA the same 2.8.3 of recovery
2.10.3 enzyme is cut system
1) pSTK carrier enzyme is cut system
Cut system 50 μ L according to following standard preparation enzyme, 37 ℃ of insulation 1h.
Utilize 0.7% agarose to carry out the electrophoresis detection analysis, voltage 6V/ centimetre, 1 * TAE, electrophoresis 1h.
2) PCR product enzyme is cut system:
Cut system 30 μ L according to following standard preparation enzyme, 37 ℃ of insulation 1h.
Utilize 2.0% agarose to carry out the electrophoresis detection analysis, voltage 6V/ centimetre, 1 * TAE, electrophoresis 1h.
2.10.4 ligation
Same 2.2.8.5
2.10.5 colibacillary heat shock transforms same 2.2.8.7
2.10.6Bt the preparation of electric shock competent cell transforms with electric shock
1) the single bacterium colony of picking Bt is in the LB of 5ml liquid nutrient medium, and 30 ℃, the 230rpm shaking culture is spent the night;
2) transfer in the BH of 100ml liquid nutrient medium by 1% inoculum size, 30 ℃, 230rpm cultivates about 4h to OD
600=2.0;
3) 4 ℃, 8, the centrifugal 10min of 000rpm collects thalline;
4) abandon supernatant, unnecessary liquid is done in control.The ultrapure water rinsing of adding 5-10mL precooling is once noted not hanging thalline;
5) the sterilization ultrapure water of adding 100mL hangs thalline;
6) 4 ℃, 8,000rpm, the centrifugal collection thalline of 8min, unnecessary liquid is done in control;
7) add 40% PEG suspension cell of 1ml precooling, and be distributed into the aliquot of 100 μ L/1.5mL centrifuge tubes, in-70 ℃ of preservations.
Electric shock transforms: in 100 μ L competent cells, add 1 μ g DNA, mixing places the electric shock cup of 0 ℃ of ice bath; Shock parameters is provided with: 2200V, 1000 Ω, 25 μ F; Change after the electric shock in 1.5ml Ep pipe, add the LB liquid nutrient medium of 800 μ L, 30 ℃ of incubators are cultivated 2h; Get the LB solid plate that 200 μ L coating contains kantlex, 30 ℃ of overnight cultures;
2.10.7 the structure of Tribactur expression vector
With the total length PCR product of introducing restriction enzyme site and shuttle expression carrier pSTK with SacI, SalI double digestion; Connect back transformed into escherichia coli JM109 competent cell; Order-checking after bacterium colony PCR, enzyme are cut evaluation correctly; The correct back of order-checking is extracted plasmid and is changed intestinal bacteria SCS110 competence demethylation again over to, and the plasmid that extracts demethylation at last changes the Bt competent cell over to.
2.10.8 the screening of positive transformant
With aseptic toothpick hickie is transferred to new flat board, numbering also inserts the LB test tube, 5 hickies of every pipe inoculation; Cultivated 8 hours, and got 300 μ l medium centrifugals, 200 μ l ultrapure water suspension thalline for 37 ℃; 100 ℃ were boiled 10 minutes, and the centrifuging and taking supernatant carries out PCR with corresponding primers designed and detects as pcr template; With the positive contrast of starting strain plasmid, screening positive clone.And through SDS-PAGE evaluation positive recombinant.
2.10.9 crystal habit is observed
The Bt inoculation is cultivated about 48h for 30 ℃ in the 1/2LB substratum, on slide glass, drip 5 μ l aqua sterilisas; A little thalline of picking is coated with in water evenly, and oven dry is fixing, with 10 μ l carbolfuchsin dye liquors dyeing 5min; The flushing with clean water excess dyestuff is dripped cedar oil, and 100 times of oily mirrors carry out microscopy.After microscopic examination brood cell crystal discharges, scrape and get culture with distilling washing 3-4 time, be suspended in the 1mL sterilized water, the brilliant drop that mixes of spore is on deckglass, and coating is even, drying, and ion sputtering metal spraying (2nm), scanning electron microscopic observation is taken pictures.Electronic Speculum (HITACHI S-4800) is analyzed by Institute of Botany, Chinese Academy of Sciences sample shop and is accomplished.
2.10.10Cry proteic process for extracting
1) the single bacterium colony of picking Bt contains in the LB liquid nutrient medium of corresponding resistant in 5mL, and 30 ℃, 230rpm activation 12h;
2) be transferred in the 200ml beef-protein medium by 1% the bacterium amount of connecing, 30 ℃, 230rpm cultivates about 36h, and microscopy stops cultivation when observing the cellular lysate 50% or more;
3) with fermented liquid in 4 ℃, the centrifugal 10min of 8000rpm abandons supernatant.
4) deposition is with the 1M NaCl washing of precooling, and 4 ℃, behind the centrifugal 10min of 8000rpm, the sterilized water with precooling washs one time again;
5) every 1l bacterium liquid precipitate is suspended from 50ml lysate (time spent adds 3% beta-mercaptoethanol pH 9.6), with NaOH pH is transferred to 9.5~10, shakes 4-12h on ice;
6) 4 ℃, the centrifugal 15min of 12000rpm gets supernatant, adds the 3M NaAc-HAc damping fluid of 1/7 volume pH 4.5, transfers pH 4.5~5.0;
7) 4 ℃ of deposition 4h (precipitating 1-4h on ice);
8) 4 ℃, the centrifugal 15min of 12000rpm, deposition is washed 2 times with the sterilized water of precooling, uses 50mM Na
2CO
3(pH 9.6) dissolution precipitation.
2.10.11 proteic SDS-PAGE detects same 2.9.3
2.11Bt the mensuration of bacterial strain insecticidal activity
1) to the indoor insecticidal activity assay of small cabbage moth (P.xylostella)
By pre-designed concentration, 50mM Na is used in the sterilized water dilution with bacterial strain to be measured
2CO
3(pH9.6) as negative control.Take by weighing the 6g feed in the 60mm petridish, corresponding protein solution is added wherein, push evenly, protein solution and feed are mixed; Feed is divided in 3 petridish, and every ware connects 30 of worms (each handles 30 cephalonts, three repetitions), worm age in days in ages 2~3.Put into 25 ℃ of illumination boxs and cultivate, cultivate dead, the borer population of living of 48h " Invest, Then Investigate ", and observe the larval feeding situation.
2) biological activity determination of Holotrichia parallela (H.parallela), black greatly gill cockchafer (H.oblita) and anomala corpulenta
Inoculation is cultivated on the LB solid medium, after producing to crystal, scrapes and gets thalline and be suspended in 10mL sterilization ddH
2Among the O, according to 2 times of differential gradient concentration dilutions of geometric ratio, bacterium liquid soaks even thickness potato silk with bacteria suspension; Residue bacterium liquid stirs with the sterilization fine earth, treat the potato silk dry after with potato silk and native mixing, with healthy, the individual anomala corpulenta larva uniformly of 5-7 age in days and Holotrichia parallela larva as supplying to try the worm kind; Be inoculated in 6 orifice plates, every hole connects 1 of worm, and each processing connects 30 of worms; Repeat twice, as blank, in 25 ℃ of growth cabinets, raise with the processing that adds clear water; In 7 days, 14 days inspection life or death borer populations, calculation correction mortality ratio and LC
50
2.12 data analysis is handled
" POLO " program of employing is calculated mortality ratio, corrected mortality, LC
50With 95% fiducial interval.Collaborative toxicity index adopts equation to calculate (B E Tabashnik, 1993).Collaborative toxicity index: with LC
50Value is estimated the mixture co-toxicity.The LC that expects with the computes mixture earlier
50Value.
With the mixture expection LC that calculates
50Value and the LC that surveys
50Value compares, if two values equate that show that symbolic animal of the birth year adds effect, the former belongs to antagonistic action less than the latter; Belong to synergism greater than the latter.Because the discordance that testing error and confession examination biology etc. are not awared it is generally acknowledged expection LC
50Actual measurement LC
50Virulence ratio symbolic animal of the birth year between 0.5-2.6 add effect, belong to synergisms greater than 2.6, less than belonging to antagonistic action at 0.5 o'clock.
SAS 9.2 software GLM processes are selected in gene and concentration difference test of significance for use, and multiple comparisons is selected Fisher ' LSD method for use, and fixed model is: y=μ+Gi+Cj+eijk, and wherein, y is that phenotypic number is a corrected mortality; μ is whole average; Gi is a genetic effect; Cj is a concentration effect; Eijk is the random error effect.
3 conclusions
3.1 obtain new insecticidal protein gene sequence
Through BlastX and BlastP comparison, finally obtained following gene order (table 3.1)
The new killing gene sequence of table 3-1
3.2 sequential analysis
Utilize software Vector NTI Suite 9 (Invitrogen, Carlsbad, CA, USA) and the online software of Weblab cry8like1 and two terminal sequences thereof are analyzed result such as Fig. 1.
3.2.1cry8like1 gene sequencing
The cry8like1 sequential analysis is following:
SigA
1 CCAGCTA
TTG?ATATCTTGCA?AGAGATACAT?ATACTTACTT?TGAGTTCTAT?TAGTGCTTTT
SigD
61 AACTTAAATA?ACTGTATATG?
TATTATTCTT?AACAAATCCC?GATATATTTT?CCCCAGTTGC
………………………………………………………………………………………………………
SigE
491 ATGTATTG
AA?ATAAAAATAT?GAGCGTTCCA?TAAATTTGCT?TGTCGCGCGT?GTTCTGAAAG
SigA
551 TTCTACATAA?ACATCTGACA?CTC
TTGACAT?TTTTACATCA?AAATTATATT?TTCTTAGATT
……………………………………………………………………………………………………...
SigA
831 T
TTGGCTCAA?AAATTAGAGA?TATACTTTGC?TTATAAACGA?AGGGAGGATG?TATTCATAGA
RBS
911 TAATGACTTA?TATGAAAAGA?AAAGCAGAAT?TTACGAAAAA?AACTTAT
AGG?AGGAATCAAC
971
ATGAATTCAA?ATAATCAAAA?TGAATATAAT?GCTTCATCTA?CTACATCCGT?ACCCAATTAT
……………………………………………………………………………………………………..
325 1TTATGGGATG?CAGCAAAAGA?GGCAAAACGC?CTCATTCAGG?TTCGTAACTC?C
ATTTAAAAT
……………………………………………………………………………………………………..
Inverted?repeat
3781 AAATC
ATAAT?AGAAAAGTAC?AGACTTTCAA?TTGATTAAGG?ACCTGTACTT?TTTTATTATC
……………………………………………………………………………………………………..
Inverted?repeat
4631 CATAAAAAAC?CT
AAAATAAA?AGCTCCTAAC?ACATTATATA?TGACTAATAA?GTTAGGAGCT
4691
TTTATTTTTT?GTTAATGCGT?TTTGAAACTA?AATTTGATTA?GTGTTTTTCT?CTATTTTGGT
……………………………………………………………………………………………………...
Cry8like1BlastP result is as shown in Figure 2.The result shows that at the cry8like1 upstream region of gene, the ORF1 downstream exist SigA, SigD, SigE transcription factor and RBS sequence; In cry8like1 gene downstream, there are two inverted repeats in the ORF3 upper reaches.
Cry8like1 is carried out the BlastP analytical results show that it is the cry8 genoid of one and half length, but comprise three structural domains of cry gene, but C-terminal lacks the sequence of one section about 1.4kb.
3.2.2 the new transcription analysis of gene in the HBF-18 bacterial strain
Adopt Trizol one step extraction method to extract the RNA of HBF 18 bacterial strains, genomic dna residual among the RNA is removed with the DNase I processing of RNase-free.Carry out the amplification of RT-PCR through two-step approach, amplified production separates (see figure 3) on 1.5% sepharose.The result shows that the RNA sample of the HBF-18 bacterial strain of each incubation time can both amplify the purpose band onesize with the cry8like1 positive control; And the RNA sample that does not carry out reverse transcription can not amplify the purpose band as negative control, shows that the band that pcr amplification goes out is not because the pollution of DNA causes.Therefore, this result of experiment shows that the cry8like1 gene can be transcribed out corresponding mRNA normally in HBF 18 bacterial strains, shows that candidate gene expresses in wild strain.
3.3 new clone and the expression of gene in intestinal bacteria
3.3.1 the pcr amplification of new gene
The total length expressed primer that utilizes design is template to cry8like1F/cry8like1R with HBF 18 genomic dnas, utilizes high-fidelity DNA polymerase to amplify the cry8like1 gene (Fig. 4) of 2214bp.
Because the HBF-18cry8like1 sequence of being cloned into is the sequence of one and half length; Through finding behind the compare of analysis that its 2143-2169 bit base and the cry8Ea1 gene order of not having the fine expression of ability among the crystal mutant strain HD73 at Tribactur have high similarity (as follows); Still consider to use 8like15 ' terminal sequence and cry8Ea 3 ' terminal sequence to carry out overlapping PCR, obtain the cry8 sequence of a total length.
CCAAATGAAAAACGGTTGTTATGGGATGCAGCAAAAGAGGCAAAACGCCTCA
||||||||||||||?|||||||?|||||||?|||||||||?||||
CCAAATGAAAAACGCTTGTTATTTGATGCAGTGAAAGAGGCAAAACGACTCA
In order to obtain the full-length gene of cry8like1; We have carried out overlapping PCR; At first utilize primer that cry8like1F/ is exchanged R and exchanges F/cry8EaR; Be template with the plasmid that contains cry8like1 and cry8Ea gene respectively, amplify 5 ' terminal sequence of cry8like1 gene and the 3 ' terminal sequence of cry8Ea respectively.(Fig. 5)
Be primer with primer to cry8like1F/cry8EaR in the amplified reaction subsequently, the cry8like1N end that amplifies is template with the cry8EaC end, through the extension of overlapping chain former and later two fragments is recombinated.Obtain the total length cry8 gene of about 3.5kb, called after cry8like2 (Fig. 6).
3.3.2 the structure of new gene heterogenous expression carrier
Ecl136II site with being inserted into the expression cassette of pEB after the above-mentioned full-length gene recovery of increasing respectively obtains each expression carrier, and expression vector establishment is seen Fig. 7.Transformed into escherichia coli JM109 competent cell carries out PCR with vector expression district forward primer pEBF and full-length gene reverse primer and identifies, filters out positive transformant in the right direction (Fig. 8).Positive colony is seeded in the LB substratum, and 37 ℃, the 230rpm overnight cultures is extracted plasmid, and enzyme is cut and identified correct back (Fig. 9), and positive colony is confirmed in order-checking.Transformed into escherichia coli Rosetta competent cell.Abduction delivering after PCR, enzyme are cut evaluation correctly.
3.3.3 the new expression of gene in intestinal bacteria
With recombinant plasmid transformed intestinal bacteria Rosetta (DE3) bacterial strain; The proteic SDS-PAGE electrophoresis result of IPTG abduction delivering finds to change over to Rosetta (DE3) bacterial strain of recombinant plasmid; Cry8like1 expresses the albumen (Figure 10) of about 80kD in soluble component, consistent with the albumen size of deriving.Change the negative contrast of Rosetta (DE3) bacterial strain over to empty plasmid pEB, the 80kDa albumen (see figure 10) of in solubility component and insolubility component, all find expressing, above presentation of results in intestinal bacteria successful expression above-mentioned albumen.
3.4 new gene does not have the cloning and expression in the crystal mutant strain at Tribactur
3.4.1 the new clone of gene in intestinal bacteria
Utilize designed primer that S8like15/S8E3 is introduced SacI, SalI restriction enzyme site respectively at the gene two ends; Prepare for making up its shuttle expression carrier respectively; With plasmid pEB8like2 is template, uses high-fidelity DNA polymerase, has amplified the cry8like2 gene (Figure 11) of 3528bp.
With Sac I, Sa1I double digestion total length PCR product and shuttle expression carrier pSTK (Figure 12), full-length gene is cloned into this carrier, the vector construction flow process is seen Figure 13; Positive colony is identified; Pcr amplification obtains the cry8like2 fragment (Figure 14) of about 3.5kb, and Sac I and Sa1I double digestion plasmid obtain the cry8like2 target gene fragment (Figure 15) of empty carrier and the 3.5kb of 8.5kb; Show that vector construction is correct, this plasmid called after pSTK8like2.
Extract the pSTK8like2 plasmid, behind the transformed into escherichia coli SCS110 bacterial strain demethylation, electric shock transforms Bt does not have crystal mutant strain HD-73-, identifies the positive transformant called after HD8like2 that obtains through PCR.
3.4.2Cry proteic extraction and detection
Extract the albumen of cry8like2 and carry out SDS-PAGE (gum concentration is 10%); Can be observed the albumen (showing) that HD8like2 can produce 133kDa like Figure 16; And do not have the proteic generation of no 133kDa in the crystal mutant strain, explain the cry8like2 gene can be in reorganization Bt bacterial strain normal expression.
3.5 the sequence and the analysis of new gene
The positive colony that will contain different recombinant plasmids has carried out the mensuration of nucleotide sequence, has obtained the nucleotide sequence of new gene, and infers its aminoacid sequence.
Clone's new gene cry8like1 size is 2214bp, sees SEQ ID NO1, and albumen is made up of 738 amino acid and is seen SEQ ID NO3, and molecular weight is 83.8kD.It is respectively leucine (8.54%) from high to low that this proteic amino acid is formed content; Threonine (8.40%), Serine (7.99%), l-asparagine (7.86%); Xie Ansuan (6.23%); Isoleucine (6.10%), L-Ala (5.96%) and tyrosine (5.96%), glycocoll (5.56%) (seeing table 3-2); This albumen iso-electric point is pH7.47, is slightly acidic albumen, shown in table 3-2.Amino acid sequence similarity is analyzed, and shows and Cry8Db protein similar property 51% that explanation is the cry8 genoid of a kind of novel (holotype), is the new gene of the 2nd grade.
The proteic amino acid composition analysis of table 3-2Cry8like1
Clone's new gene cry8like2 size is seen SEQ ID NO2 for 3528bp, and albumen is made up of 1176 amino acid and is seen SEQ ID NO4, and molecular weight is 133.6kD.It is respectively Threonine (8.33%) from high to low that this proteic amino acid is formed content, leucine (8.25%), l-asparagine (7.91%); Serine (6.89%), Xie Ansuan (6.63%), L-glutamic acid (6.55%); Glycocoll (6.38%), tyrosine (5.87%) (seeing table 3-2); This albumen iso-electric point is pH5.02, is slightly acidic albumen, shown in table 3-3.Amino acid sequence similarity is analyzed, and shows and Cry8Ea1 protein similar property 66% that explanation is the cry8 genoid of a kind of novel (holotype), is the new gene of the 2nd grade.
The proteic amino acid composition analysis of table 3-3Cry8like2
3.6Bt bacterial strain insecticidal activity assay result
3.6.1Cry8 to anomala corpulenta biological activity primary dcreening operation result
Table 3-4HD8like2 is to anomala corpulenta insecticidal activity primary dcreening operation
Can be known by table 34, be 1*10 in concentration
10The time, HD8 like2 reaches 96.5% to anomala corpulenta larva corrected mortality, and HD8like2 has insecticidal activity preferably to anomala corpulenta.
3.6.2Cry8l ike2 is to small cabbage moth biological activity primary dcreening operation result
Table 3-5Cry8 like2 is to small cabbage moth insecticidal activity primary dcreening operation
Shown in table 3-5, when protein concentration reached 100ppm, the mortality ratio of small cabbage moth was 0 to the biological activity primary dcreening operation result of small cabbage moth, and growing state with contrast similarly, explain that Cry8like2 does not have insecticidal activity to small cabbage moth, do not have the body weight restraining effect yet.
3.6.3 different strains and combination are to Holotrichia parallela biological activity determination result and analysis
3.6.3.1 biological activity determination result
Table 3-6 bacterial strain HBF-18 biological activity determination result
Table 3-9 strain HD 8G biological activity determination result
Table 3-10 strain HD 8like2 biological activity determination result
Table 3-12 strain HD 8G-HD8like2 biological activity determination result
3.6.3.2 collaborative virulence evaluation
Collaborative toxicity index: with LC
50Value is estimated the mixture co-toxicity.
Collaborative toxicity index=test gained LC
50/ expection LC
50* 100
Because the discordance that testing error and confession examination biology etc. are not awared.It is generally acknowledged expection LC
50Actual measurement LC
50Virulence ratio symbolic animal of the birth year between 0.5-2.6 add effect, belong to synergisms greater than 2.6, less than belonging to antagonistic action at 0.5 o'clock.(Finney,D.J.,Fd.(1952).Probit?Analysis.)
Table 3-14 various combination insecticidal effect table
Can find out expection LC in combination back between HD8G and the Cry8 like2 by table 3-15
50With actual measurement LC
50Virulence ratio symbolic animal of the birth year between 0.5-2.6 add effect.
In order to check the synergism effect between HD8G and the HD8like2; Select for use SAS 9.2 software GLM processes that gene and concentration are carried out significance test of difference, multiple comparisons is selected Fisher ' LSD method for use, and fixed model is: y=μ+Gi+Cj+eijk; Wherein, y is that phenotypic number is a corrected mortality; μ is whole average; Gi is a genetic effect; Cj is a concentration effect; Eijk is the random error effect.
Table 3-15 average and standard deviation
The result sees shown in Figure 17.
Bacterial strain HBF-18 is best to the insecticidal effect of Holotrichia parallela, and significant difference between the combination of HD8G bacterial strain, HD8like2 bacterial strain and HD8G and HD8like2.
Can draw as drawing a conclusion by giving birth to the survey result:
1.Cry8like2 anomala corpulenta and Holotrichia parallela are had insecticidal activity, small cabbage moth are not had insecticidal activity.And insecticidal activity and HBF-18 difference to Holotrichia parallela reach utmost point level of signification, belong to summation action with the HD8G combination.
2.HD8G and HD8like2 can be used for the biological control to Holotrichia parallela jointly to there not being antagonistic action between the Holotrichia parallela.Along with the big area promotion and application of Bt preparation and trans Bt gene crops, insect can produce resistance to the Bt insecticidal crystal protein under the selective pressure that continues, and two kinds of crystallin actings in conjunction can prevent the generation of resistance, solve resistance problem.
Claims (11)
1.Cry 8like1 albumen, it has the aminoacid sequence shown in the SEQ ID NO3.
2. according to the said albumen of claim 1, be Cry8like2 albumen, its aminoacid sequence is shown in SEQ ID NO4.
3. the coding described Cry 8like1 of claim 1 proteic gene, it has nucleotide sequence shown in SEQ ID NO1.
4. the coding described Cry8like2 of claim 2 proteic gene, its nucleotide sequence is shown in SEQ ID NO2.
5. a carrier contains claim 3 or 4 described genes.
6. according to the said carrier of claim 5, be pSTK 8like2, its structure as shown in Figure 13.
7. a protein composition is made up of Cry8like2 albumen and Cry8Ga1 albumen.
8. said albumen of claim 2 or the application of the described protein composition of claim 7 in anti-coleopteran pest.
9. said according to Claim 8 application is albumen or protein composition to be processed sterilant be used to kill coleopteran pest.
10. the said application of said according to Claim 8 application is in the gene transferred plant or mikrobe with proteins encoded, makes it express the characteristic of anti-coleopteran pest.
11. arbitrary according to Claim 8-10 said application, said coleopteran pest is a grub.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201210119831 CN102659933B (en) | 2012-04-21 | 2012-04-21 | Bacillus thuringiensis gene cry8like and cry8G combination and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN 201210119831 CN102659933B (en) | 2012-04-21 | 2012-04-21 | Bacillus thuringiensis gene cry8like and cry8G combination and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN102659933A true CN102659933A (en) | 2012-09-12 |
CN102659933B CN102659933B (en) | 2013-12-25 |
Family
ID=46769539
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN 201210119831 Active CN102659933B (en) | 2012-04-21 | 2012-04-21 | Bacillus thuringiensis gene cry8like and cry8G combination and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102659933B (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103266078A (en) * | 2013-05-31 | 2013-08-28 | 中国农业科学院植物保护研究所 | Bacillus thuringiensis engineering bacteria and application thereof |
CN103333230A (en) * | 2013-07-09 | 2013-10-02 | 福建农林大学 | Bacillus thuringiensis gene cry1Da3 and applications thereof |
WO2020047704A1 (en) * | 2018-09-03 | 2020-03-12 | Syngenta Participations Ag | Compositions and methods for controlling plant pests |
CN111996152A (en) * | 2020-09-17 | 2020-11-27 | 中国农业科学院植物保护研究所 | Enterobacter strain with insecticidal activity on Holotrichia parallela |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1609191A (en) * | 2004-11-16 | 2005-04-27 | 中国农业科学院植物保护研究所 | Bacillus thringiensis strain and gene with high effect on coleoptera pests |
CN101113424A (en) * | 2007-07-04 | 2008-01-30 | 中国农业科学院植物保护研究所 | Coleoptera pest efficient Bacillus thuringiensis cry8G gene, protein and uses thereof |
CN102633884A (en) * | 2012-04-21 | 2012-08-15 | 中国农业科学院植物保护研究所 | Bacillus thuringiensis vip1like1/vip2like1 gene combination and application thereof |
-
2012
- 2012-04-21 CN CN 201210119831 patent/CN102659933B/en active Active
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1609191A (en) * | 2004-11-16 | 2005-04-27 | 中国农业科学院植物保护研究所 | Bacillus thringiensis strain and gene with high effect on coleoptera pests |
CN101113424A (en) * | 2007-07-04 | 2008-01-30 | 中国农业科学院植物保护研究所 | Coleoptera pest efficient Bacillus thuringiensis cry8G gene, protein and uses thereof |
CN102633884A (en) * | 2012-04-21 | 2012-08-15 | 中国农业科学院植物保护研究所 | Bacillus thuringiensis vip1like1/vip2like1 gene combination and application thereof |
Non-Patent Citations (1)
Title |
---|
张彦蕊: "苏云金芽胞杆菌HBF_18菌株毒力相关基因的克隆与活性研究", 《中国农业科学院学位论文》 * |
Cited By (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN103266078A (en) * | 2013-05-31 | 2013-08-28 | 中国农业科学院植物保护研究所 | Bacillus thuringiensis engineering bacteria and application thereof |
CN103266078B (en) * | 2013-05-31 | 2014-12-10 | 中国农业科学院植物保护研究所 | Bacillus thuringiensis engineering bacteria and application thereof |
CN103333230A (en) * | 2013-07-09 | 2013-10-02 | 福建农林大学 | Bacillus thuringiensis gene cry1Da3 and applications thereof |
CN103333230B (en) * | 2013-07-09 | 2016-02-17 | 福建农林大学 | Bacillus thuringiensis Genes cry1Da3 and application thereof |
WO2020047704A1 (en) * | 2018-09-03 | 2020-03-12 | Syngenta Participations Ag | Compositions and methods for controlling plant pests |
CN111996152A (en) * | 2020-09-17 | 2020-11-27 | 中国农业科学院植物保护研究所 | Enterobacter strain with insecticidal activity on Holotrichia parallela |
CN111996152B (en) * | 2020-09-17 | 2022-04-08 | 中国农业科学院植物保护研究所 | Enterobacter strain with insecticidal activity on Holotrichia parallela |
Also Published As
Publication number | Publication date |
---|---|
CN102659933B (en) | 2013-12-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN109825457B (en) | Salt-tolerant bacillus E40207a2 and application thereof | |
CN113604490B (en) | Kiwi fruit canker susceptibility gene AcBXL1 and application thereof | |
CN108164588A (en) | Application of the cotton transport protein GhBASS5 genes in plant salt tolerance | |
US20220369648A1 (en) | Endophytic falciphora oryzae fo-r20 and its application | |
CN107475210A (en) | A kind of Bacterial Blight Resistance in Rice related gene OsABA2 and its application | |
Sohrab et al. | Characterization of Tomato Leaf Curl New Delhi Virus infecting cucurbits: Evidence for sap transmission in a host specific manner | |
CN104099367A (en) | Method for culturing transgenic insect-resistant paddy rice | |
CN102659933B (en) | Bacillus thuringiensis gene cry8like and cry8G combination and application thereof | |
CN110468150B (en) | Application of RGS1 gene as negative regulatory factor in improving tomato bacterial leaf spot resistance in low-irradiation environment | |
CN109021084A (en) | Trifoliate orange Cold resistant genes PtrERF109 and its application in plant cold resistance genetic improvement | |
CN105296625A (en) | Molecular marker primer for aided identification of red pepper gray mold resistance and application of molecular marker primer | |
CN105274122B (en) | The RNAi expression vector and its construction method of diamondback moth TOR gene and application | |
CN112522291B (en) | Rice OsSH3P2 gene and application thereof | |
Kaushik et al. | Selection of Tn5:: lacZ mutants isogenic to wild type Azospirillum brasilense strains capable of growing at sub-optimal temperature | |
CN109266647A (en) | Rice-stem borer is caused harm inducible promoter and its application | |
CN116425847B (en) | Rice OsGLP8-10 for inhibiting sclerotinia and application thereof | |
CN110172424B (en) | Bacillus methylotrophicus and application thereof in preventing and controlling root-knot nematodes | |
CN102633884B (en) | Bacillus thuringiensis vip1like1/vip2like1 gene combination and application thereof | |
CN110004155B (en) | Disease-resistant gene and protein for controlling plant aversion and aphid resistance characters and application thereof | |
CN108103042B (en) | Anti-verticillium wilt related receptor-like protein kinase GhPR5K, coding gene thereof and application thereof | |
CN114989273B (en) | Gene PlMYB1R and application thereof in preventing and treating downy mildew of litchi | |
CN116284286A (en) | Wheat stripe rust fungus sugar transport protein, gene and application thereof | |
CN113621620B (en) | Gene with function of regulating and controlling immunity of plutella xylostella and preparation method and application thereof | |
CN109456969A (en) | Brown Planthopper is caused harm inducible promoter and its application | |
CN112852862B (en) | Application of arabidopsis small peptide signal molecule RGF7 gene |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20120912 Assignee: Origin Agritech Limited Assignor: Institute of Plant Protection, Chinese Academy of Agricultural Sciences Contract record no.: 2016990000342 Denomination of invention: Bacillus thuringiensis gene cry8like and cry8G combination and application thereof Granted publication date: 20131225 License type: Common License Record date: 20160817 |
|
LICC | Enforcement, change and cancellation of record of contracts on the licence for exploitation of a patent or utility model |