CN114292923B - Genetic marker of 191 human micro-haplotype loci, amplification primer and application thereof - Google Patents

Abstract

The invention relates to the technical field of forensic genetics identification, and specifically discloses a genetic marker of 191 human micro-haplotype loci, an amplification primer and application thereof. The 191 human micro-haplotype locus genetic markers provided by the present invention combine the advantages of STR and SNP, and have the advantages of short amplified fragments, low mutation rate, good polymorphism and no stutter peaks. Utilizing the 191 human micro-haplotype loci genetic markers provided by the present invention to carry out kinship identification can independently solve the second-level kinship identification between two individuals, and only two levels of kinship between grandparents, nephews, or nephews are satisfied. Human beings are involved in the identification requirements, and the identification system has high performance, good repeatability, high sensitivity and stability. And in forensic identification, it has significant anti-degradation ability, and has extremely high application value in actual forensic prosecution.

Description

191 human microhaplotype loci genetic markers and their amplification primers and applications

Technical Field

The present invention relates to the technical field of forensic genetic identification, and in particular to 191 human microhaploid locus genetic markers and amplification primers and applications thereof.

Background Art

Short tandem repeats (STR) and single nucleotide polymorphisms (SNP) are commonly used genetic markers in forensic medicine. STR has become the mainstream genetic marker for individual identification and kinship identification due to its high polymorphism and wide distribution, and plays an irreplaceable role in actual case inspections. Compared with STR, SNP has a low mutation rate and short amplification fragment. It can also provide ancestral information and predict individual phenotypic characteristics. It has advantages in the analysis of degraded samples and the inference of geographical ancestry. Although both STR and SNP have played an important role in judicial practice, they still have great limitations and cannot fully meet the requirements of forensic medicine. For example, the fragment length of highly degraded samples is less than 100bp, while the fragment length range of existing kits STR is mostly 100bp to 450bp; for ultra-trace samples with very little DNA template, stutter peaks often appear during STR amplification due to replication slippage, and capillary electrophoresis (CE) cannot distinguish alleles from stutters; and when using STR to analyze mixed samples, it is easily affected by stutter peaks and the mixing ratio of samples, resulting in uncertainty. For SNPs, most SNPs are di-alleles, and single SNPs have low polymorphism and insufficient information. Therefore, in order to achieve similar performance to STR, the number of detection sites needs to be increased. However, too many complex sites may affect the balance of amplification efficiency between loci, resulting in allele loss.

Kinship identification is one of the two major tasks of forensic evidence. At present, there are corresponding identification specifications for grandparent-grandchild identification, full sibling identification and paternity testing (Technical Specifications for Parentage Identification GB/T37223-2018, Technical Specifications for Biological Full Sibling Relationship Identification SF/T 0117-2021; Specifications for Biological Grandparent-Grandchild Relationship Identification SF/Z JD0105005-2015) that can be used as reference for practical applications. Grandparent-grandchild identification has strict requirements for the persons involved in the identification, that is, grandparents, children and the child’s biological mother are required to participate in the identification at the same time, and none of them can be missing. Full sibling identification can only distinguish between full siblings with the same father and mother and unrelated individuals, while paternity testing requires at least one of the child’s parents to participate in the identification. For the above identification contents with standardized references, daily commercial test kits can meet the needs. However, in actual case investigations, it is often encountered that the child's parents have passed away or are unable to participate in the identification, and there is a need to identify the relationship between grandparents and grandchildren (only grandfather and grandson are involved in the identification), half-sibling identification, uncle-nephew identification, aunt-nephew identification, and aunt-nephew identification. This type of identification belongs to the second-level kinship identification, which is one of the difficulties in current forensic research.

Summary of the invention

In view of the above-mentioned problems existing in the existing forensic genetic identification methods, the present invention provides 191 human microhaplotype loci genetic markers and amplification primers and applications thereof. The 191 human microhaplotype loci genetic markers are used in forensic genetic identification, which can not only meet the needs of daily forensic case investigation, but also independently solve the second-level kinship identification between two individuals, and have extremely high accuracy, sensitivity and stability.

In order to achieve the above-mentioned object of the invention, the embodiment of the present invention adopts the following technical solution:

A set of 191 human microhaplotype loci genetic markers, including the following 191 human microhaplotype loci:

Compared with the prior art, the 191 human micro-haplotype loci genetic markers provided by the present invention are multiple linked SNPs, which combine the advantages of STR and SNP, and have the advantages of short amplified fragments, low mutation rate, good polymorphism, and no stutter peak. In practical applications, the 191 human micro-haplotype loci genetic markers provided by the present invention can be used for individual identification and identification, and can also be used for kinship identification, including being able to independently solve the second-level kinship identification between two individuals, meeting the needs of only two people participating in the identification, such as grandfather and grandson, half-siblings, uncle and nephew, and aunt and nephew, and the system efficiency of the identification is extremely high, with good repeatability, extremely high sensitivity and stability. The 191 human micro-haplotype loci provided by the present invention are used for forensic identification, which has significant anti-degradation ability and has extremely high application value in actual forensic investigations.

The 191 human microhaplotype loci provided by the present invention conform to the Hardy-Weinberg equilibrium in the Hebei Han population and are in a linkage equilibrium state. They are independent of each other and can independently solve the problem of second-level kinship identification between two individuals.

The present invention also provides primers for amplifying the 191 human microhaplotype loci genetic markers, and the sequences of the primers are as follows:

1) SEQ ID NO.1-2; 2) SEQ ID NO.3-4; 3) SEQ ID NO.5-6; 4) SEQ ID NO.7-8; 5) SEQ ID NO.9-10; 6 )SEQ ID NO.11-12; 7) SEQ ID NO.13-14; 8) SEQ ID NO.15-16; 9) SEQ ID NO.17-18; 10) SEQ ID NO.19-20; 11) SEQ ID NO.21-22; 12) SEQ ID NO.23-24; 13) SEQ ID NO.25-26; 14) SEQ ID NO.27-28; 15) SEQ ID NO.29-30; 16) SEQ ID NO.31-32; 17) SEQ ID NO.33-34; 18) SEQ ID NO.35-36; 19) SEQ ID NO.37-38; 20) SEQ ID NO.39-40; 21) SEQ ID NO.41-42; 22) SEQ ID NO.43-44; 23) SEQ ID NO.45-46; 24) SEQ ID NO.47-48; 25) SEQ ID NO. 49-50; 26) SEQ ID NO.51-52; 27) SEQ ID NO.53-54; 28) SEQ ID NO.55-56; 29) SEQ ID NO.57-58; 30) SEQ ID NO.59 -60; 31) SEQ ID NO.61-62; 32) SEQ ID NO.63-64; 33) SEQ ID NO.65-66; 34) SEQ ID NO.67-68; 35) SEQ ID NO.69- 70; 36) SEQ ID NO. 71-72; 37) SEQ ID NO. 73-74; 38) SEQ ID NO. 75-76; 39) SEQ ID NO.77-78; 40) SEQ ID NO.79-80; 41) SEQ ID NO.81-82; 42) SEQ ID NO.83-84; 43) SEQ ID NO.85-86; 44) SEQ ID NO.87-88; 45) SEQ ID NO.89-90; 46) SEQ ID NO.91-92; 47) SEQ ID NO.93-94; 48) SEQ ID NO.95-96; 49) SEQ ID NO. 97-98; 50) SEQ ID NO. 99-100; 51) SEQ ID NO. 101-102; 52) SEQ ID NO. 103-104; 53) SEQ ID NO. 105-106; 54) SEQ ID NO. 107 -108;55)SEQ ID NO.109-110;56)SEQ ID NO.111-112; 57) SEQ ID NO.113-114; 58) SEQ ID NO.115-116; 59) SEQ ID NO.11-118; 60) SEQ ID NO.119-120; 61) SEQ ID NO .121-122; 62) SEQ ID NO.123-124; 63) SEQ ID NO.125-126; 64) SEQ ID NO.127-128; 65) SEQ ID NO.129-130; 66) SEQ ID NO .131-132; 67) SEQ ID NO.133-134; 68) SEQ ID NO.135-136; 69) SEQ ID NO.137-138; 70) SEQ ID NO.139-140; 71) SEQ ID NO. 141-142;72)SEQ ID NO.143-144; 73) SEQ ID NO.145-146; 74) SEQ ID NO.147-148; 75) SEQ ID NO.149-150; 76) SEQ ID NO.151-152; 77) SEQ ID NO.153-154; 78)SEQ ID NO.155-156; 79)SEQ ID NO.157-158; 80)SEQ ID NO.159-160; 81)SEQ ID NO.161-162; 82)SEQ IDNO .163-164; 83) SEQ ID NO.165-166; 84) SEQ ID NO.167-168; 85) SEQ ID NO.169-170; 86) SEQ ID NO.171-172; 87) SEQ ID NO .173-174;88)SEQ ID NO.175-176; 89)SEQ ID NO.177-178; 90)SEQ ID NO.179-180; 91)SEQ ID NO.181-182; 92)SEQ ID NO.183-184; 93)SEQ IDNO .185-186; 94) SEQ ID NO. 187-188; 95) SEQ ID NO. 189-190; 96) SEQ ID NO. 191-192; 97) SEQ ID NO. 193-194; 98) SEQ ID NO .195-196; 99) SEQ ID NO.197-198; 100) SEQ ID NO.199-200; 101) SEQ ID NO.201-202; 102) SEQ ID NO.203-204; 103) SEQ ID NO. 205-206;104)SEQ ID NO.207-208; 105) SEQ ID NO.209-210; 106) SEQ ID NO.211-212; 107) SEQ ID NO.213-214; 108) SEQ ID NO.215-216; 109) SEQ ID NO .217-218; 110) SEQ ID NO.219-220; 111) SEQ ID NO.221-222; 112) SEQ ID NO.223-224; 113) SEQ ID NO.225-226; 114) SEQ ID NO. 227-28; 115) SEQ ID NO. 229-230; 116) SEQ ID NO. 231-232; 117) SEQ ID NO. 233-234; 118) SEQ ID NO. 235-236; 119) SEQ ID NO.237-238; 120) SEQ ID NO.239-240; 121) SEQ ID NO.241-242; 122) SEQ ID NO.243-244; 123) SEQ ID NO.245-246; 124) SEQ ID NO .247-248; 125) SEQ ID NO. 249-250; 126) SEQ ID NO. 251-252; 127) SEQ ID NO. 253-254; 128) SEQ ID NO. 255-256; 129) SEQ ID NO. 257-258; 130) SEQ ID NO. 259-260; 131) SEQ ID NO. 261-262; 132) SEQ ID NO. 263-264; 133) SEQ ID NO. 265-266; 134) SEQ ID NO.267-268; 135) SEQ ID NO.269-270; 136) SEQ ID NO.271-272; 137) SEQ ID NO.273-274; 138) SEQ ID NO.275-276; 139) SEQ ID NO .277-278; 140) SEQ ID NO. 279-280; 141) SEQ ID NO. 281-282; 142) SEQ ID NO. 283-284; 143) SEQ ID NO. 285-286; 144) SEQ ID NO. 287-288; 145) SEQ ID NO. 289-290; 146) SEQ ID NO. 291-292; 147) SEQ ID NO. 293-294; 148) SEQ ID NO. 295-296; 149) SEQ ID NO.297-298; 150) SEQ ID NO.299-300; 151) SEQ ID NO.301-302; 152) SEQ ID NO.303-304; 153) SEQ ID NO.305-306; 154) SEQ ID NO.307-308; 155) SEQ ID NO.309-310; 156) SEQ ID NO.311-312; 157) SEQ ID NO.313-314; 158) SEQ ID NO.315-316; 159) SEQ ID NO .317-318; 160) SEQ ID NO. 319-320; 161) SEQ ID NO. 321-322; 162) SEQ ID NO. 323-324; 163) SEQ ID NO. 325-326; 164) SEQ ID NO.327-328; 165)SEQ ID NO.329-330; 166)SEQ ID NO.331-332; 167)SEQ ID NO.333-334; 168)SEQ ID NO.335-336; 169)SEQ ID NO.337-338; 170) SEQ ID NO.339-340; 171) SEQ ID NO.341-342; 172) SEQ ID NO.343-344; 173) SEQ ID NO.345-346; 174) SEQ ID NO .347-348; 175) SEQ ID NO. 349-350; 176) SEQ ID NO. 351-352; 177) SEQ ID NO. 353-354; 178) SEQ ID NO. 355-356; 179) SEQ ID NO.357-358; 180)SEQ ID NO.359-360; 181)SEQ ID NO.61-362; 182)SEQ ID NO.363-364; 183)SEQ ID NO.365-366; 184)SEQ IDNO .367-368; 185) SEQ ID NO. 369-370; 186) SEQ ID NO. 371-372; 187) SEQ ID NO. 373-374; 188) SEQ ID NO. 375-376; 189) SEQ ID NO .377-378; 190) SEQ ID NO. 379-380; 191) SEQ ID NO. 381-382.

Compared with the prior art, the primers for amplifying the 191 human microhaplotype loci genetic markers provided by the present invention can specifically amplify the above-mentioned 191 microhaploid loci in the same system, and the primer pairs will not interfere with each other, which can meet the requirements of multiplex PCR, further improving the accuracy and stability of using the amplified loci as genetic markers for forensic identification and analysis, and simplifying the operating steps of forensic identification, especially reducing the difficulty of second-level kinship identification, and having extremely high application value.

The present invention also provides the application of the 191 human microhaplotype loci genetic markers in forensic identification.

The present invention also provides the application of the 191 human microhaplotype loci genetic markers in individual identification or kinship identification.

Preferably, the kinship identification includes paternity identification, full-sibling identification, and two-level kinship identification involving only two individuals.

The present invention also provides a forensic identification kit, which comprises primers for amplifying the 191 human microhaplotype gene loci genetic markers.

Preferably, the forensic identification kit further comprises a buffer solution, a DNA polymerase and dNTPs.

The present invention also provides a method for using the forensic identification kit, which comprises extracting genomic DNA of a sample to be tested as a template, performing PCR amplification using the kit, performing a linker sequence PCR reaction on the obtained amplification product to obtain a multiplex PCR library, performing quantitative analysis and second-generation sequencing detection analysis on the multiplex PCR library, and obtaining typing results of the microhaplotype locus.

Preferably, the PCR amplification system includes the following reagents and amounts:

所述PCR扩增的程序为：

The procedure of the PCR amplification is:

The system of the linker sequence PCR reaction includes the following reagents and amounts:

所述接头序列PCR反应的程序为：

The procedure of the linker sequence PCR reaction is:

Preferably, the concentration of the genomic DNA is 5ng-20ng.

Preferably, in the mixture of 191 human microhaplotype loci amplification primers, the concentration of each primer is 5-10 μM.

Further preferably, the forensic identification kit may also introduce primers corresponding to the sex identification site or other functional identification primers to meet the sex identification requirements of the forensic identification kit.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 is a diagram comparing the system performance of the forensic identification kit in Example 4 of the detection in Example 6 of the present invention and the existing kit in the same identification, wherein, 2ND vs. UR: two-layer kinship identification, 3RD vs. UR: three-layer kinship identification; kit type: MH: the forensic identification kit in Example 4, SIG: signature, 42STR: 42 STR kit constructed by this laboratory, COM A: SIG+42STR two kits are used in combination, COM B: the above three kits are used in combination.

DETAILED DESCRIPTION

In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

Example 1

Screening of microhaploid loci:

The screening of 191 microhaplotype loci on 22 autosomes was carried out using the population data of 103 Chinese Beijing Han and 105 Chinese Southern Han populations in the 1000 Genomes Database, according to the following specific conditions:

Initial screening:

(1) Removal of recombination hotspots; (2) Removal of SNPs with heterozygosity less than 0.4; (3) DNA fragments with 2-5 SNPs within 250 bp in length, a total of 245,479 micro-haplotype loci were screened. Phase was used to estimate the haplotypes and haplotype frequencies of micro-haplotype loci.

Rescreening:

The micro-haplotype loci screened above were further screened:

(1) There are 3 to 5 SNPs within 200 bp of the DNA fragment length; (2) The number of effective alleles is greater than 2.5; (3) The sequence features within ±200 bp upstream and downstream of the microhaplotype position are checked on the UCSC browser, and microhaplotype loci with long poly structures, repeat regions, and Indels are eliminated; (4) After the amplification primers are successfully designed, BLAT is performed on the sequence on the Ensembl browser to eliminate microhaplotype loci sequences that can be located in multiple positions in the genome alignment; (5) In order to reduce the possibility of linkage, the physical distance between microhaplotype loci located on the same chromosome is greater than 5 Mb.

A total of 191 microhaplotype loci that were correctly typed were successfully sequenced under the above conditions, and the 191 optimized primer pairs involved could meet the requirements of high-throughput amplification without interfering with each other.

Nomenclature of microhaplotype loci

At present, there is no standardized naming method for micro-haplotype loci in the world. The naming method proposed by Professor Kidd has certain limitations and is not conducive to the unification of micro-haplotype loci between laboratories. Our laboratory proposes a new naming method for micro-haplotype loci. By observing the name of the micro-haplotype, you can intuitively know which chromosome the micro-haplotype locus is located on, including several SNPs and the position of the SNP on the chromosome. The naming method we proposed includes the English abbreviation "mh" for the micro-haplotype, the chromosome number, and the position of each SNP in the locus. For example, mh1-1987049/096/145/156, "mh" is the abbreviation for the micro-haplotype to distinguish different genetic markers, "1" means that the locus is located on chromosome 1, "1987049" is the position of the first SNP of the locus on the chromosome, and "096/145/156" respectively represent the last few digits of the second, third and fourth SNPs on the chromosome that are different from the first SNP position. This naming method is intuitive and clear, which is conducive to the unification of micro-haplotype loci between laboratories. As the number of research populations increases, the polymorphism of some SNPs in different groups varies, and the addition or deletion of SNPs in micro-haplotype loci can be clearly understood. Through the above population and specific screening conditions, 191 human micro-haplotype loci were finally obtained, and after testing and analysis, it was found that it combined the advantages of STR and SNP, with the advantages of short amplification fragments, low mutation rate, good polymorphism, and no stutter peaks.

Example 2

The group of human microhaplotype loci screened in Example 1 includes the following 191 human microhaplotype loci:

Example 3

The sequences of the 191 pairs of primers for amplifying the 191 human microhaplotype loci in Example 2 are as follows:

1) SEQ ID NO.1-2; 2) SEQ ID NO.3-4; 3) SEQ ID NO.5-6; 4) SEQ ID NO.7-8; 5) SEQ ID NO.9-10; 6 )SEQ ID NO.11-12; 7) SEQ ID NO.13-14; 8) SEQ ID NO.15-16; 9) SEQ ID NO.17-18; 10) SEQ ID NO.19-20; 11) SEQ ID NO.21-22; 12) SEQ ID NO.23-24; 13) SEQ ID NO.25-26; 14) SEQ ID NO.27-28; 15) SEQ ID NO.29-30; 16) SEQ ID NO.31-32; 17) SEQ ID NO.33-34; 18) SEQ ID NO.35-36; 19) SEQ ID NO.37-38; 20) SEQ ID NO.39-40; 21) SEQ ID NO.41-42; 22) SEQ ID NO.43-44; 23) SEQ ID NO.45-46; 24) SEQ ID NO.47-48; 25) SEQ ID NO. 49-50; 26) SEQ ID NO.51-52; 27) SEQ ID NO.53-54; 28) SEQ ID NO.55-56; 29) SEQ ID NO.57-58; 30) SEQ ID NO.59 -60; 31) SEQ ID NO.61-62; 32) SEQ ID NO.63-64; 33) SEQ ID NO.65-66; 34) SEQ ID NO.67-68; 35) SEQ ID NO.69- 70; 36) SEQ ID NO. 71-72; 37) SEQ ID NO. 73-74; 38) SEQ ID NO. 75-76; 39) SEQ ID NO.77-78; 40) SEQ ID NO.79-80; 41) SEQ ID NO.81-82; 42) SEQ ID NO.83-84; 43) SEQ ID NO.85-86; 44) SEQ ID NO.87-88; 45) SEQ ID NO.89-90; 46) SEQ ID NO.91-92; 47) SEQ ID NO.93-94; 48) SEQ ID NO.95-96; 49) SEQ ID NO. 97-98; 50) SEQ ID NO. 99-100; 51) SEQ ID NO. 101-102; 52) SEQ ID NO. 103-104; 53) SEQ ID NO. 105-106; 54) SEQ ID NO. 107 -108;55)SEQ ID NO.109-110;56)SEQ ID NO.111-112; 57) SEQ ID NO.113-114; 58) SEQ ID NO.115-116; 59) SEQ ID NO.11-118; 60) SEQ ID NO.119-120; 61) SEQ ID NO .121-122; 62) SEQ ID NO.123-124; 63) SEQ ID NO.125-126; 64) SEQ ID NO.127-128; 65) SEQ ID NO.129-130; 66) SEQ ID NO .131-132; 67) SEQ ID NO.133-134; 68) SEQ ID NO.135-136; 69) SEQ ID NO.137-138; 70) SEQ ID NO.139-140; 71) SEQ ID NO. 141-142;72)SEQ ID NO.143-144; 73) SEQ ID NO.145-146; 74) SEQ ID NO.147-148; 75) SEQ ID NO.149-150; 76) SEQ ID NO.151-152; 77) SEQ ID NO.153-154; 78)SEQ ID NO.155-156; 79)SEQ ID NO.157-158; 80)SEQ ID NO.159-160; 81)SEQ ID NO.161-162; 82)SEQ IDNO .163-164; 83) SEQ ID NO.165-166; 84) SEQ ID NO.167-168; 85) SEQ ID NO.169-170; 86) SEQ ID NO.171-172; 87) SEQ ID NO .173-174;88)SEQ ID NO.175-176; 89)SEQ ID NO.177-178; 90)SEQ ID NO.179-180; 91)SEQ ID NO.181-182; 92)SEQ ID NO.183-184; 93)SEQ IDNO .185-186; 94) SEQ ID NO. 187-188; 95) SEQ ID NO. 189-190; 96) SEQ ID NO. 191-192; 97) SEQ ID NO. 193-194; 98) SEQ ID NO .195-196; 99) SEQ ID NO.197-198; 100) SEQ ID NO.199-200; 101) SEQ ID NO.201-202; 102) SEQ ID NO.203-204; 103) SEQ ID NO. 205-206;104)SEQ ID NO.207-208; 105) SEQ ID NO.209-210; 106) SEQ ID NO.211-212; 107) SEQ ID NO.213-214; 108) SEQ ID NO.215-216; 109) SEQ ID NO .217-218; 110) SEQ ID NO.219-220; 111) SEQ ID NO.221-222; 112) SEQ ID NO.223-224; 113) SEQ ID NO.225-226; 114) SEQ ID NO. 227-28; 115) SEQ ID NO. 229-230; 116) SEQ ID NO. 231-232; 117) SEQ ID NO. 233-234; 118) SEQ ID NO. 235-236; 119) SEQ ID NO.237-238; 120) SEQ ID NO.239-240; 121) SEQ ID NO.241-242; 122) SEQ ID NO.243-244; 123) SEQ ID NO.245-246; 124) SEQ ID NO .247-248; 125) SEQ ID NO. 249-250; 126) SEQ ID NO. 251-252; 127) SEQ ID NO. 253-254; 128) SEQ ID NO. 255-256; 129) SEQ ID NO. 257-258; 130) SEQ ID NO. 259-260; 131) SEQ ID NO. 261-262; 132) SEQ ID NO. 263-264; 133) SEQ ID NO. 265-266; 134) SEQ ID NO.267-268; 135) SEQ ID NO.269-270; 136) SEQ ID NO.271-272; 137) SEQ ID NO.273-274; 138) SEQ ID NO.275-276; 139) SEQ ID NO .277-278; 140) SEQ ID NO. 279-280; 141) SEQ ID NO. 281-282; 142) SEQ ID NO. 283-284; 143) SEQ ID NO. 285-286; 144) SEQ ID NO. 287-288; 145) SEQ ID NO. 289-290; 146) SEQ ID NO. 291-292; 147) SEQ ID NO. 293-294; 148) SEQ ID NO. 295-296; 149) SEQ ID NO.297-298; 150) SEQ ID NO.299-300; 151) SEQ ID NO.301-302; 152) SEQ ID NO.303-304; 153) SEQ ID NO.305-306; 154) SEQ ID NO.307-308; 155) SEQ ID NO.309-310; 156) SEQ ID NO.311-312; 157) SEQ ID NO.313-314; 158) SEQ ID NO.315-316; 159) SEQ ID NO .317-318; 160) SEQ ID NO. 319-320; 161) SEQ ID NO. 321-322; 162) SEQ ID NO. 323-324; 163) SEQ ID NO. 325-326; 164) SEQ ID NO.327-328; 165)SEQ ID NO.329-330; 166)SEQ ID NO.331-332; 167)SEQ ID NO.333-334; 168)SEQ ID NO.335-336; 169)SEQ ID NO.337-338; 170) SEQ ID NO.339-340; 171) SEQ ID NO.341-342; 172) SEQ ID NO.343-344; 173) SEQ ID NO.345-346; 174) SEQ ID NO .347-348; 175) SEQ ID NO. 349-350; 176) SEQ ID NO. 351-352; 177) SEQ ID NO. 353-354; 178) SEQ ID NO. 355-356; 179) SEQ ID NO.357-358; 180)SEQ ID NO.359-360; 181)SEQ ID NO.61-362; 182)SEQ ID NO.363-364; 183)SEQ ID NO.365-366; 184)SEQ IDNO .367-368; 185) SEQ ID NO. 369-370; 186) SEQ ID NO. 371-372; 187) SEQ ID NO. 373-374; 188) SEQ ID NO. 375-376; 189) SEQ ID NO .377-378; 190) SEQ ID NO. 379-380; 191) SEQ ID NO. 381-382.

Example 4

A forensic identification kit comprises primers for amplifying the above-mentioned 191 human microhaplotype loci (191 pairs of primers in Example 3), an IGT-EM808 polymerase mixture, an enhancement buffer NB, an enhancement buffer M, a YF buffer B, an IGT-I5 tag and an IGT-I7 tag.

The method of using the forensic identification kit is as follows:

The genomic DNA is extracted from the whole blood of the test subject, and PCR amplification is performed using the extracted genomic DNA as a template. The obtained amplification product is then subjected to a linker sequence PCR reaction to obtain an identification product, namely a multiplex PCR library.

The PCR amplification system includes the following reagents and dosages:

上述PCR扩增的程序为：

The procedure for the above PCR amplification is:

The amplified product obtained by the above PCR amplification is subjected to the first round of magnetic bead purification, and the specific method is as follows:

1) Add 27uL of AMPure XP magnetic beads equilibrated at room temperature to the PCR tube (containing 30uL of PCR amplification product) and mix gently by pipetting 20 times;

2) After incubation at room temperature for 5 minutes, place the PCR tube on the DynaMag-96 Side magnetic stand for 3 minutes;

3) Remove the supernatant, remove the PCR tube from the magnetic stand, add 50ul YF buffer B into the tube and mix gently by pipetting 20 times;

4) After incubation at room temperature for 5 minutes, place the PCR tube on the DynaMag-96 Side magnetic stand for 3 minutes;

5) Remove the supernatant, place the PCR tube on the magnetic rack, add 180ul 80% ethanol solution into the tube, and let it stand for 30 seconds;

6) Remove the supernatant, keep the PCR tube on the magnetic rack, add 180ul 80% ethanol solution into the tube, let it stand for 30 seconds, and then remove the supernatant;

7) Let stand at room temperature for 3 minutes to allow the residual ethanol to evaporate completely;

8) Remove the PCR tube from the magnetic stand, add 24ul Nuclease-free water, gently pipette to resuspend the magnetic beads to avoid bubbles, and let stand at room temperature for 2 minutes;

9) Place the PCR tube back on the magnetic rack and let it stand for 3 minutes;

10) Use a pipette to aspirate 13.5ul of the supernatant and transfer it to a new 200ul PCR tube. The supernatant in the new PCR tube is the purified multiplex PCR amplification product.

The above-mentioned linker sequence PCR reaction system includes the following reagents and amounts:

上述接头序列PCR反应的程序为：

The procedure for the above-mentioned linker sequence PCR reaction is:

The amplified product obtained by the PCR reaction of the above-mentioned adapter sequence is subjected to a second round of magnetic bead purification, and the specific method is as follows:

1) Add 27uL of AMPure XP magnetic beads equilibrated at room temperature to the PCR tube (containing the amplified product obtained from the PCR reaction of the adapter sequence) and mix gently by pipetting 20 times;

2) After incubation at room temperature for 5 minutes, place the PCR tube on the DynaMag-96 Side magnetic stand for 3 minutes;

3) Remove the supernatant, remove the PCR tube from the magnetic stand, add 50ul YF buffer B to the tube, and mix gently by pipetting 20 times;

4) After incubation at room temperature for 5 minutes, place the PCR tube on the DynaMag-96 Side magnetic stand for 3 minutes;

5) Remove the supernatant, place the PCR tube on the magnetic rack, add 180ul 80% ethanol solution into the tube, and let it stand for 30 seconds;

6) Remove the supernatant, keep the PCR tube on the magnetic rack, add 180ul 80% ethanol solution into the tube, let it stand for 30 seconds, and then remove the supernatant;

7) Let stand at room temperature for 3 minutes to allow the residual ethanol to evaporate completely;

8) Remove the PCR tube from the magnetic stand, add 24uL Nuclease-free water, gently pipette to resuspend the magnetic beads to avoid bubbles, and let stand at room temperature for 2 minutes;

9) Place the PCR tube back on the magnetic rack and let it stand for 3 minutes;

10) Use a pipette to aspirate 20uL of supernatant and transfer it to a new PCR tube. The supernatant in the new PCR tube is the obtained multiplex PCR library.

Library quantification:

3.0Fluorometer定量仪(Qubit dsDNAHS Assay Kit)进行文库浓度测定，记录文库浓度。正常文库的浓度范围为5ng/uL-50ng/uL，文库浓度主要与模板的质量相关。Take 2ul of the prepared multiplex PCR library and use

3.0 Fluorometer quantifier (Qubit dsDNA HS Assay Kit) was used to measure the library concentration and record the library concentration. The normal library concentration range is 5ng/uL-50ng/uL, and the library concentration is mainly related to the quality of the template.

Library quality test:

GX Touch 24(DNA HiSensChip&Reagent Kit)进行文库片段长度检测，正常文库的靶片段分布区间在280bp–420bp之间。Dilute the quantitative library to 5ng/uL and take 10uL for use

GX Touch 24 (DNA HiSensChip & Reagent Kit) was used to detect the length of library fragments. The target fragment distribution range of a normal library was between 280 bp and 420 bp.

MiSeq FGx platform for on-machine sequencing detection:

Denature and dilute the constructed library and PhiX according to Protocol A in MiSeq System Denature and Dilute Libraries Guide (Document#15039740v10), edit the sample table using IEM software according to Illumina ExperimentManager Software Guide (Document#15031335v08), and perform sequencing according to MiSeq System Guide (Document#15027617 v05 Material#20000262). The sequencing reagents used in this experiment are MiSeq Reagent Kit v3 or MiSeq FGx Reagent Kit (Micro Flow Cell & Standard Flow Cell), PE300 double-end sequencing.

Example 5

Repeatability test:

The cell line NA18530 was used to conduct a repeatability study on the kit in Example 4. One method was to construct the library three times and sequence it simultaneously; the other method was to construct the library once and sequence it three times. After data analysis and comparison, the typing of all 191 micro-haplotype loci of NA18530 was consistent, indicating that the micro-haplotype composite amplification kit (forensic identification kit) in Example 4 has good repeatability.

Sensitivity test:

The sensitivity study of the kit in Example 4 was carried out using the cell line NA18530. The starting template amounts of the first round of PCR amplification were 10ng, 5ng, 2.5ng, 1ng, 500pg, 250pg, 125pg, and 62.5pg, respectively, and repeated once. After data analysis, the accurate typing of all micro-haplotype loci can still be obtained when the starting template amount is 250pg. When the starting template amount is 125pg, allele loss occurs in one micro-haplotype locus. When the starting template amount is 62.5pg, the heterozygous equilibrium of 11 and 13 micro-haplotype loci in two repetitions does not reach the set threshold value, and in addition, there is a sample with a starting template amount of 62.5pg and allele loss of 3 micro-haplotype loci. In summary, it is shown that the sensitivity of the micro-haplotype composite amplification kit in Example 4 can reach 250pg, which has very good sensitivity.

Stability test:

The stability study of the kit in Example 4 was conducted using the cell line NA18530. The stability study included two types: one was to add two PCR inhibitors, humic acid and hemoglobin, to the DNA, and the other was to use ultrasonic disruption to prepare degradation samples.

(1) Humic acid PCR inhibitor, the concentrations of humic acid in the 1ng/uL DNA solution were 25ng/uL, 50ng/uL, 75ng/uL and 100ng/uL, and the starting DNA template amount for the first round of PCR amplification was 5ng, which was repeated once. After data analysis, when the humic acid concentration was 25ng/uL, allele loss occurred at two microhaploid loci.

(2) Hemoglobin PCR inhibitor, the concentration of hemoglobin in the 1ng/uL DNA solution was 100uM, 200uM, 300uM and 400uM respectively, the starting DNA template amount for the first round of PCR amplification was 5ng, and it was repeated once. After data analysis, when the hemoglobin concentration was 200uM, allele loss occurred at two micro-haploid loci.

(3) Ultrasonic shearing of DNA to prepare degraded samples. Ultrasonic shearing was performed according to the conditions in Table 1, and Qubit quantitative dilution was used to construct the library to 5 ng/ul. The artificially prepared degraded samples were simultaneously amplified by GSTAR ^TM 25 kit (Beijing Jinma Shenghe Technology Co., Ltd.) for composite STR amplification and analyzed by capillary electrophoresis using ABI 3500 genetic analyzer. DNA amplified by GSTAR ^TM 25 kit showed severe locus imbalance 10 minutes after ultrasonic shearing, and allele loss of the entire locus occurred 20 minutes after ultrasonic shearing.

Table 1 Ultrasonic interruption conditions

However, the degraded DNA detected by the micro-haplotype kit in Example 4 can still be accurately typed after ultrasonic interruption for 30 minutes. It can be seen that the above micro-haplotype locus amplification kit has good anti-degradation ability and can be applied to actual forensic examinations.

Example 6

A population data survey was conducted on 221 healthy unrelated individuals of the Han nationality in Hebei using the kit in Example 4. Through the Hardy-Weinberg equilibrium test, it was found that 191 microhaplotype loci were in Hardy-Weinberg equilibrium in the population.

In addition, locus independence analysis was performed, and 191 microhaplotype loci were found to be in linkage equilibrium and independent of each other.

The system performance of the test kit in Example 4 was calculated, as shown in Table 2, which can confirm that the microhaploid locus test kit (forensic identification kit) can solve the problems of identity identification, paternity testing, and grandparent-grandchild identification.

Table 2 System performance of the microhaplotype locus kit

locus TDP CPEduo CPEtrio RGE 191 1-2.2025E-138 1-6.4440E-22 1-7.6383E-40 1-2.5273E-17

Note: TDP: Cumulative individual identification probability; CPEduo: Cumulative non-paternity exclusion probability of a duo;

CPEtrio: cumulative probability of non-paternal exclusion of a triplet; RGE: mean non-grandparental exclusion rate.

In order to test the application value of the kit in distant relative identification, the population allele frequencies of 221 unrelated individuals of the Han nationality in Hebei Province were used to simulate 500,000 pairs of two-layer kinship individuals, three-layer kinship pairs and unrelated individuals according to the genetic law, and two-layer and three-layer kinship identifications were performed respectively. The area under the receiver operating characteristic curve (ROC curve) (AUC) was used as the system performance evaluation index, and the system performance of the commercial kit ForenSeq ^TM DNA Signature Prep Kit (Verogen) and the second-generation sequencing kit composed of 42 STR loci constructed in our laboratory in the early stage were compared in the same identification. The results are shown in Figure 1, where 2ND vs. UR: two-layer kinship identification, 3RD vs. UR: three-layer kinship identification; Kit type: MH: forensic identification kit in Example 4, SIG: signature, 42STR: 42 STR kit constructed by our laboratory (published), COM A: SIG+42STR two kits are used in combination, and COM B: the above three kits are used in combination. It can be seen that the system performance of the kit in the above-mentioned two-layer and three-layer kinship identification is equivalent to the results when the other two kits are used in combination. The kit in Example 4 has an AUC of more than 0.9999 in the grandparent-grandchild identification, and can independently solve the problem of two-layer kinship identification between two individuals, solving the problem of not being able to achieve grandparent-grandchild identification results due to the inability to provide parental samples.

Example 7

A forensic medicine identification kit comprises the 191 pairs of primers in Example 3 and 6 pairs of primers located on sex chromosomes, and other reagents are the same as those in the forensic medicine identification kit in Example 4.

The 6 pairs of primers located on the sex chromosomes correspond to the 6 SNP sites for identifying sex. The 6 SNP sites and their corresponding 6 pairs of primers are shown in Table 3.

Table 3 Six SNP sites and primers used for gender identification

The forensic identification kit is used for high-throughput multiplex PCR detection (the detection method is the same as that in Example 4), which can not only realize the accurate identification of identity, paternity identification, grandparent-grandchild identification, and second-level kinship such as grandparent-grandchild, aunt-nephew or uncle-nephew when only two people participate, but also can meet the accurate judgment of gender.

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modification, equivalent substitution or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Hebei Medical University

<120> 191 human microhaplotype loci genetic markers and their amplification primers and applications

<130> 2021

<160> 394

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213> mh1-1987049/096/145/156-F

<400> 1

tacatgttgc ccgcctcttc 20

<210> 2

<211> 20

<212> DNA

<213> mh1-1987049/096/145/156-R

<400> 2

tgcttgtgtg gcttgaaggt 20

<210> 3

<211> 22

<212> DNA

<213> mh1-30729052/070/109/133-F

<400> 3

gacagactgg aatgtgagca ct 22

<210> 4

<211> 22

<212> DNA

<213> mh1-30729052/070/109/133-R

<400> 4

catctctgcc tgacttttgg ga 22

<210> 5

<211> 22

<212> DNA

<213> mh1-46553582/679/720-F

<400> 5

gatctcaaag gagaggcacg tt 22

<210> 6

<211> 22

<212> DNA

<213> mh1-46553582/679/720-R

<400> 6

ggattgtaat cccacagtgc ct 22

<210> 7

<211> 23

<212> DNA

<213> mh1-58680514/523/637-F

<400> 7

ctatgatgcc aacctaaccc aca 23

<210> 8

<211> 23

<212> DNA

<213> mh1-58680514/523/637-R

<400> 8

tggaaagcct tcctgtccta ttg 23

<210> 9

<211> 26

<212> DNA

<213> mh1-91827052/072/172-F

<400> 9

gcgatgaaca gagagttatc aatctg 26

<210> 10

<211> 22

<212> DNA

<213> mh1-91827052/072/172-R

<400> 10

catgcctggc actttacatc ac 22

<210> 11

<211> 23

<212> DNA

<213> mh1-104323602/681/790-F

<400> 11

gccaacaatg ctttttctgc aag 23

<210> 12

<211> 22

<212> DNA

<213> mh1-104323602/681/790-R

<400> 12

agctcccaat gttatttgcc ct 22

<210> 13

<211> 23

<212> DNA

<213> mh1-115842550/667/688-F

<400> 13

catacaggtg gcaatggaaa tgg 23

<210> 14

<211> 23

<212> DNA

<213> mh1-115842550/667/688-R

<400> 14

catcagtatg gatgtgtggt ggt 23

<210> 15

<211> 24

<212> DNA

<213> mh1-158512252/258/348/394-F

<400> 15

ctgcataagc ctcagagata gcaa 24

<210> 16

<211> 25

<212> DNA

<213> mh1-158512252/258/348/394-R

<400> 16

tccagtttgc aacctactag atcac 25

<210> 17

<211> 22

<212> DNA

<213> mh1-172044709/780/851-F

<400> 17

ctgcatttcc agcctgtact ct 22

<210> 18

<211> 22

<212> DNA

<213> mh1-172044709/780/851-R

<400> 18

tcctccccac aggaaaggat aa 22

<210> 19

<211> 22

<212> DNA

<213> mh1-201719704/769/827-F

<400> 19

agtggttctg gaagcttctc tg 22

<210> 20

<211> 22

<212> DNA

<213> mh1-201719704/769/827-R

<400> 20

agaggctact ttccactccc tt 22

<210> 21

<211> 22

<212> DNA

<213> mh1-212512407/570/586-F

<400> 21

gagtgtgctt cacagtgagt ga 22

<210> 22

<211> 21

<212> DNA

<213> mh1-212512407/570/586-R

<400> 22

tctgatcctt ccccatctgc t 21

<210> 23

<211> 22

<212> DNA

<213> mh1-222531127/152/166/211/297-F

<400> 23

gtacacgtgc acatcatgct tc 22

<210> 24

<211> 22

<212> DNA

<213> mh1-222531127/152/166/211/297-R

<400> 24

taggaatgtg gaaagggcca ac 22

<210> 25

<211> 22

<212> DNA

<213> mh1-230147759/786/900-F

<400> 25

actgttgaga gaagctgcct tc 22

<210> 26

<211> 22

<212> DNA

<213> mh1-230147759/786/900-R

<400> 26

tgtgctagga gcatctacca ct 22

<210> 27

<211> 22

<212> DNA

<213> mh1-242826907/7030/7080-F

<400> 27

ctgcatgaaa tgcaagggct ag 22

<210> 28

<211> 22

<212> DNA

<213> mh1-242826907/7030/7080-R

<400> 28

agaccagaac tcagggttct ga 22

<210> 29

<211> 19

<212> DNA

<213> mh2-1719160/192/314-F

<400> 29

catgcctccc acctgagtt 19

<210> 30

<211> 22

<212> DNA

<213> mh2-1719160/192/314-R

<400> 30

tatgtaagga ttcgtgctgg gg 22

<210> 31

<211> 23

<212> DNA

<213> mh2-12980960/1009/1020/1042-F

<400> 31

cctccaggcc tagtatgaac cta 23

<210> 32

<211> 24

<212> DNA

<213> mh2-12980960/1009/1020/1042-R

<400> 32

cagtccagtg agagagacat gatg 24

<210> 33

<211> 23

<212> DNA

<213> mh2-40889563/587/681-F

<400> 33

catcaacaaa aggtacgtgc act 23

<210> 34

<211> 24

<212> DNA

<213> mh2-40889563/587/681-R

<400> 34

tgcactaaca accactggaa attg 24

<210> 35

<211> 26

<212> DNA

<213> mh2-50525129/265/283/286-F

<400> 35

cagaacctac taacaatgca cttgag 26

<210> 36

<211> 23

<212> DNA

<213> mh2-50525129/265/283/286-R

<400> 36

acgaaggaac acaaattgta ggc 23

<210> 37

<211> 25

<212> DNA

<213> mh2-59904398/418/532-F

<400> 37

tggcgtttct tcatctctat tcact 25

<210> 38

<211> 29

<212> DNA

<213> mh2-59904398/418/532-R

<400> 38

catcttttaa aagttctgac tcggtacag 29

<210> 39

<211> 22

<212> DNA

<213> mh2-83704508/560/644-F

<400> 39

gtggcaaagc agttttcagc aa 22

<210> 40

<211> 22

<212> DNA

<213> mh2-83704508/560/644-R

<400> 40

agctcaagtg atgttgttgg ct 22

<210> 41

<211> 24

<212> DNA

<213> mh2-102961904/1915/2092-F

<400> 41

tggtacacct ttacatcatc acca 24

<210> 42

<211> 24

<212> DNA

<213> mh2-102961904/1915/2092-R

<400> 42

accttgtcag catgctgtta tatg 24

<210> 43

<211> 24

<212> DNA

<213> mh2-143835498/502/592-F

<400> 43

gaagctccag atgagagaag tgtg 24

<210> 44

<211> 24

<212> DNA

<213> mh2-143835498/502/592-R

<400> 44

cgttatgcaa tggctgagtt gaac 24

<210> 45

<211> 23

<212> DNA

<213> mh2-159366197/199/391-F

<400> 45

caggtgcaga aaacacctac tct 23

<210> 46

<211> 24

<212> DNA

<213> mh2-159366197/199/391-R

<400> 46

tgcagtgtta tttacaggtg ggag 24

<210> 47

<211> 25

<212> DNA

<213> mh2-180485747/756/906-F

<400> 47

aggggcttaa agcaatcaat aagga 25

<210> 48

<211> 28

<212> DNA

<213> mh2-180485747/756/906-R

<400> 48

tgtggtagttcttactccat aaagagtg 28

<210> 49

<211> 22

<212> DNA

<213> mh2-204497437/494/626/637-F

<400> 49

gcaaagccca tgtgtctaaa gg 22

<210> 50

<211> 25

<212> DNA

<213> mh2-204497437/494/626/637-R

<400> 50

gttggaattg ctggtcattt tagga 25

<210> 51

<211> 25

<212> DNA

<213> mh2-215555209/251/261/366-F

<400> 51

aggtgtatcg ttttccattt ttgct 25

<210> 52

<211> 24

<212> DNA

<213> mh2-215555209/251/261/366-R

<400> 52

cacttaaacc ccttgaacac agtg 24

<210> 53

<211> 25

<212> DNA

<213> mh2-226060812/1009/1011-F

<400> 53

gctgaggata ttcccactga ttctc 25

<210> 54

<211> 25

<212> DNA

<213> mh2-226060812/1009/1011-R

<400> 54

aggtgtaagg ctagagccta aaaca 25

<210> 55

<211> 23

<212> DNA

<213> mh2-241704758/894/937-F

<400> 55

tcagacctct ccatacaacc aga 23

<210> 56

<211> 29

<212> DNA

<213> mh2-241704758/894/937-R

<400> 56

ttggcaataa atattttgat tggaaaggg 29

<210> 57

<211> 24

<212> DNA

<213> mh3-6960143/274/286-F

<400> 57

gcaaacatca actaaccaga cctt 24

<210> 58

<211> 22

<212> DNA

<213> mh3-6960143/274/286-R

<400> 58

agctggaaaa gagagctgga aa 22

<210> 59

<211> 24

<212> DNA

<213> mh3-21955422/498/567/601-F

<400> 59

ggaagaagat gggttctctt gtct 24

<210> 60

<211> 24

<212> DNA

<213> mh3-21955422/498/567/601-R

<400> 60

ctgaatctat gcagcagggt aaac 24

<210> 61

<211> 22

<212> DNA

<213> mh3-31508097/266/296-F

<400> 61

gtaagtaaga ggcacccaga gt 22

<210> 62

<211> 22

<212> DNA

<213> mh3-31508097/266/296-R

<400> 62

cacagagagt tcctctcaag ca 22

<210> 63

<211> 24

<212> DNA

<213> mh3-68306722/788/808-F

<400> 63

gctaaagctg gtctctggaa ctac 24

<210> 64

<211> 22

<212> DNA

<213> mh3-68306722/788/808-R

<400> 64

tggtctcagg ggaaacatgg ta 22

<210> 65

<211> 20

<212> DNA

<213> mh3-79781324/420/486-F

<400> 65

cccttgccat tcccctcaga 20

<210> 66

<211> 27

<212> DNA

<213> mh3-79781324/420/486-R

<400> 66

cctactctcc caattatgta tctctgt 27

<210> 67

<211> 28

<212> DNA

<213> mh3-95881886/2030/2033-F

<400> 67

tgagtgtatg gcagcctaat tatattca 28

<210> 68

<211> 24

<212> DNA

<213> mh3-95881886/2030/2033-R

<400> 68

agctgtttgt ctttcaagtc tcct 24

<210> 69

<211> 26

<212> DNA

<213> mh3-103639947/40092/40100-F

<400> 69

tctttaaggg ttcagtttgt tctcac 26

<210> 70

<211> 24

<212> DNA

<213> mh3-103639947/40092/40100-R

<400> 70

cagtcccaca aaccaatcat cttt 24

<210> 71

<211> 22

<212> DNA

<213> mh3-126347871/7878/8012-F

<400> 71

agggcactgt ccattacaca ga 22

<210> 72

<211> 22

<212> DNA

<213> mh3-126347871/7878/8012-R

<400> 72

tgctaactct ggtgttggga ac 22

<210> 73

<211> 27

<212> DNA

<213> mh3-143004069/087/155-F

<400> 73

tgcttccctg ctttttattt ctaacac 27

<210> 74

<211> 27

<212> DNA

<213> mh3-143004069/087/155-R

<400> 74

aacgggaatg taactaccaa agaaaac 27

<210> 75

<211> 22

<212> DNA

<213> mh3-175274859/866/957-F

<400> 75

cagaagccct ttgtctcaag ca 22

<210> 76

<211> 25

<212> DNA

<213> mh3-175274859/866/957-R

<400> 76

acctgagcac tgaagaacaa ttcag 25

<210> 77

<211> 27

<212> DNA

<213> mh3-182276940/7010/7016/7021-F

<400> 77

cacttcttat cacagcagatttccatc 27

<210> 78

<211> 27

<212> DNA

<213> mh3-182276940/7010/7016/7021-R

<400> 78

catggatgaa ataggagaatcccagta 27

<210> 79

<211> 22

<212> DNA

<213> mh3-194754152/199/285-F

<400> 79

ctccggtatc tctgggtaag gt 22

<210> 80

<211> 22

<212> DNA

<213> mh3-194754152/199/285-R

<400> 80

ctcaagagct ctgtccgtta cc 22

<210> 81

<211> 18

<212> DNA

<213> mh4-2940812/814/958-F

<400> 81

acagtgtggg ccagggaa 18

<210> 82

<211> 20

<212> DNA

<213> mh4-2940812/814/958-R

<400> 82

ccaaccctgc cccttattgg 20

<210> 83

<211> 27

<212> DNA

<213> mh4-16207396/403/430/569-F

<400> 83

tcctcacact gacataaaac aaaaagg 27

<210> 84

<211> 25

<212> DNA

<213> mh4-16207396/403/430/569-R

<400> 84

ctgatcaagg catcagatct ctctt 25

<210> 85

<211> 29

<212> DNA

<213> mh4-27677978/7989/8090-F

<400> 85

cttctttgtt caaagtattg tgatccaga 29

<210> 86

<211> 22

<212> DNA

<213> mh4-27677978/7989/8090-R

<400> 86

cacttagcca cttgaggcag aa 22

<210> 87

<211> 22

<212> DNA

<213> mh4-35168225/285/346-F

<400> 87

gtgctctacc ttagccatgt gt 22

<210> 88

<211> 21

<212> DNA

<213> mh4-35168225/285/346-R

<400> 88

agtccccaag caatcatgga c 21

<210> 89

<211> 26

<212> DNA

<213> mh4-44974480/558/564-F

<400> 89

gggtttatcc actaaggaca cacaag 26

<210> 90

<211> 28

<212> DNA

<213> mh4-44974480/558/564-R

<400> 90

catggagctt acagactgaa aagaaaat 28

<210> 91

<211> 28

<212> DNA

<213> mh4-60535292/301/447-F

<400> 91

gtttcccaat tacacatatg cctacatc 28

<210> 92

<211> 27

<212> DNA

<213> mh4-60535292/301/447-R

<400> 92

tgtggtagaa ttagagtcac atgtgag 27

<210> 93

<211> 24

<212> DNA

<213> mh4-72915136/258/290-F

<400> 93

ggctgccaag ggaataataa agtc 24

<210> 94

<211> 27

<212> DNA

<213> mh4-72915136/258/290-R

<400> 94

agtcaagctt aaatggattc tacatgt 27

<210> 95

<211> 24

<212> DNA

<213> mh4-85385818/830/926-F

<400> 95

gggatctcct cattgtacct tgac 24

<210> 96

<211> 24

<212> DNA

<213> mh4-85385818/830/926-R

<400> 96

gcttctcata ggggaaagga gtag 24

<210> 97

<211> 28

<212> DNA

<213> mh4-101260476/587/611-F

<400> 97

cttaaaatag cacatctgatttcccaga 28

<210> 98

<211> 23

<212> DNA

<213> mh4-101260476/587/611-R

<400> 98

tgctttttca ggggcagaag ata 23

<210> 99

<211> 28

<212> DNA

<213> mh4-115378329/413/424-F

<400> 99

tgttaaagcc acattcactttttcctag 28

<210> 100

<211> 28

<212> DNA

<213> mh4-115378329/413/424-R

<400> 100

gcttgagaat gtaataaccc cttctagt 28

<210> 101

<211> 33

<212> DNA

<213> mh4-124498324/480/511-F

<400> 101

tttgtaatta tggctaaagt attagtgata gtc 33

<210> 102

<211> 31

<212> DNA

<213> mh4-124498324/480/511-R

<400> 102

gacatgaata gtcattcacc ttaaattagg a 31

<210> 103

<211> 23

<212> DNA

<213> mh4-137138497/611/617-F

<400> 103

cccgtggaaa gcatgatatg gta 23

<210> 104

<211> 21

<212> DNA

<213> mh4-137138497/611/617-R

<400> 104

tgctttctgt gtgtgctgga t 21

<210> 105

<211> 22

<212> DNA

<213> mh4-154004438/489/571-F

<400> 105

atgtgtgggg agactagtgc at 22

<210> 106

<211> 22

<212> DNA

<213> mh4-154004438/489/571-R

<400> 106

agtgaatgca tgtgcacctc tc 22

<210> 107

<211> 29

<212> DNA

<213> mh4-162585594/653/766-F

<400> 107

aggatgatca ttgcatttat tacatgtca 29

<210> 108

<211> 24

<212> DNA

<213> mh4-162585594/653/766-R

<400> 108

gtgtcatgac agttagctcc ctaa 24

<210> 109

<211> 26

<212> DNA

<213> mh4-174845656/790/795-F

<400> 109

ccttattacc cactcttcag gagcta 26

<210> 110

<211> 26

<212> DNA

<213> mh4-174845656/790/795-R

<400> 110

gctttattagc catgggattc ctatca 26

<210> 111

<211> 29

<212> DNA

<213> mh4-186640816/892/943-F

<400> 111

aaaatgtatt cttatgcttc accaaaacc 29

<210> 112

<211> 32

<212> DNA

<213> mh4-186640816/892/943-R

<400> 112

gttctgtgaa attagtaaag attatgggag aa 32

<210> 113

<211> 22

<212> DNA

<213> mh5-1860057/167/245/251-F

<400> 113

tctccacaga gactcttggt gg 22

<210> 114

<211> 15

<212> DNA

<213> mh5-1860057/167/245/251-R

<400> 114

gaggccccgc gagca 15

<210> 115

<211> 27

<212> DNA

<213> mh5-12979828/868/954-F

<400> 115

gctcaatggt aacagcagaa atagttc 27

<210> 116

<211> 29

<212> DNA

<213> mh5-12979828/868/954-R

<400> 116

ctctcttcag atagactcctttattggtg 29

<210> 117

<211> 27

<212> DNA

<213> mh5-29621406/425/521-F

<400> 117

cagagggatc aatataggca aatctca 27

<210> 118

<211> 25

<212> DNA

<213> mh5-29621406/425/521-R

<400> 118

cttccaggcc aattgttttt aacct 25

<210> 119

<211> 24

<212> DNA

<213> mh5-58793906/3912/4040-F

<400> 119

catctaggtg gaggaatcat tggt 24

<210> 120

<211> 24

<212> DNA

<213> mh5-58793906/3912/4040-R

<400> 120

cttgctgctg atttatgacc tctc 24

<210> 121

<211> 22

<212> DNA

<213> mh5-74544910/5024/5085-F

<400> 121

aacgatgtcc tcactgtcac ct 22

<210> 122

<211> 21

<212> DNA

<213> mh5-74544910/5024/5085-R

<400> 122

tgtcttcttg cctgcgatag c 21

<210> 123

<211> 21

<212> DNA

<213> mh5-85243205/264/270-F

<400> 123

tgttaacact gatggcgagc a 21

<210> 124

<211> 21

<212> DNA

<213> mh5-85243205/264/270-R

<400> 124

tgcattcgcc acaaattgct t 21

<210> 125

<211> 23

<212> DNA

<213> mh5-94697284/290/464-F

<400> 125

acgtggcaaa cataggttac tgt 23

<210> 126

<211> 24

<212> DNA

<213> mh5-94697284/290/464-R

<400> 126

tctcaacctt gtcttcagat gcaa 24

<210> 127

<211> 25

<212> DNA

<213> mh5-115023525/607/656-F

<400> 127

cagatgactttttgtcaccaacctt 25

<210> 128

<211> 22

<212> DNA

<213> mh5-115023525/607/656-R

<400> 128

aggtaggttc aaacgtggtg ag 22

<210> 129

<211> 22

<212> DNA

<213> mh5-125660025/080/185-F

<400> 129

accgtcacct ctttgtagga ct 22

<210> 130

<211> 23

<212> DNA

<213> mh5-125660025/080/185-R

<400> 130

agacctactg ggtccaggaa ata 23

<210> 131

<211> 23

<212> DNA

<213> mh5-142109741/816/894-F

<400> 131

tgtgccgggt gtattttaaa tgc 23

<210> 132

<211> 22

<212> DNA

<213> mh5-142109741/816/894-R

<400> 132

catcagttta ccacctggct ca 22

<210> 133

<211> 23

<212> DNA

<213> mh5-176568834/912/934-F

<400> 133

tctggactac gaggtaaaga gca 23

<210> 134

<211> 23

<212> DNA

<213> mh5-176568834/912/934-R

<400> 134

ctcacggaga tggtgacttt gaa 23

<210> 135

<211> 22

<212> DNA

<213> mh6-452728/732/759/778-F

<400> 135

tcccaggaga tgactgctac ag 22

<210> 136

<211> 22

<212> DNA

<213> mh6-452728/732/759/778-R

<400> 136

ctgtaggttc ttctccccag gt 22

<210> 137

<211> 24

<212> DNA

<213> mh6-27425930/6092/6105-F

<400> 137

tctcccagat ctcactctct tcag 24

<210> 138

<211> 24

<212> DNA

<213> mh6-27425930/6092/6105-R

<400> 138

aagccagatg acagaggtat gcta 24

<210> 139

<211> 22

<212> DNA

<213> mh6-36998194/260/349/350-F

<400> 139

tccaagccac tcatgtttct gt 22

<210> 140

<211> 24

<212> DNA

<213> mh6-36998194/260/349/350-R

<400> 140

agaggcaagg attgtgtttc tagg 24

<210> 141

<211> 23

<212> DNA

<213> mh6-45920098/185/285/296-F

<400> 141

gacaggtgct gcaaaatgtt ctc 23

<210> 142

<211> 23

<212> DNA

<213> mh6-45920098/185/285/296-R

<400> 142

gatgtttcat tgtcacacag ccc 23

<210> 143

<211> 25

<212> DNA

<213> mh6-55528157/158/284-F

<400> 143

ccaccaccaa ctctatcgat aatcc 25

<210> 144

<211> 24

<212> DNA

<213> mh6-55528157/158/284-R

<400> 144

atcgccttta agaggagtta ctgc 24

<210> 145

<211> 24

<212> DNA

<213> mh6-65542037/118/127-F

<400> 145

cctgggaacc tggaatgata gaag 24

<210> 146

<211> 25

<212> DNA

<213> mh6-65542037/118/127-R

<400> 146

gaagtgcctg gaaataatcc catag 25

<210> 147

<211> 21

<212> DNA

<213> mh6-77681361/439/445-F

<400> 147

ctgtttttca ccgccagggt a 21

<210> 148

<211> 21

<212> DNA

<213> mh6-77681361/439/445-R

<400> 148

catggcacaa ccagcaatca c 21

<210> 149

<211> 21

<212> DNA

<213> mh6-107704804/813/933-F

<400> 149

atggataggt ccccaggtca g 21

<210> 150

<211> 21

<212> DNA

<213> mh6-107704804/813/933-R

<400> 150

ccttttcgag aggctcctct g 21

<210> 151

<211> 23

<212> DNA

<213> mh6-144281002/030/122-F

<400> 151

gcgtagactg tgttttgttc agt 23

<210> 152

<211> 22

<212> DNA

<213> mh6-144281002/030/122-R

<400> 152

aggagctgaa atgtggaatc ca 22

<210> 153

<211> 28

<212> DNA

<213> mh6-152814204/243/272-F

<400> 153

gcagatatgg agaaaatctt cacattcc 28

<210> 154

<211> 28

<212> DNA

<213> mh6-152814204/243/272-R

<400> 154

gtaggttat gagctcagaa aatgaatg 28

<210> 155

<211> 21

<212> DNA

<213> mh6-165727439/571/575-F

<400> 155

ggagagagag gaggctttcc a 21

<210> 156

<211> 23

<212> DNA

<213> mh6-165727439/571/575-R

<400> 156

cttcctccta tctactccct gca 23

<210> 157

<211> 24

<212> DNA

<213> mh7-155353189/266/289-F

<400> 157

ctgggtctta ggaggaacta gttg 24

<210> 158

<211> 20

<212> DNA

<213> mh7-155353189/266/289-R

<400> 158

ttgggcaaga ttgcctttgc 20

<210> 159

<211> 19

<212> DNA

<213> mh7-946204/291/360-F

<400> 159

tccaactcca cctccgtgt 19

<210> 160

<211> 22

<212> DNA

<213> mh7-946204/291/360-R

<400> 160

atcctcacaa tggaatggga cc 22

<210> 161

<211> 25

<212> DNA

<213> mh7-10789582/643/723-F

<400> 161

cttggctgta aacctctttt tggaa 25

<210> 162

<211> 27

<212> DNA

<213> mh7-10789582/643/723-R

<400> 162

tagccccaaa acactatttt tacatgc 27

<210> 163

<211> 26

<212> DNA

<213> mh7-19940740/773/856-F

<400> 163

ctttttggat tcatggacaa accaga 26

<210> 164

<211> 26

<212> DNA

<213> mh7-19940740/773/856-R

<400> 164

aggaaagcct gacctacaca aataat 26

<210> 165

<211> 27

<212> DNA

<213> mh7-35567404/461/536-F

<400> 165

tgtataaatt ctgtctgtgtgaccgaa 27

<210> 166

<211> 28

<212> DNA

<213> mh7-35567404/461/536-R

<400> 166

gacataacaa tttggagaaa ccagagac 28

<210> 167

<211> 21

<212> DNA

<213> mh7-44151710/747/763-F

<400> 167

catcccactg ccttgattca c 21

<210> 168

<211> 23

<212> DNA

<213> mh7-44151710/747/763-R

<400> 168

gacagcaatc acaatgtcta ccc 23

<210> 169

<211> 33

<212> DNA

<213> mh7-54459338/406/443/474-F

<400> 169

agatcactga agcttaaaac ttattaaaac atg 33

<210> 170

<211> 22

<212> DNA

<213> mh7-54459338/406/443/474-R

<400> 170

ttgggttagt gcatgcaagt ca 22

<210> 171

<211> 25

<212> DNA

<213> mh7-66228193/350/355-F

<400> 171

tgggaagtca ttagagggta tcaga 25

<210> 172

<211> 25

<212> DNA

<213> mh7-66228193/350/355-R

<400> 172

ctgatacatg tcagaatgca acagg 25

<210> 173

<211> 25

<212> DNA

<213> mh7-88765334/417/434-F

<400> 173

tggtatcatg ggtaggctaa atgtg 25

<210> 174

<211> 23

<212> DNA

<213> mh7-88765334/417/434-R

<400> 174

ccaacacagc ctaaaaccaa ctg 23

<210> 175

<211> 17

<212> DNA

<213> mh7-98286323/325/385/477-F

<400> 175

tgccagcccc ctctgtc 17

<210> 176

<211> 22

<212> DNA

<213> mh7-98286323/325/385/477-R

<400> 176

gagttggtga ggtgggtttc aa 22

<210> 177

<211> 30

<212> DNA

<213> mh7-109825096/124/233/285-F

<400> 177

caaaaataat catccaacag tgaagagaag 30

<210> 178

<211> 34

<212> DNA

<213> mh7-109825096/124/233/285-R

<400> 178

ggtaattttg tagagaaaat acaaactatt cttt 34

<210> 179

<211> 21

<212> DNA

<213> mh7-116223260/387/392-F

<400> 179

ggggcctaaa tttcgctcct a 21

<210> 180

<211> 24

<212> DNA

<213> mh7-116223260/387/392-R

<400> 180

atgccacagt catccttaaa gaac 24

<210> 181

<211> 21

<212> DNA

<213> mh7-128870866/888/957/970-F

<400> 181

gtgtggaagg tgcttcactg a 21

<210> 182

<211> 23

<212> DNA

<213> mh7-128870866/888/957/970-R

<400> 182

cttcctggct ctagtctagg tga 23

<210> 183

<211> 27

<212> DNA

<213> mh8-547113/127/247-F

<400> 183

catttagctttcttctgaag aagagca 27

<210> 184

<211> 25

<212> DNA

<213> mh8-547113/127/247-R

<400> 184

gacactggat tgtgtaaagt atgcc 25

<210> 185

<211> 21

<212> DNA

<213> mh8-10518109/145/239-F

<400> 185

atcacaatgc agggcagagt g 21

<210> 186

<211> 22

<212> DNA

<213> mh8-10518109/145/239-R

<400> 186

acaccaaggc agacaaggag ta 22

<210> 187

<211> 22

<212> DNA

<213> mh8-19756502/636/649-F

<400> 187

ggcacagtgc tgttaacatc tc 22

<210> 188

<211> 18

<212> DNA

<213> mh8-19756502/636/649-R

<400> 188

gctagtgggg gatgtggc 18

<210> 189

<211> 34

<212> DNA

<213> mh8-29616927/7078/7103-F

<400> 189

ggaacttgta tttggttatact taattttgtt tcag 34

<210> 190

<211> 23

<212> DNA

<213> mh8-29616927/7078/7103-R

<400> 190

agtcctgtgg gaatagcaca gat 23

<210> 191

<211> 22

<212> DNA

<213> mh8-60271584/624/690-F

<400> 191

gcaaggttgc caagaaacac tg 22

<210> 192

<211> 22

<212> DNA

<213> mh8-60271584/624/690-R

<400> 192

cactccagct gactacaagc aa 22

<210> 193

<211> 26

<212> DNA

<213> mh8-68082699/750/828-F

<400> 193

cagtcaaaac agcggtagtt tatagg 26

<210> 194

<211> 26

<212> DNA

<213> mh8-68082699/750/828-R

<400> 194

tctgtatcta catcaatgac acccaa 26

<210> 195

<211> 24

<212> DNA

<213> mh8-101133535/641/643/685-F

<400> 195

ggaaaaagtc cattcctcac ttgg 24

<210> 196

<211> 22

<212> DNA

<213> mh8-101133535/641/643/685-R

<400> 196

ctgaatctac acaaccgggt ga 22

<210> 197

<211> 22

<212> DNA

<213> mh8-116835749/847/860-F

<400> 197

tgtccatcgt ccttgaacac ag 22

<210> 198

<211> 22

<212> DNA

<213> mh8-116835749/847/860-R

<400> 198

ccttcaccag tgcctgtact tt 22

<210> 199

<211> 24

<212> DNA

<213> mh8-136290219/272/289-F

<400> 199

gaaagatgct ccctatttgg gaga 24

<210> 200

<211> 24

<212> DNA

<213> mh8-136290219/272/289-R

<400> 200

gactagggag aaccgaatag atgc 24

<210> 201

<211> 23

<212> DNA

<213> mh8-142661001/023/065-F

<400> 201

ggactttaac tggggacaac tga 23

<210> 202

<211> 23

<212> DNA

<213> mh8-142661001/023/065-R

<400> 202

ccatatgctt cattcgtgct cag 23

<210> 203

<211> 23

<212> DNA

<213> mh9-6000422/551/580-F

<400> 203

tgttctgggc aactctcatc tta 23

<210> 204

<211> 33

<212> DNA

<213> mh9-6000422/551/580-R

<400> 204

agaattaaga caataaaaat gtcctaacag att 33

<210> 205

<211> 24

<212> DNA

<213> mh9-23635143/146/207-F

<400> 205

gtctctggaa ggcatgtaaa actc 24

<210> 206

<211> 23

<212> DNA

<213> mh9-23635143/146/207-R

<400> 206

ctgaagttgc cgtgatatca ctc 23

<210> 207

<211> 31

<212> DNA

<213> mh9-36010365/433/555-F

<400> 207

agctgtttca ttggtatgat attattctca c 31

<210> 208

<211> 30

<212> DNA

<213> mh9-36010365/433/555-R

<400> 208

tgcagatcat atgaagaaaa tattccctct 30

<210> 209

<211> 21

<212> DNA

<213> mh9-88945871/6039/6042/6046/6056-F

<400> 209

gcacctgctc catcatgact g 21

<210> 210

<211> 25

<212> DNA

<213> mh9-88945871/6039/6042/6046/6056-R

<400> 210

caacatacac acagtagcca aagga 25

<210> 211

<211> 20

<212> DNA

<213> mh9-116564334/350/488-F

<400> 211

cctcccagtc atgggatgga 20

<210> 212

<211> 23

<212> DNA

<213> mh9-116564334/350/488-R

<400> 212

ggaattaatc atgtggccag cac 23

<210> 213

<211> 21

<212> DNA

<213> mh9-135392593/625/637/711-F

<400> 213

agaggcagca tccacaagtt g 21

<210> 214

<211> 21

<212> DNA

<213> mh9-135392593/625/637/711-R

<400> 214

acctggcaga tcactgaagg t 21

<210> 215

<211> 23

<212> DNA

<213> mh10-52144387/438/469-F

<400> 215

ggaaagctgg aagatgtgtt tgg 23

<210> 216

<211> 22

<212> DNA

<213> mh10-52144387/438/469-R

<400> 216

tgtgcctggc cctagactaa ag 22

<210> 217

<211> 22

<212> DNA

<213> mh10-62848538/544/601-F

<400> 217

tcccctatag ccacacatcc at 22

<210> 218

<211> 23

<212> DNA

<213> mh10-62848538/544/601-R

<400> 218

atgccaggta cttggtattt gct 23

<210> 219

<211> 19

<212> DNA

<213> mh10-71634144/299/303-F

<400> 219

ccaggcagct gcagattgg 19

<210> 220

<211> 22

<212> DNA

<213> mh10-71634144/299/303-R

<400> 220

gatgcacgga gaagagtcca aa 22

<210> 221

<211> 22

<212> DNA

<213> mh10-79630161/180/219-F

<400> 221

gcatctctca ctgcatcttg ga 22

<210> 222

<211> 21

<212> DNA

<213> mh10-79630161/180/219-R

<400> 222

tgagtctgga gggattcagc t 21

<210> 223

<211> 22

<212> DNA

<213> mh10-90206230/327/348-F

<400> 223

gaaatggcat ccgatccaca ag 22

<210> 224

<211> 22

<212> DNA

<213> mh10-90206230/327/348-R

<400> 224

ctgatcactg cctttgtggt tg 22

<210> 225

<211> 22

<212> DNA

<213> mh10-99523571/573/632-F

<400> 225

agggagaaag gaaactgctc tg 22

<210> 226

<211> 22

<212> DNA

<213> mh10-99523571/573/632-R

<400> 226

tctctactct gcgaattcct gc 22

<210> 227

<211> 21

<212> DNA

<213> mh10-111432667/700/772-F

<400> 227

ccccatgctg tttgtctgtc t 21

<210> 228

<211> 21

<212> DNA

<213> mh10-111432667/700/772-R

<400> 228

ctgtggcagc tgaaaccagt a 21

<210> 229

<211> 22

<212> DNA

<213> mh10-121111532/675/691-F

<400> 229

tgatcatgtc agaggtggct ca 22

<210> 230

<211> 23

<212> DNA

<213> mh10-121111532/675/691-R

<400> 230

gtcagggttg agaatgcaca tca 23

<210> 231

<211> 23

<212> DNA

<213> mh10-132237561/688/743-F

<400> 231

gtggtaacca ctccttccta agc 23

<210> 232

<211> 22

<212> DNA

<213> mh10-132237561/688/743-R

<400> 232

ctgattcttc cagggctggt tc 22

<210> 233

<211> 22

<212> DNA

<213> mh10-12081667/668/772-F

<400> 233

tgccaaaatc aaccccctct tc 22

<210> 234

<211> 22

<212> DNA

<213> mh10-12081667/668/772-R

<400> 234

acaggcctcc tcagaacttc ta 22

<210> 235

<211> 22

<212> DNA

<213> mh10-23068047/080/131-F

<400> 235

aaaagacacc ggtgttccac tg 22

<210> 236

<211> 22

<212> DNA

<213> mh10-23068047/080/131-R

<400> 236

aaggggcaaa aggaaactgg ag 22

<210> 237

<211> 23

<212> DNA

<213> mh10-35046057/116/252-F

<400> 237

ggaaaagcat ccaggcaatt acc 23

<210> 238

<211> 22

<212> DNA

<213> mh10-35046057/116/252-R

<400> 238

tctcaccaga ttgaatgtgg gc 22

<210> 239

<211> 22

<212> DNA

<213> mh10-43083331/467/505-F

<400> 239

cagcaccttg aaaactcgtg ac 22

<210> 240

<211> 23

<212> DNA

<213> mh10-43083331/467/505-R

<400> 240

ctcaaagctc cttaagcctc agg 23

<210> 241

<211> 21

<212> DNA

<213> mh11-12051115/117/276/279-F

<400> 241

ttggggaaga ggtttcctgg a 21

<210> 242

<211> 21

<212> DNA

<213> mh11-12051115/117/276/279-R

<400> 242

agcagctgag gaactctgag a 21

<210> 243

<211> 22

<212> DNA

<213> mh11-24408883/9048/9072-F

<400> 243

caggttgtac acaccatggc at 22

<210> 244

<211> 22

<212> DNA

<213> mh11-24408883/9048/9072-R

<400> 244

acagcactga aagtgtcaac gg 22

<210> 245

<211> 26

<212> DNA

<213> mh11-35239380/487/552-F

<400> 245

gaagctcttg gctaaagaaa tttcct 26

<210> 246

<211> 23

<212> DNA

<213> mh11-35239380/487/552-R

<400> 246

cctttgtgtg gttcatcaac gag 23

<210> 247

<211> 19

<212> DNA

<213> mh11-62787587/614/770-F

<400> 247

cgatgactcg gacccaggt 19

<210> 248

<211> 18

<212> DNA

<213> mh11-62787587/614/770-R

<400> 248

aggagccacg aaacccga 18

<210> 249

<211> 22

<212> DNA

<213> mh11-70104795/890/982-F

<400> 249

gaacccagag ggactttgga tg 22

<210> 250

<211> 21

<212> DNA

<213> mh11-70104795/890/982-R

<400> 250

caagcccctg ttctggatct g 21

<210> 251

<211> 28

<212> DNA

<213> mh11-80844932/5097/5104-F

<400> 251

actatatgct aacaagcaat ggtttgag 28

<210> 252

<211> 24

<212> DNA

<213> mh11-80844932/5097/5104-R

<400> 252

gtgagaaata tgctccaatc ccct 24

<210> 253

<211> 24

<212> DNA

<213> mh11-92548924/9009/9081-F

<400> 253

gaagtgagag aagttggcat ttgc 24

<210> 254

<211> 23

<212> DNA

<213> mh11-92548924/9009/9081-R

<400> 254

ccatttggca cccagaagaa gta 23

<210> 255

<211> 22

<212> DNA

<213> mh11-115165135/208/273-F

<400> 255

ggtgtccaca ctgacaattt gc 22

<210> 256

<211> 22

<212> DNA

<213> mh11-115165135/208/273-R

<400> 256

tgagcacgta gagcaagttc tg 22

<210> 257

<211> 22

<212> DNA

<213> mh11-127025586/628/687-F

<400> 257

gggaagcagg agaattgttt gg 22

<210> 258

<211> 22

<212> DNA

<213> mh11-127025586/628/687-R

<400> 258

ctctgaaacc agttcctcca ct 22

<210> 259

<211> 22

<212> DNA

<213> mh11-134478240/245/322-F

<400> 259

gctgattctc aaagtggcct ct 22

<210> 260

<211> 22

<212> DNA

<213> mh11-134478240/245/322-R

<400> 260

tggaaaggac ccttctttgc ag 22

<210> 261

<211> 22

<212> DNA

<213> mh12-13420587/700/702-F

<400> 261

ttgacactct gggccttaat gg 22

<210> 262

<211> 22

<212> DNA

<213> mh12-13420587/700/702-R

<400> 262

caacaaggtg agagtcacag gt 22

<210> 263

<211> 22

<212> DNA

<213> mh12-29086729/787/889-F

<400> 263

cagggacttt ttctgcacag ga 22

<210> 264

<211> 22

<212> DNA

<213> mh12-29086729/787/889-R

<400> 264

tagcagctca ggcagctaga ta 22

<210> 265

<211> 22

<212> DNA

<213> mh12-52741299/328/333/407/428-F

<400> 265

ggaggcagaa aggaaaacat gc 22

<210> 266

<211> 22

<212> DNA

<213> mh12-52741299/328/333/407/428-R

<400> 266

ctctgacgat ttgcatttgg gc 22

<210> 267

<211> 22

<212> DNA

<213> mh12-64611235/285/299-F

<400> 267

gcttgggtca acgtgtaata gc 22

<210> 268

<211> 20

<212> DNA

<213> mh12-64611235/285/299-R

<400> 268

aaccggcgaa aaggttagct 20

<210> 269

<211> 24

<212> DNA

<213> mh12-78576646/704/730/815-F

<400> 269

ccactttagg accaggtcta aagg 24

<210> 270

<211> 28

<212> DNA

<213> mh12-78576646/704/730/815-R

<400> 270

gactttgatt tgaaccatgt atttgacc 28

<210> 271

<211> 23

<212> DNA

<213> mh12-93864450/453/506-F

<400> 271

gatgggaata ttagccccac aca 23

<210> 272

<211> 23

<212> DNA

<213> mh12-93864450/453/506-R

<400> 272

gagagctaca tttcaaggag gca 23

<210> 273

<211> 20

<212> DNA

<213> mh12-104583417/426/511/516/597-F

<400> 273

aatggggctc agctttgcat 20

<210> 274

<211> 22

<212> DNA

<213> mh12-104583417/426/511/516/597-R

<400> 274

catcaagaag tgctgaaggg gt 22

<210> 275

<211> 22

<212> DNA

<213> mh12-120495289/370/414-F

<400> 275

ccaaccaaga atctctccca ca 22

<210> 276

<211> 22

<212> DNA

<213> mh12-120495289/370/414-R

<400> 276

aaggagggag ggtgtttcct ta 22

<210> 277

<211> 22

<212> DNA

<213> mh13-24130689/693/782/792-F

<400> 277

tgctgataac atgctgacgg tt 22

<210> 278

<211> 22

<212> DNA

<213> mh13-24130689/693/782/792-R

<400> 278

tgtctcattc ctccgtagct ca 22

<210> 279

<211> 22

<212> DNA

<213> mh13-46330559/633/668-F

<400> 279

tcaccagacc agatacgagg tt 22

<210> 280

<211> 22

<212> DNA

<213> mh13-46330559/633/668-R

<400> 280

acgtccaagt acatgcacac ag 22

<210> 281

<211> 21

<212> DNA

<213> mh13-53365014/091/197-F

<400> 281

gcagtcctgg attgatcagc a 21

<210> 282

<211> 30

<212> DNA

<213> mh13-53365014/091/197-R

<400> 282

acaggagagt catcaattgt caattaaaag 30

<210> 283

<211> 24

<212> DNA

<213> mh13-75948926/8956/9019-F

<400> 283

caggaagccc atactatcaa caca 24

<210> 284

<211> 26

<212> DNA

<213> mh13-75948926/8956/9019-R

<400> 284

aacccgtctt agggcttata aattgt 26

<210> 285

<211> 25

<212> DNA

<213> mh13-86540463/512/659-F

<400> 285

gcttcgtgct agataaagcc ttatg 25

<210> 286

<211> 31

<212> DNA

<213> mh13-86540463/512/659-R

<400> 286

aaaaacacaa caatataaat gcattcatac a 31

<210> 287

<211> 23

<212> DNA

<213> mh13-96407596/649/753-F

<400> 287

gcgttcacct ggttagatag gtt 23

<210> 288

<211> 27

<212> DNA

<213> mh13-96407596/649/753-R

<400> 288

tccttttctt ttagcatttc ccttgtt 27

<210> 289

<211> 23

<212> DNA

<213> mh13-102654868/4972/5010-F

<400> 289

gctgtacaga tgacactgat gca 23

<210> 290

<211> 23

<212> DNA

<213> mh13-102654868/4972/5010-R

<400> 290

tgtcattctc cctctgaggt cag 23

<210> 291

<211> 24

<212> DNA

<213> mh13-114035629/633/707-F

<400> 291

ggtccctatc catctttctc agga 24

<210> 292

<211> 24

<212> DNA

<213> mh13-114035629/633/707-R

<400> 292

cacatctctc cagggttgta agag 24

<210> 293

<211> 23

<212> DNA

<213> mh14-20727667/710/808-F

<400> 293

agaagtaatc cttgctggac aca 23

<210> 294

<211> 23

<212> DNA

<213> mh14-20727667/710/808-R

<400> 294

ctagaacgtg aagaacccag tga 23

<210> 295

<211> 22

<212> DNA

<213> mh14-33572037/068/090/139-F

<400> 295

tgggctaatg caaaggacag ac 22

<210> 296

<211> 20

<212> DNA

<213> mh14-33572037/068/090/139-R

<400> 296

aaggcaccag gaatgcacaa 20

<210> 297

<211> 20

<212> DNA

<213> mh14-44538405/436/523-F

<400> 297

aggagtcctg tctgcactga 20

<210> 298

<211> 20

<212> DNA

<213> mh14-44538405/436/523-R

<400> 298

tgagccctgt gtcctacatg 20

<210> 299

<211> 22

<212> DNA

<213> mh14-67511789/809/813/925-F

<400> 299

gtcgcctttc agaaccatcc tt 22

<210> 300

<211> 22

<212> DNA

<213> mh14-67511789/809/813/925-R

<400> 300

ggaaaaggca gtggttttca cc 22

<210> 301

<211> 24

<212> DNA

<213> mh14-80998510/557/611-F

<400> 301

catgtttggt gggtgttaca aagg 24

<210> 302

<211> 24

<212> DNA

<213> mh14-80998510/557/611-R

<400> 302

gagagacagc caagattagc catt 24

<210> 303

<211> 22

<212> DNA

<213> mh14-90301415/512/516-F

<400> 303

ctgtcgggtt tgaagaaggt ga 22

<210> 304

<211> 27

<212> DNA

<213> mh14-90301415/512/516-R

<400> 304

tggattataa tactgtgtga gacgctt 27

<210> 305

<211> 19

<212> DNA

<213> mh14-104316322/414/453-F

<400> 305

tggcccatct tctgggact 19

<210> 306

<211> 19

<212> DNA

<213> mh14-104316322/414/453-R

<400> 306

ccaacctgga agcacctgt 19

<210> 307

<211> 26

<212> DNA

<213> mh15-27602580/609/747-F

<400> 307

caaccacccc ttcacatttt atgttc 26

<210> 308

<211> 22

<212> DNA

<213> mh15-27602580/609/747-R

<400> 308

tctgtggggt tctttttgtt gt 22

<210> 309

<211> 23

<212> DNA

<213> mh15-53159314/324/431-F

<400> 309

tcactaaata tggtcccgca agg 23

<210> 310

<211> 22

<212> DNA

<213> mh15-53159314/324/431-R

<400> 310

agacaagggc agaatggtga ac 22

<210> 311

<211> 22

<212> DNA

<213> mh15-69304596/621/651-F

<400> 311

taattctcac ccatgccctg tc 22

<210> 312

<211> 22

<212> DNA

<213> mh15-69304596/621/651-R

<400> 312

ctgaccatct tggtcaaagg gt 22

<210> 313

<211> 20

<212> DNA

<213> mh15-78831543/604/674/697-F

<400> 313

tggcacgcta ttgcattgtg 20

<210> 314

<211> 17

<212> DNA

<213> mh15-78831543/604/674/697-R

<400> 314

agcagcagcg aacaggt 17

<210> 315

<211> 23

<212> DNA

<213> mh15-91536647/714/773-F

<400> 315

actccaagga ggacaaatgc tag 23

<210> 316

<211> 23

<212> DNA

<213> mh15-91536647/714/773-R

<400> 316

caagactgtgcaggtgaat aga 23

<210> 317

<211> 22

<212> DNA

<213> mh15-101401241/328/414-F

<400> 317

ctagagacat tcggcagtgt ca 22

<210> 318

<211> 22

<212> DNA

<213> mh15-101401241/328/414-R

<400> 318

gcatctaagt ccacttgcct tg 22

<210> 319

<211> 18

<212> DNA

<213> mh16-828087/161/223/242-F

<400> 319

gggaacagcc cagctcag 18

<210> 320

<211> 21

<212> DNA

<213> mh16-828087/161/223/242-R

<400> 320

gttgtaggca ggtgtctgct t 21

<210> 321

<211> 27

<212> DNA

<213> mh16-19880935/0984/1051-F

<400> 321

ccattctaga acattcttac tggcctt 27

<210> 322

<211> 25

<212> DNA

<213> mh16-19880935/0984/1051-R

<400> 322

gagagtgaac tgtgtacccgtattc 25

<210> 323

<211> 21

<212> DNA

<213> mh16-28499072/134/216-F

<400> 323

gcggggataa cacaaacctc t 21

<210> 324

<211> 22

<212> DNA

<213> mh16-28499072/134/216-R

<400> 324

aacccctctc tgctcctaca tt 22

<210> 325

<211> 22

<212> DNA

<213> mh16-49595295/400/414-F

<400> 325

ttttcctccc caatgaggac ag 22

<210> 326

<211> 21

<212> DNA

<213> mh16-49595295/400/414-R

<400> 326

ggaaggcagg aagatgctag t 21

<210> 327

<211> 22

<212> DNA

<213> mh16-57674122/144/239-F

<400> 327

aagcgcaggg agagtatagt ca 22

<210> 328

<211> 22

<212> DNA

<213> mh16-57674122/144/239-R

<400> 328

tctccccaat ccatctctcc tt 22

<210> 329

<211> 23

<212> DNA

<213> mh16-76868825/950/953-F

<400> 329

acacagaaac actgctcaga gtc 23

<210> 330

<211> 26

<212> DNA

<213> mh16-76868825/950/953-R

<400> 330

acgtatagttttcacagtga tgacct 26

<210> 331

<211> 22

<212> DNA

<213> mh17-12218325/392/434/522-F

<400> 331

atgtgtggtg aagagaggat gg 22

<210> 332

<211> 22

<212> DNA

<213> mh17-12218325/392/434/522-R

<400> 332

cctttgcgaa actgcaaaaa cc 22

<210> 333

<211> 20

<212> DNA

<213> mh17-33970547/587/589/732-F

<400> 333

cgtggcatca cagttggact 20

<210> 334

<211> 21

<212> DNA

<213> mh17-33970547/587/589/732-R

<400> 334

gagtcagcct ggacaccttt c 21

<210> 335

<211> 26

<212> DNA

<213> mh17-40705403/505/528/533-F

<400> 335

ggtgcttcca gaaatagttt gtatcc 26

<210> 336

<211> 25

<212> DNA

<213> mh17-40705403/505/528/533-R

<400> 336

actcctgtga aaacagtaca ggtag 25

<210> 337

<211> 34

<212> DNA

<213> mh17-54617721/723/870-F

<400> 337

gatcaaatgt ctttatataa gaaaaacaga gttc 34

<210> 338

<211> 23

<212> DNA

<213> mh17-54617721/723/870-R

<400> 338

cagaatctca gaagttccct ggt 23

<210> 339

<211> 20

<212> DNA

<213> mh17-81067161/204/334-F

<400> 339

ttcccttcca gagcccaacc 20

<210> 340

<211> 20

<212> DNA

<213> mh17-81067161/204/334-R

<400> 340

tggagggtcc ccacagagtt 20

<210> 341

<211> 24

<212> DNA

<213> mh18-1648913/8946/9009-F

<400> 341

ggaaatgtac atgggaggag gaag 24

<210> 342

<211> 26

<212> DNA

<213> mh18-1648913/8946/9009-R

<400> 342

cgatgaagaa aattgtagcc ctaagc 26

<210> 343

<211> 22

<212> DNA

<213> mh18-11578129/218/238-F

<400> 343

aaatcatccc caccagaacc at 22

<210> 344

<211> 22

<212> DNA

<213> mh18-11578129/218/238-R

<400> 344

gcatgcatgt ggctttcatt tc 22

<210> 345

<211> 27

<212> DNA

<213> mh18-42056338/401/516-F

<400> 345

gttgtttgag ttttctgaca agaagga 27

<210> 346

<211> 27

<212> DNA

<213> mh18-42056338/401/516-R

<400> 346

acaggtgtag atacattttc cttggtt 27

<210> 347

<211> 22

<212> DNA

<213> mh18-52103231/255/320-F

<400> 347

tctcctgggc atccatttat gc 22

<210> 348

<211> 22

<212> DNA

<213> mh18-52103231/255/320-R

<400> 348

accaggctac ccaaatcatc ac 22

<210> 349

<211> 22

<212> DNA

<213> mh18-78243467/550/557/627-F

<400> 349

cccgattctg agcatcaagg aa 22

<210> 350

<211> 25

<212> DNA

<213> mh18-78243467/550/557/627-R

<400> 350

caagcataca tctggaggac aaaac 25

<210> 351

<211> 21

<212> DNA

<213> mh19-645780/797/801/903/934-F

<400> 351

gcttattcgc aagcccaaac c 21

<210> 352

<211> 17

<212> DNA

<213> mh19-645780/797/801/903/934-R

<400> 352

aggagcctgc tgcacga 17

<210> 353

<211> 22

<212> DNA

<213> mh19-32967227/289/331-F

<400> 353

acattgcctc acacctcata gg 22

<210> 354

<211> 22

<212> DNA

<213> mh19-32967227/289/331-R

<400> 354

ctcaccactt tggggatgaa ga 22

<210> 355

<211> 22

<212> DNA

<213> mh19-55911606/667/708-F

<400> 355

agttagagct gctccagacc at 22

<210> 356

<211> 22

<212> DNA

<213> mh19-55911606/667/708-R

<400> 356

agcagtcaca tccttgaaag gg 22

<210> 357

<211> 22

<212> DNA

<213> mh20-4334692/856/885-F

<400> 357

tcaccctaaa acctacccgg aa 22

<210> 358

<211> 21

<212> DNA

<213> mh20-4334692/856/885-R

<400> 358

acagtgcgct tctcttcaga c 21

<210> 359

<211> 21

<212> DNA

<213> mh20-12674881/4924/5006-F

<400> 359

gtgggctact gtgtatgcag a 21

<210> 360

<211> 22

<212> DNA

<213> mh20-12674881/4924/5006-R

<400> 360

gagaggtacc aagtgtggac ag 22

<210> 361

<211> 20

<212> DNA

<213> mh20-22330802/810/874/973-F

<400> 361

tctgcttgct tgtgcagtct 20

<210> 362

<211> 24

<212> DNA

<213> mh20-22330802/810/874/973-R

<400> 362

acaggacagt agaagatccc tacc 24

<210> 363

<211> 23

<212> DNA

<213> mh20-40717241/300/307-F

<400> 363

tggctggcat ttcttagagg atg 23

<210> 364

<211> 21

<212> DNA

<213> mh20-40717241/300/307-R

<400> 364

ctcttgggcg cctttattcc t 21

<210> 365

<211> 20

<212> DNA

<213> mh20-54160200/230/378-F

<400> 365

tcatacgagg gtgccaacac 20

<210> 366

<211> 20

<212> DNA

<213> mh20-54160200/230/378-R

<400> 366

gtcttcatgt ctgcggaggt 20

<210> 367

<211> 21

<212> DNA

<213> mh20-63124779/838/974-F

<400> 367

agaggaggga atggaggtga g 21

<210> 368

<211> 21

<212> DNA

<213> mh20-63124779/838/974-R

<400> 368

gttcatcctg acagccctca g 21

<210> 369

<211> 29

<212> DNA

<213> mh21-18775368/420/523-F

<400> 369

ggacttaaaa agtaaaacta ggctttgtg 29

<210> 370

<211> 26

<212> DNA

<213> mh21-18775368/420/523-R

<400> 370

agcaggaagtttgaacaaaa tggtta 26

<210> 371

<211> 29

<212> DNA

<213> mh21-30568687/804/813-F

<400> 371

ctgtatcagt ggtattccag aaaatatcc 29

<210> 372

<211> 29

<212> DNA

<213> mh21-30568687/804/813-R

<400> 372

ccatcccata tcaacatttt aaaggagaa 29

<210> 373

<211> 18

<212> DNA

<213> mh21-38685564/617/643/673-F

<400> 373

tgtggctccc caagtcca 18

<210> 374

<211> 18

<212> DNA

<213> mh21-38685564/617/643/673-R

<400> 374

gcatggtggc tccttgct 18

<210> 375

<211> 18

<212> DNA

<213> mh21-46138559/672/677-F

<400> 375

caggccaggt tcccacac 18

<210> 376

<211> 19

<212> DNA

<213> mh21-46138559/672/677-R

<400> 376

gtacctgggt gctgtgacg 19

<210> 377

<211> 23

<212> DNA

<213> mh22-22132253/415/434-F

<400> 377

accccatttc ctcatacatt gct 23

<210> 378

<211> 27

<212> DNA

<213> mh22-22132253/415/434-R

<400> 378

gtctgtccta ttatgtagcc ctttact 27

<210> 379

<211> 23

<212> DNA

<213> mh22-38109259/340/349-F

<400> 379

aggggaggaa aaaggtgtag aga 23

<210> 380

<211> 23

<212> DNA

<213> mh22-38109259/340/349-R

<400> 380

agcttagaac aggaccccaa aag 23

<210> 381

<211> 22

<212> DNA

<213> mh22-48867296/365/380-F

<400> 381

gagcactgtg atcaaaggct ca 22

<210> 382

<211> 22

<212> DNA

<213> mh22-48867296/365/380-R

<400> 382

cacattctgt tgctggaagg ga 22

<210> 383

<211> 24

<212> DNA

<213> rs2056688-F

<400> 383

ggatcatgat acctgcccaa catg 24

<210> 384

<211> 22

<212> DNA

<213>rs2056688-R

<400> 384

accacacgtg ttcacaccta ga 22

<210> 385

<211> 22

<212> DNA

<213>rs1534285-F

<400> 385

ccacaagact aagccaagac ca 22

<210> 386

<211> 22

<212> DNA

<213>rs1534285-R

<400> 386

acaggacgtc aattcaccag aa 22

<210> 387

<211> 21

<212> DNA

<213> rs763056-F

<400> 387

gaaagtcatc caccccagca t 21

<210> 388

<211> 21

<212> DNA

<213>rs763056-R

<400> 388

tacctgacct cctcttggca a 21

<210> 389

<211> 22

<212> DNA

<213>rs17316592-F

<400> 389

ccttctgtgt ttgtccagag gt 22

<210> 390

<211> 22

<212> DNA

<213>rs17316592-R

<400> 390

gttgccatct gtcccctctt aa 22

<210> 391

<211> 23

<212> DNA

<213> rs3900-F

<400> 391

ggaccctgaa atacagaact gca 23

<210> 392

<211> 26

<212> DNA

<213> rs3900-R

<400> 392

ctcatttttg aagctcgtga aacaga 26

<210> 393

<211> 22

<212> DNA

<213>rs13447352-F

<400> 393

tagagggtat tggggtaggc aa 22

<210> 394

<211> 22

<212> DNA

<213>rs13447352-R

<400> 394

atgccttcag gcttctagct tc 22

Claims (10)

1. A primer set for amplifying genetic markers of 191 human micro-haplotype loci, characterized in that: the nucleotide sequence of the primer is as follows:

1）SEQ ID NO.1-2；2）SEQ ID NO.3-4；3）SEQ ID NO.5-6；4）SEQ ID NO.7-8；5）SEQ ID NO.9-10；6）SEQ ID NO.11-12；7）SEQ ID NO.13-14；8）SEQ ID NO.15-16；9）SEQ ID NO.17-18；10）SEQ ID NO.19-20；11）SEQ ID NO.21-22；12）SEQ ID NO.23-24；13）SEQ ID NO.25-26；14）SEQ ID NO.27-28；15）SEQ ID NO.29-30；16）SEQ ID NO.31-32；17）SEQ ID NO.33-34；18）SEQ ID NO.35-36；19）SEQ ID NO.37-38；20）SEQ ID NO.39-40；21）SEQ ID NO.41-42；22）SEQ ID NO.43-44；23）SEQ ID NO.45-46；24）SEQ ID NO.47-48；25）SEQ ID NO.49-50；26）SEQ ID NO.51-52；27）SEQ ID NO.53-54；28）SEQ ID NO.55-56；29）SEQ ID NO.57-58；30）SEQ ID NO.59-60；31）SEQ ID NO.61-62；32）SEQ ID NO.63-64；33）SEQ ID NO.65-66；34）SEQ ID NO.67-68；35）SEQ ID NO.69-70；36）SEQ ID NO.71-72；37）SEQ ID NO.73-74；38）SEQ ID NO.75-76；39）SEQ ID NO.77-78；40）SEQ ID NO.79-80；41）SEQ ID NO.81-82；42）SEQ ID NO.83-84；43）SEQ ID NO.85-86；44）SEQ ID NO.87-88；45）SEQ ID NO.89-90；46）SEQ ID NO.91-92；47）SEQ ID NO.93-94；48）SEQ ID NO.95-96；49）SEQ ID NO.97-98；50）SEQ ID NO.99-100；51）SEQ ID NO.101-102；52）SEQ ID NO.103-104；53）SEQ ID NO.105-106；54）SEQ ID NO.107-108；55）SEQ ID NO.109-110；56）SEQ ID NO.111-112；57）SEQ ID NO.113-114；58）SEQ ID NO.115-116；59）SEQ ID NO.117-118；60）SEQ ID NO.119-120；61）SEQ ID NO.121-122；62）SEQ ID NO.123-124；63）SEQ ID NO.125-126；64）SEQ ID NO.127-128；65）SEQ ID NO.129-130；66）SEQ ID NO.131-132；67）SEQ ID NO.133-134；68）SEQ ID NO.135-136；69）SEQ ID NO.137-138；70）SEQ ID NO.139-140；71）SEQ ID NO.141-142；72）SEQ ID NO.143-144；73）SEQ ID NO.145-146；74）SEQ ID NO.147-148；75）SEQ ID NO.149-150；76）SEQ ID NO.151-152；77）SEQ ID NO.153-154；78）SEQ ID NO.155-156；79）SEQ ID NO.157-158；80）SEQ ID NO.159-160；81）SEQ ID NO.161-162；82）SEQ ID NO.163-164；83）SEQ ID NO.165-166；84）SEQ ID NO.167-168；85）SEQ ID NO.169-170；86）SEQ ID NO.171-172；87）SEQ ID NO.173-174；88）SEQ ID NO.175-176；89）SEQ ID NO.177-178；90）SEQ ID NO.179-180；91）SEQ ID NO.181-182；92）SEQ ID NO.183-184；93）SEQ ID NO.185-186；94）SEQ ID NO.187-188；95）SEQ ID NO.189-190；96）SEQ ID NO.191-192；97）SEQ ID NO.193-194；98）SEQ ID NO.195-196；99）SEQ ID NO.197-198；100）SEQ ID NO.199-200；101）SEQ ID NO.201-202；102）SEQ ID NO.203-204；103）SEQ ID NO.205-206；104）SEQ ID NO.207-208；105）SEQ ID NO.209-210；106）SEQ ID NO.211-212；107）SEQ ID NO.213-214；108）SEQ ID NO.215-216；109）SEQ ID NO.217-218；110）SEQ ID NO.219-220；111）SEQ ID NO.221-222；112）SEQ ID NO.223-224；113）SEQ ID NO.225-226；114）SEQ ID NO.227-228；115）SEQ ID NO.229-230；116）SEQ ID NO.231-232；117）SEQ ID NO.233-234；118）SEQ ID NO.235-236；119）SEQ ID NO.237-238；120）SEQ ID NO.239-240；121）SEQ ID NO.241-242；122）SEQ ID NO.243-244；123）SEQ ID NO.245-246；124）SEQ ID NO.247-248；125）SEQ ID NO.249-250；126）SEQ ID NO.251-252；127）SEQ ID NO.253-254；128）SEQ ID NO.255-256；129）SEQ ID NO.257-258；130）SEQ ID NO.259-260；131）SEQ ID NO.261-262；132）SEQ ID NO.263-264；133）SEQ ID NO.265-266；134）SEQ ID NO.267-268；135）SEQ ID NO.269-270；136）SEQ ID NO.271-272；137）SEQ ID NO.273-274；138）SEQ ID NO.275-276；139）SEQ ID NO.277-278；140）SEQ ID NO.279-280；141）SEQ ID NO.281-282；142）SEQ ID NO.283-284；143）SEQ ID NO.285-286；144）SEQ ID NO.287-288；145）SEQ ID NO.289-290；146）SEQ ID NO.291-292；147）SEQ ID NO.293-294；148）SEQ ID NO.295-296；149）SEQ ID NO.297-298；150）SEQ ID NO.299-300；151）SEQ ID NO.301-302；152）SEQ ID NO.303-304；153）SEQ ID NO.305-306；154）SEQ ID NO.307-308；155）SEQ ID NO.309-310；156）SEQ ID NO.311-312；157）SEQ ID NO.313-314；158）SEQ ID NO.315-316；159）SEQ ID NO.317-318；160）SEQ ID NO.319-320；161）SEQ ID NO.321-322；162）SEQ ID NO.323-324；163）SEQ ID NO.325-326；164）SEQ ID NO.327-328；165）SEQ ID NO.329-330；166）SEQ ID NO.331-332；167）SEQ ID NO.333-334；168）SEQ ID NO.335-336；169）SEQ ID NO.337-338；170）SEQ ID NO.339-340；171）SEQ ID NO.341-342；172）SEQ ID NO.343-344；173）SEQ ID NO.345-346；174）SEQ ID NO.347-348；175）SEQ ID NO.349-350；176）SEQ ID NO.351-352；177）SEQ ID NO.353-354；178）SEQ ID NO.355-356；179）SEQ ID NO.357-358；180）SEQ ID NO.359-360；181）SEQ ID NO.361-362；182）SEQ ID NO.363-364；183）SEQ ID NO.365-366；184）SEQ ID NO.367-368；185）SEQ ID NO.369-370；186）SEQ ID NO.371-372；187）SEQ ID NO.373-374；188）SEQ ID NO.375-376；189）SEQ ID NO.377-378；190）SEQ ID NO.379-380；191）SEQ ID NO.381-382。

2. use of a primer combination for amplifying genetic markers of 191 human micro-haplotype loci according to claim 1 for forensic identification for non-diagnostic purposes.

3. Use of a primer combination for amplifying genetic markers of 191 human micro-haplotype loci according to claim 1 for identification of individuals of non-diagnostic interest.

4. Use of a primer combination for amplifying genetic markers of 191 human micro-haplotype loci according to claim 1 for genetic relationship identification for non-diagnostic purposes.

5. Use of a primer combination for amplifying genetic markers of 191 human micro-haplotype loci according to claim 4 for genetic relationship identification for non-diagnostic purposes, wherein: the genetic relationship identification comprises paternity identification, isotactic cell identification and two-level genetic relationship identification with only two individuals participating in.

6. A forensic identification kit, characterized in that: a primer combination comprising the genetic markers for amplifying 191 human microsloid loci of claim 1.

7. The forensic identification kit of claim 6, wherein: also included are buffer solutions, DNA polymerase and dNTPs.

8. The method of using a forensic identification kit for non-diagnostic purposes according to claim 6 wherein: extracting genome DNA of a sample to be detected as a template, carrying out PCR amplification by using the kit, carrying out a linker sequence PCR reaction on the obtained amplification product to obtain a multiple PCR library, and carrying out quantitative and second-generation sequencing detection analysis on the multiple PCR library to obtain a typing result of the micro-haplotype locus.

9. The method of using a forensic identification kit for non-diagnostic purposes according to claim 8 in which: the PCR amplification system comprises the following reagents and the dosage:

；

the PCR amplification procedure was:

；

the system for PCR reaction of the linker sequence comprises the following reagents and the dosage:

；

the PCR reaction of the linker sequence is as follows:

。

10. the method of using a forensic identification kit for non-diagnostic purposes according to claim 9 wherein: the dosage of the genome DNA is 5ng-20ng;

and/or said amplifying 191 a mixture of primers genetically tagged to a human microsloid locus, each primer at a concentration of 5-10 μm.

Images