CN114292868A

CN114292868A - Application of rice plant height gene LOC _ Os03g64415 in rice plant type improvement

Info

Publication number: CN114292868A
Application number: CN202111635993.6A
Authority: CN
Inventors: 孔维龙; 李阳生; 邓霄霄; 周明骜; 张晨浩
Original assignee: Wuhan University WHU
Current assignee: Wuhan University WHU
Priority date: 2021-12-29
Filing date: 2021-12-29
Publication date: 2022-04-08

Abstract

The invention discloses application of a rice plant height gene LOC _ Os03g64415 in rice plant type improvement, belonging to the field of genetic breeding. The nucleotide sequence of the gene is shown as SEQ ID NO. 1; the CDS sequence corresponding to the gene is shown as SEQ ID NO.2, or is generated by adding, substituting or deleting one or more basic groups from the sequence shown as SEQ ID NO.2, and encodes a nucleotide sequence for controlling the height of the rice plant; the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO.3, or the amino acid sequence with the same function is formed by substituting, deleting or adding one or more amino acid residues. The improvement of the rice plant type including reduction of the plant height and increase of the tillering number is realized by reducing the expression of the gene or causing the function deletion mutation of the gene, and the different allelic gene types of the gene have wide application prospects in the aspects of optimizing the rice plant type and shaping an ideal plant type.

Description

Application of rice plant height gene LOC _ Os03g64415 in rice plant type improvement

Technical Field

The invention belongs to the field of genetic breeding, and particularly relates to application of a rice plant height gene LOC _ Os03g64415 in rice plant type improvement.

Background

The cultivation of high-yield and stable-yield rice (Oryza sativa L.) is an important guarantee for food safety in China. The method mainly comprises the following steps of analyzing the modern variety breeding of rice, wherein the modern variety breeding of rice is ideal plant type modeling breeding, namely, efficiently polymerizing excellent allelic forms of key genes of important agronomic characters related to the ideal plant type to form a super new variety. The key points of ideal plant type are large spike formation, proper tillering, plant height and thick stalk lodging resistance. The rice plant height character directly influences the whole rice plant shape, total biomass, lodging resistance, harvest index and the like, and becomes an ideal plant type phenotype which is mainly concerned and modeled.

The rice dwarf breeding and the popularization of semi-short-stalk varieties in the last 60 years revolutionize the rice breeding, and the research on the rice plant height becomes one of the important subjects of the research on the rice biology and plant type improvement. Although some results are obtained by means of cloning of the high QTL at present, most dwarf genes are obtained by using deformed dwarf mutants (granule dwarf and multi-tiller dwarf), and the deformed characteristics cannot be practically utilized in breeding, so that only a few high related genes are applied to rice breeding, such as DEP1 widely utilized in japonica rice and sd1 widely utilized in indica rice. The sd1 gene has self disadvantages, reduces plant height, reduces lodging and yield reduction, can reduce the utilization rate of nitrogen fertilizer while improving the yield of unit harvest, and has high dependence of rice yield increasing effect on chemical fertilizers. Therefore, the ideal rice plant height gene which can be used for true breeding still needs to be continuously explored and analyzed through a dominant rice variety derivative group, so that the short plate existing in the current plant height gene is filled, and more gene selections are provided for ideal rice breeding.

Following the green revolution, the three-line hybrid rice and the two-line hybrid rice, the modeling of the ideal plant type of the rice combined with the utilization of the indica-japonica hybrid vigor is regarded as an important breakthrough for further improving the rice yield. A new model of super hybrid rice molecular design breeding is proposed by Lijiayan academy and the like, namely super ideal indica-japonica subspecies interspecies hybrid seeds with ideal plant types and excellent quality are cultivated. Then, a plurality of multi-effect genes related to plant height are cloned in different indica-japonica hybrid populations, so that a good application effect is achieved in production, for example, an ideal plant type gene IPA1, the number of grains per ear, the plant height and the heading stage multi-effect control gene Ghd7 prove that the research on the utilization of the advantages of the ideal plant type and indica-japonica hybrid and the indehiscent plant height is carried out, and the analysis of new plant height genes in indica-japonica derived populations can further improve the yield of rice and optimize the plant type for driving protection. Therefore, new QTL and PH heterosis sites are searched in the rice fine variety derived population, and the method has important significance for ideal plant type breeding.

The LOC _ Os03g64415 gene has important significance in rice plant height regulation and ideal plant type breeding.

Disclosure of Invention

The invention aims to provide application of a rice plant height gene LOC _ Os03g64415 in rice plant type improvement.

The purpose of the invention is realized by the following technical scheme:

the invention provides application of a rice plant height gene LOC _ Os03g64415 in rice plant type improvement.

The protein coded by the rice plant height gene LOC _ Os03g64415 has an amino acid sequence shown as SEQ ID NO. 3; or an amino acid sequence with the same function formed by substituting, deleting or adding one or more amino acid residues in the amino acid sequence shown in SEQ ID NO. 3.

Further, the rice plant height gene LOC _ Os03g64415 has a CDS coding sequence shown in SEQ ID NO. 2; or generated by adding, substituting or deleting one or more bases in the nucleotide sequence shown in SEQ ID NO.2, and encodes the nucleotide sequence for controlling the height of the rice plant.

Furthermore, the nucleotide sequence of the rice plant height gene LOC _ Os03g64415 is shown as SEQ ID NO. 1.

The rice plant type improvement comprises the reduction of the rice plant height and the increase of the tillering number, and the rice plant type improvement can be realized by specifically reducing the expression of LOC _ Os03g64415 gene or making LOC _ Os03g64415 gene function deletion mutation.

In some embodiments, rice plant type improvement is achieved by knocking out the LOC _ Os03g64415 gene. The LOC _ Os03g64415 gene can be knocked out by a CRISPR/Cas9 system, and the sequences of sgRNA target 1 and target 2 of the LOC _ Os03g64415 gene are knocked out preferably:

the nucleotide sequence of target 1 (designed in the sense strand) of sgRNA is: CTCTCTCCCGAAGGCTGCTACGG (SEQ ID NO.4),

the nucleotide sequence of target 2 (designed in the antisense strand) of sgRNA is: CCGGAGGGGCCAGATCTGGCCGG (SEQ ID NO. 5).

The primer pair for detecting the transgenic plant with the LOC _ Os03g64415 gene knocked out by the CRISPR/Cas9 system is preferably as follows:

nucleotide sequence of primer JC-F: AGTCTTCGATATTCCCGTCCGTG (SEQ ID NO.6),

nucleotide sequence of primer JC-R: TCTTGCTCGCCGAAGTCGCTC (SEQ ID NO. 7).

Compared with the prior art, the beneficial results of the invention are as follows:

(1) the invention provides a stable dwarf rice variety for cultivating the dwarf rice variety by targeting a gene LOC _ Os03g64415 related to the rice plant type by a gene editing method; (2) the rice plant height trait gene has good regulation and control effect, the gene knockout strain can obviously reduce the rice plant height and increase the tillering number, and different allelic gene types of the gene have wide application prospect in the aspects of optimizing the rice plant type and shaping ideal plant types.

Drawings

FIG. 1 shows the sequence analysis and gene editing target design of rice LOC _ Os03g64415 gene. The blue boxes represent exons, the blue lines represent introns, and the white boxes represent untranslated regions. The 2 Cas9 recognition sites are shown as the figure, and the sequences are CTCTCTCCCGAAGGCTGCTACGG, CCGGAGGGGCCAGATCTGGCCGG respectively.

FIG. 2 Cas 9-mediated acquisition of different mutant genotypes of LOC _ Os03g 64415. WT is a wild-type sequence, and the Arabic number indicates the number of bases in which deletion or addition occurs (the number preceded by "-" indicates base deletion, and the number preceded by "+" indicates base addition).

FIG. 3 Cas 9-mediated phenotypic investigation of the different mutant genotype of LOC _ Os03g 64415. The whole plant morphology is inspected, the WT is a ZH11 wild type control plant, and qph-3.1 is a LOC _ Os03g64415 mutant line representative plant (qph-3.1-criprpr 1).

FIG. 4 Cas 9-mediated phenotypic investigation of the different mutant genotype of LOC _ Os03g 64415. Spike morphology study included: ear (left) and internode (right) under ear, WT is ZH11 wild type control plant, qph-3.1 is LOC _ Os03g64415 mutant line representative plant (qph-3.1-criprpr 1).

FIG. 5 Cas 9-mediated phenotypic investigation of the different mutant genotype of LOC _ Os03g 64415. In the long state examination of each internode, WT is a ZH11 wild-type control plant, qph-3.1 is LOC _ Os03g64415 mutant line representative plant (qph-3.1-criprpr 1). D2 represents the reciprocal two internodes, D3 represents the reciprocal three internodes, and D4 represents the reciprocal four internodes.

FIG. 6 statistical analysis of plant height and tiller number of different mutant genotype of LOC _ Os03g 64415. WT1, WT2 and WT3 are wild-type control plants of ZH11, and qph-3.1-criprpr 1, qph-3.1-criprpr 2 and qph-3.1-criprpr 3 are mutant strain plants. The 3 asterisks indicate p <0.001, the difference is very significant.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental methods used in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were all commercially available products unless otherwise specified.

Example 1 cloning of the Rice LOC _ Os03g64415 Gene

According to the LOC _ Os03g64415 gene sequence information recorded by Rice Genome Annotation Project (http:// Rice. uga. edu/index. shtml), a full-length primer sequence F is designed: ATGTCGTCGCCACCCGGCC (SEQ ID NO. 8); the sequence R: GCAACAGAGCATTTGAATTCCAATT (SEQ ID NO.9), LOC _ Os03g64415 full length CDS sequence can be obtained by amplification with Nipponbare genome cDNA as template, and the sequence is shown as SEQ ID NO.2 by sequencing.

Example 2 verification of the plant height regulating action of LOC _ Os03g64415 Gene in Rice Material

Crisper-cas9 gene knockout verification is carried out on LOC _ Os03g64415, a CRISPER-cas9 target site is designed by using a CRISPERDIRect website, the GC content of the target site is not less than 40 percent (50 to 70 percent), the screened 20bp target sequence is connected to the 5' end of the sgRNA sequence, and finally 2 target site sequences are respectively designed on the first exon of LOC _ Os03g64415, and the PAM sequence is NGG (figure 1).

According to the target site, a Crisper-cas9 gene knockout vector is constructed for LOC _ Os03g 64415. Transforming the knock-out vector into Agrobacterium by electrotransformation, transforming the recipient material ZH11 (Zhonghua 11) with Agrobacterium strain to obtain T₀Plant, planting T₀Obtaining T from positive plant₁And (5) positive plants. Extracting the genome DNA of the transformed plant, and performing amplification reaction by using a primer JC-F: AGTCTTCGATATTCCCGTCCGTG and primer JC-R: TCTTGCTCGCCGAAGTCGCTC and comparing the amplified PCR with the reference sequence (SEQ ID NO.2) to identify the editing condition of the transgenic plant. The specific editing situation is as follows: LOC _ Os03g64415 gene knockout obtains 2 1-base insertion mutant materials qph-3.1-criprpr 1 and qph-3.1-criprpr 3, and 1 4-base deletion mutant material qph-3.1-criprpr 2, and 3 homozygous mutant strains are obtained in total (figure 2). Compared with the ZH11 control material, the LOC _ Os03g64415 gene knockout mutant material has the advantages that the plant height (figure 3), the ear length (figure 4), the length between two inversed knots (figure 5) and the length between three inversed knots (figure 5) are all obviously reduced. In addition, LOC _ Os03g64415 gene knockout mutant material is found to have extremely delayed growth period, extremely reduced fruit setting rate and significantly increased tillering (FIGS. 4 and 6). These results show that LOC _ Os03g64415 can regulate the plant height of rice and has potential important value in creating rice dwarfing materials. And LOC _ Os03g64415 is a pleiotropic gene related to plant height, growth period, setting percentage and tillering, and the allelic gene type in the population has a utilization value in the ideal plant type modeling and sterile line creation, so that a selectable control target point is provided.

Although the present invention has been described above by way of specific embodiments, the present invention is not limited to these specific embodiments. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the scope of the invention encompassed by the appended claims. In addition, some terms used in the specification and claims of the present invention are not restrictive, but are merely for convenience of description.

Sequence listing

<110> Wuhan university

<120> application of rice plant height gene LOC _ Os03g64415 in rice plant type improvement

<160> 9

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2668

<212> DNA

<213> Oryza sativa

<400> 1

atgtcgtcgc cacccggccg ccgtcaccgc ccgctggcct ctcgccggag gggccagatc 60

tggccggcgc gacaaccccc gccgtcaagg cgcgccggtg tccccgccgt agcagccttc 120

gggagagaga gagcctcgcc accgccgtcc ctgcagccgc ccggcttgcc ggccagccgc 180

tcgtgcggcg atgaggcgga gggaggagag agggggtggc ggcggtgggt tgtggggagg 240

cgccgtccgg gtcgcctagg gacgggagcg acacggacgg gaatatcgaa gacttatgtt 300

tctagtgttg ttgctaagac tcttgcattg caggagctta aaggaaacat tcgagtcttc 360

tgtagggtgc gacctttatt gccaaatgaa tcaggagctg ttgcttatcc aaagagtgga 420

gaaaacttag gtcgtggcat tgagttgaca cataatggta tagtaacact tgctgcgatc 480

cttctgtgtt ttttactttc atatctgcac ctcttggaaa attcattcca gtaattcttc 540

atttttcttc acaggtcaaa tgtatttctt cacatttgac aaagtatttg agcagtcgac 600

atcacaagaa gatgtgttca ttgagatttc ccatctcgtc cagagcgccc ttgatggcta 660

caaggtaaca tttacttgtc gctgtgcttt gagaagtgca agagcacaac cccactatag 720

gagtgggaaa aaagtttaag tccacaaaag ttagtatcta taattcgtgc tagctaatgt 780

gaaaacaact caggtgtgca tatttgcata tggccaaact ggctcgggta aaacatacac 840

aatgatggga aatccagaat tacatgacca gaaaggatta attccgagat cacttgaaca 900

aattttccaa acaagccagg ctcttatttc acagggatgg aaatataaga tgcaggtgag 960

ttcttaccca cttcaattgg tcagtttgtt tgagctaaca aaggtgcagg ctttctatag 1020

ttgtaactct catgtttacc tttgaacatc taggcatcta tgttggaaat ctacaatgaa 1080

gccatatgtg atctgctagc cactaatcac acaactattc aagatggtgg cgcttcaaag 1140

tacagtatca agcatgatgc caatggtaat acccatgtat cagatctcat aatcgtcgat 1200

gtgttgagta tcaatgaagt ttcttctctc ctcaagcggg ctgctcagag caggttgcac 1260

tctagttctt ctcatcagtt tttcaaatct tcaattaaat ttgtaagaac agaagaacag 1320

aaagaaggca aagaacctgg atatagtttc tgtgagcaca tagaaacata atcaggtagt 1380

cataaggcct gaagtgaagt tagaagcata atttcaatga aatgtaataa gtcaaaaact 1440

ggcattatta tgactccatt ttcacaatca tggtatcaac atttgtgcct tacatactgt 1500

tgtgctataa aatgcacgat aatttagctg aattctccaa gaaagaaaat ttgctgccat 1560

acgttgtaaa cagctttatt atttatctgc agatctgttg gaagaacaca gatgaacgaa 1620

gaatcatcta gaagtcattg tgtgttcacg cttcgatttt ttggtgtcaa tgaggtatgc 1680

gatatcttct aatgtaggtc ttgctaatgc ctggtaattt tttgtagtca tcatttggat 1740

tgttttctct acagggaaca gaccagcagg tgcaaggagt gctcaatcta atcgatcttg 1800

ccggcagtga gcggcttaac aagagcggtg ccaccggaga taggctaaag gagacacagg 1860

taatttgcta tttcacacct cagtttttgt tgcatctaag gtgtatacat ggtacaatgc 1920

gtaaccactg ttgtgatgta aatttgctat ttaggctatt aataaaagcc tctcgtgctt 1980

gagcgatgta atcttctcca ttgcaaagaa agaggagcac gttccattca ggaactcaaa 2040

attaacgtac ctgctacagg taaattctaa gcactcagct aagaatatct gcaaacttgg 2100

tatggtttcc atggttataa tgtgtgaatg attttgttcc ccttggacaa agccatgcct 2160

tggaggagac tcgaagacac ttatgtttgt gaatctgtct ccagaggtgt cgtctacagg 2220

ggagtcaatt tgctcgctac ggttcgcagc acgggtgaac tcgtgcgaga ttggcatccc 2280

tcgtcgtcaa acccaagtgc gtagcttggc gcaaggatga gttggcttgg acaagatgaa 2340

tgtccatgac taattgtatt tgtgtgttgt ttgagggatg caatggatca tttgcatccc 2400

ctccgtgtgt tgggcatggg catatttgct tagagggtgt gtataatatt ctgatttggc 2460

atgtggcttt gttgattgta ggagcatcgc attgcattac agatagtagt atttaatttg 2520

tggctgcagc actgtgcagt ggtagtaaca agatgtgagg ttggttgtat tttattggag 2580

aggtgccctg tgttgtgttg ggctggcttt gtttggatga agaagacaga ctagtaattg 2640

gaattcaaat gctctgttgc tttttagt 2668

<210> 2

<211> 1389

<212> DNA

<213> Oryza sativa

<400> 2

atgtcgtcgc cacccggccg ccgtcaccgc ccgctggcct ctcgccggag gggccagatc 60

tggccggcgc gacaaccccc gccgtcaagg cgcgccggtg tccccgccgt agcagccttc 120

gggagagaga gagcctcgcc accgccgtcc ctgcagccgc ccggcttgcc ggccagccgc 180

tcgtgcggcg atgaggcgga gggaggagag agggggtggc ggcggtgggt tgtggggagg 240

cgccgtccgg gtcgcctagg gacgggagcg acacggacgg gaatatcgaa gacttatgtt 300

tctagtgttg ttgctaagac tcttgcattg caggagctta aaggaaacat tcgagtcttc 360

tgtagggtgc gacctttatt gccaaatgaa tcaggagctg ttgcttatcc aaagagtgga 420

gaaaacttag gtcgtggcat tgagttgaca cataatggtc aaatgtattt cttcacattt 480

gacaaagtat ttgagcagtc gacatcacaa gaagatgtgt tcattgagat ttcccatctc 540

gtccagagcg cccttgatgg ctacaaggtg tgcatatttg catatggcca aactggctcg 600

ggtaaaacat acacaatgat gggaaatcca gaattacatg accagaaagg attaattccg 660

agatcacttg aacaaatttt ccaaacaagc caggctctta tttcacaggg atggaaatat 720

aagatgcagg catctatgtt ggaaatctac aatgaagcca tatgtgatct gctagccact 780

aatcacacaa ctattcaaga tggtggcgct tcaaagtaca gtatcaagca tgatgccaat 840

ggtaataccc atgtatcaga tctcataatc gtcgatgtgt tgagtatcaa tgaagtttct 900

tctctcctca agcgggctgc tcagagcaga tctgttggaa gaacacagat gaacgaagaa 960

tcatctagaa gtcattgtgt gttcacgctt cgattttttg gtgtcaatga gggaacagac 1020

cagcaggtgc aaggagtgct caatctaatc gatcttgccg gcagtgagcg gcttaacaag 1080

agcggtgcca ccggagatag gctaaaggag acacaggcta ttaataaaag cctctcgtgc 1140

ttgagcgatg taatcttctc cattgcaaag aaagaggagc acgttccatt caggaactca 1200

aaattaacgt acctgctaca gccatgcctt ggaggagact cgaagacact tatgtttgtg 1260

aatctgtctc cagaggtgtc gtctacaggg gagtcaattt gctcgctacg gttcgcagca 1320

cgggtgaact cgtgcgagat tggcatccct cgtcgtcaaa cccaagtgcg tagcttggcg 1380

caaggatga 1389

<210> 3

<211> 462

<212> PRT

<213> Oryza sativa

<400> 3

Met Ser Ser Pro Pro Gly Arg Arg His Arg Pro Leu Ala Ser Arg Arg

1 5 10 15

Arg Gly Gln Ile Trp Pro Ala Arg Gln Pro Pro Pro Ser Arg Arg Ala

20 25 30

Gly Val Pro Ala Val Ala Ala Phe Gly Arg Glu Arg Ala Ser Pro Pro

35 40 45

Pro Ser Leu Gln Pro Pro Gly Leu Pro Ala Ser Arg Ser Cys Gly Asp

50 55 60

Glu Ala Glu Gly Gly Glu Arg Gly Trp Arg Arg Trp Val Val Gly Arg

65 70 75 80

Arg Arg Pro Gly Arg Leu Gly Thr Gly Ala Thr Arg Thr Gly Ile Ser

85 90 95

Lys Thr Tyr Val Ser Ser Val Val Ala Lys Thr Leu Ala Leu Gln Glu

100 105 110

Leu Lys Gly Asn Ile Arg Val Phe Cys Arg Val Arg Pro Leu Leu Pro

115 120 125

Asn Glu Ser Gly Ala Val Ala Tyr Pro Lys Ser Gly Glu Asn Leu Gly

130 135 140

Arg Gly Ile Glu Leu Thr His Asn Gly Gln Met Tyr Phe Phe Thr Phe

145 150 155 160

Asp Lys Val Phe Glu Gln Ser Thr Ser Gln Glu Asp Val Phe Ile Glu

165 170 175

Ile Ser His Leu Val Gln Ser Ala Leu Asp Gly Tyr Lys Val Cys Ile

180 185 190

Phe Ala Tyr Gly Gln Thr Gly Ser Gly Lys Thr Tyr Thr Met Met Gly

195 200 205

Asn Pro Glu Leu His Asp Gln Lys Gly Leu Ile Pro Arg Ser Leu Glu

210 215 220

Gln Ile Phe Gln Thr Ser Gln Ala Leu Ile Ser Gln Gly Trp Lys Tyr

225 230 235 240

Lys Met Gln Ala Ser Met Leu Glu Ile Tyr Asn Glu Ala Ile Cys Asp

245 250 255

Leu Leu Ala Thr Asn His Thr Thr Ile Gln Asp Gly Gly Ala Ser Lys

260 265 270

Tyr Ser Ile Lys His Asp Ala Asn Gly Asn Thr His Val Ser Asp Leu

275 280 285

Ile Ile Val Asp Val Leu Ser Ile Asn Glu Val Ser Ser Leu Leu Lys

290 295 300

Arg Ala Ala Gln Ser Arg Ser Val Gly Arg Thr Gln Met Asn Glu Glu

305 310 315 320

Ser Ser Arg Ser His Cys Val Phe Thr Leu Arg Phe Phe Gly Val Asn

325 330 335

Glu Gly Thr Asp Gln Gln Val Gln Gly Val Leu Asn Leu Ile Asp Leu

340 345 350

Ala Gly Ser Glu Arg Leu Asn Lys Ser Gly Ala Thr Gly Asp Arg Leu

355 360 365

Lys Glu Thr Gln Ala Ile Asn Lys Ser Leu Ser Cys Leu Ser Asp Val

370 375 380

Ile Phe Ser Ile Ala Lys Lys Glu Glu His Val Pro Phe Arg Asn Ser

385 390 395 400

Lys Leu Thr Tyr Leu Leu Gln Pro Cys Leu Gly Gly Asp Ser Lys Thr

405 410 415

Leu Met Phe Val Asn Leu Ser Pro Glu Val Ser Ser Thr Gly Glu Ser

420 425 430

Ile Cys Ser Leu Arg Phe Ala Ala Arg Val Asn Ser Cys Glu Ile Gly

435 440 445

Ile Pro Arg Arg Gln Thr Gln Val Arg Ser Leu Ala Gln Gly

450 455 460

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ctctctcccg aaggctgcta cgg 23

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ccggaggggc cagatctggc cgg 23

<210> 6

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

agtcttcgat attcccgtcc gtg 23

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

tcttgctcgc cgaagtcgct c 21

<210> 8

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

atgtcgtcgc cacccggcc 19

<210> 9

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

gcaacagagc atttgaattc caatt 25

Claims

1. The application of the rice plant height gene LOC _ Os03g64415 in improving the rice plant type is characterized in that:

the protein coded by the rice plant height gene LOC _ Os03g64415 has an amino acid sequence shown as SEQ ID NO. 3; or an amino acid sequence with the same function formed by the substitution, deletion or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO. 3;

the rice plant type improvement comprises the reduction of the rice plant height.

2. The application of the rice plant height gene LOC _ Os03g64415 in improving the rice plant type according to claim 1, wherein the application comprises the following steps: the rice plant type improvement also comprises the increase of tillering number.

3. The application of the rice plant height gene LOC _ Os03g64415 in improving the rice plant type according to claim 1, wherein the application comprises the following steps: the rice plant height gene LOC _ Os03g64415 has a coding sequence shown as SEQ ID NO. 2; or generated by adding, substituting or deleting one or more bases in the nucleotide sequence shown in SEQ ID NO.2, and encodes the nucleotide sequence for controlling the height of the rice plant.

4. The application of the rice plant height gene LOC _ Os03g64415 in improving the rice plant type according to claim 1, wherein the application comprises the following steps: the nucleotide sequence of the rice plant height gene LOC _ Os03g64415 is shown as SEQ ID No. 1.

5. The use of the rice plant height gene LOC _ Os03g64415 in rice plant type improvement according to any one of claims 1 to 4, wherein: the rice plant type is improved by reducing the expression of LOC _ Os03g64415 gene or making LOC _ Os03g64415 gene function deletion mutation.

6. The application of the rice plant height gene LOC _ Os03g64415 in improving the rice plant type according to claim 5, wherein the application comprises the following steps: the improvement of the rice plant type is realized by knocking out LOC _ Os03g64415 gene.

7. The application of the rice plant height gene LOC _ Os03g64415 in improving the rice plant type according to claim 6, wherein the application comprises the following steps: the sequence of the sgRNA target 1 and the target 2 of the LOC _ Os03g64415 gene knocked out by the CRISPR/Cas9 system is as follows:

target 1 of sgRNA: CTCTCTCCCGAAGGCTGCTACGG the flow of the air in the air conditioner,

target 2 of sgRNA: CCGGAGGGGCCAGATCTGGCCGG are provided.

8. The use of the rice plant height gene LOC _ Os03g64415 in rice plant type improvement according to claim 7, wherein: the primer pair for detecting the transgenic plant with the LOC _ Os03g64415 gene knocked out by the CRISPR/Cas9 system is as follows:

primer JC-F: AGTCTTCGATATTCCCGTCCGTG the flow of the air in the air conditioner,

primer JC-R: TCTTGCTCGCCGAAGTCGCTC are provided.