CN114250323A - HSV1/HSV2/VZV virus triple fluorescent PCR detection kit and using method thereof - Google Patents
HSV1/HSV2/VZV virus triple fluorescent PCR detection kit and using method thereof Download PDFInfo
- Publication number
- CN114250323A CN114250323A CN202111611241.6A CN202111611241A CN114250323A CN 114250323 A CN114250323 A CN 114250323A CN 202111611241 A CN202111611241 A CN 202111611241A CN 114250323 A CN114250323 A CN 114250323A
- Authority
- CN
- China
- Prior art keywords
- seq
- hsv2
- hsv1
- vzv
- virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
- C12Q1/705—Specific hybridization probes for herpetoviridae, e.g. herpes simplex, varicella zoster
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an HSV1/HSV2/VZV virus triple fluorescent PCR detection kit, which comprises a primer and a probe which can simultaneously detect HSV1gB gene, HSV2gB gene and VZV gB gene, Taq polymerase, dNTPs, Tris-HCl and MgSO4And an enhancer. The kit of the invention adopts the locked nucleic acid probe and the PCR reinforcing agent, can simultaneously detect the 3 viruses, has the detection limit of 1000copies/mL, has no cross reaction with measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human immunodeficiency virus infection samples, and has higher sensitivity and specificity.
Description
Technical Field
The invention relates to the technical field of biology, in particular to an HSV1/HSV2/VZV virus triple fluorescent PCR detection kit and a using method thereof.
Background
Herpes viruses (herpesviruses) are a group of enveloped DNA viruses with similar biological properties and can be classified into three major classes, α, β, and γ. It infects a wide range of hosts, mainly affecting the skin, mucous membranes and nervous tissues, and seriously affecting the health of humans and other animals. Herpes-like diseases can be caused by Herpes Simplex Virus (HSV) and Varicella-Zoster Virus (VZV), which are common pathogenic sources of skin diseases, among the alpha herpes viruses. HSV including type 1 and type 2 can infect skin mucosa except genitals and genitals respectively to cause herpes simplex, can be attacked when the immunity of a body is poor, has light general symptoms, short course of disease and repeated attack, and can be gradually cured when the immunity of the body is enhanced. VZV can cause herpes zoster, the disease always goes along the nerve and is in a strip shape, and antiviral treatment and immune enhancement treatment are combined, so that the virus can be immunized for a long time after healing. Herpes diseases caused by HSV1/HSV2/VZV can have different consequences, different treatment strategies are needed, and accurate identification of the three viruses HSV1/HSV2/VZV is important for selecting the correct treatment strategy.
Disclosure of Invention
In view of the above, the invention provides a triple fluorescent PCR detection kit for HSV1/HSV2/VZV virus, which can simultaneously detect 3 viruses, namely HSV1, HSV2 and VZV, and has higher sensitivity and specificity, and a use method thereof.
The technical scheme of the invention is realized as follows: the invention provides an HSV1/HSV2/VZV virus triple fluorescent PCR detection kit, which comprises primers and probes capable of simultaneously detecting HSV1gB gene, HSV2gB gene and VZV gB gene:
the primer and the probe for detecting HSV1gB genes comprise a forward primer shown by SEQ ID NO. 1, a reverse primer shown by SEQ ID NO. 2 and a probe shown by SEQ ID NO. 3;
the primers and the probes for detecting HSV2gB genes comprise a forward primer shown by SEQ ID NO. 4, a reverse primer shown by SEQ ID NO. 5 and a probe shown by SEQ ID NO. 6;
the primer and the probe for detecting the VZV gB gene comprise a forward primer shown by SEQ ID NO. 7, a reverse primer shown by SEQ ID NO. 8 and a probe shown by SEQ ID NO. 9;
on the basis of the technical scheme, preferably, the probes shown by SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are all nucleic acid-locked modified probes, the 5 'ends of the probes are all marked with fluorescent groups, and the 3' ends of the probes are all marked with quenching groups.
On the basis of the above technical scheme, preferably, the bases of 1 or more positions of the probes shown as SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are modified by locked nucleic acid.
Based on the above technical solution, preferably, 1 or more bases of 9 th, 11 th, 12 th, 15 th and 17 th positions from the 5' end of the probe shown by SEQ ID NO 3, SEQ ID NO 6 and SEQ ID NO 9 are modified by a locked nucleic acid.
On the basis of the technical scheme, preferably, Taq polymerase, dNTPs, Tris-HCl and MgSO (magnesium sulfate) are also included4And an enhancer.
On the basis of the technical scheme, preferably, the enhancer is TMAC and PEG 6000.
Based on the technical scheme, preferably, the final concentration of the Taq polymerase is 8-12U, dNTPs, and the final concentration of the Taq polymerase is 0.05-0.10mmol/L, Tris-HCl, and the final concentration of the Taq polymerase is 50-60mmol/L, MgSO4The final concentration of the PEG6000 is 5-8mmol/L, TMAC, the final concentration is 15-25mmol/L, and the mass fraction of the PEG6000 is 3-7%.
On the basis of the above technical scheme, preferably, the fluorophore is one or more of FAM, HEX, TET, JOE, VIC, ROX, Cy3 and Cy5, and the quencher is one or more of TAMRA, BHQ1, BHQ2 and DABCYL.
On the basis of the technical scheme, preferably, the concentrations of the primers shown by SEQ ID NO 1-2, SEQ ID NO 4-5 and SEQ ID NO 7-8 are all 0.25-0.35 mu mol/L, and the concentrations of the probes shown by SEQ ID NO 3, SEQ ID NO 6 and SEQ ID NO 9 are all 0.08-0.15 mu mol/L.
The invention also provides a use method of the HSV1/HSV2/VZV virus triple fluorescent PCR detection kit, which comprises the following steps:
s1, diluting HSV1 pseudovirus, HSV2 pseudovirus and VZV pseudovirus with negative serum, and extracting template DNA;
and S2, carrying out template DNA amplification detection, and judging the existence and genotype of HSV1gB gene, HSV2gB gene and VZV gB gene in the sample by using the intensity of fluorescence signals of the amplification template of three detection channels on a fluorescence PCR instrument and a cycle threshold value.
The invention also provides an application of the HSV1/HSV2/VZV virus triple fluorescent PCR detection kit in clinical detection, and the herpes virus is clinically detected by using the kit and the detection method.
Compared with the prior art, the triple fluorescent PCR detection kit for HSV1/HSV2/VZV virus and the use method thereof have the following beneficial effects:
(1) the probe is a locked nucleic acid probe, the 5' end of the probe is marked with different fluorescent groups, the 3' end of the probe is marked with different quenching groups, the 2' -O,4' -C position of beta-D-ribofuranose in the structure forms an annular oxygen methylene bridge, a sulfur methylene bridge or an amine methylene bridge rigid condensation structure through different glycidyl actions, the annular bridge locks the N configuration of the furanose C3' -endo form, the flexibility of a ribose structure is reduced, and the stability of a phosphate framework local structure is increased. According to the invention, the locked nucleic acid probe is added, so that the target fragment is enriched in the PCR process, and the detection sensitivity and specificity are further improved.
(2) TMAC and PEG6000 in the PCR buffer solution can improve the DNA denaturation and renaturation condition, remove non-specific amplification and improve the reaction efficiency and specificity.
(3) The kit can simultaneously detect 3 viruses including HSV1, HSV2 and VZV, has the detection limit of 1000copies/mL, has no cross reaction with measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human cytomegalovirus infected samples, and has no false positive.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
FIG. 1 is a graph of fluorescence amplification of HSV1 according to the invention;
FIG. 2 is a graph of fluorescence amplification of HSV2 according to the invention;
FIG. 3 is a graph of the fluorescence amplification of a VZV of the present invention;
FIG. 4 is a fluorescence amplification curve diagram of a sample for detecting measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human cytomegalovirus infection by using the kit of the present invention.
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention.
Design of HSV1, HSV2, and VZV primers and probes:
the primer and the probe sequence of the gB gene sequence of herpes simplex virus type 1 (HSV1) are as follows:
a forward primer: 5'-GACATCGACACGGTCATC-3' (SEQ ID NO: 1);
reverse primer: 5'-ATCCCCTCGAAGAACGC-3' (SEQ ID NO: 2);
and (3) probe: 5'-ACGCCGACGCCAACGCCGCC-3' (SEQ ID NO: 3).
The sequences amplified by PCR were: GACATCGACACGGTCATCCACGCCGACGCCAACGCCGCCATGTTTGCGGGCCTGGGCGCGTTCTTCGAGGGGAT (SEQ ID NO: 10).
The primer and the probe sequence of the gB gene sequence of herpes simplex virus type 2 (HSV2) are as follows:
a forward primer: 5'-ACATCGACACGGTCATCC-3' (SEQ ID NO: 4);
reverse primer: 5'-TCCCATGACGACCTTGCC-3' (SEQ ID NO: 5);
a fluorescent probe: 5'-ATCCCCTCGAAGAACGCGCACAGCC-3' (SEQ ID NO: 6).
The sequences amplified by PCR were: ACATCGACACGGTCATCCGCGCCGACGCCAACGCCGCCATGTTCGCGGGGCTGTGCGCGTTCTTCGAGGGGATGGGGGACTTGGGGCGCGCGGTCGGCAAGGTCGTCATGGGA (SEQ ID NO: 11).
The varicella-zoster virus (VZV) gB gene sequence primer and probe sequence are as follows:
a forward primer: 5'-TCCAAAGCATGGCATACTACCAA-3' (SEQ ID NO: 7);
reverse primer: 5'-TCCTCAATGATGCAATTCACCG-3' (SEQ ID NO: 8);
and (3) probe: 5'-TTCCGGGGGTTCCGGCAACCATGTAC-3' (SEQ ID NO: 9).
The sequences amplified by PCR were: TCCAAAGCATGGCATACTACCAATGACACGTACATGGTTGCCGGAACCCCCGGAACATATAGGACGGGCACGTCGGTGAATTGCATCATTGAGGA (SEQ ID NO: 12).
The probe is a probe modified by locked nucleic acid, and 1 or more bases of 9 th, 11 th, 12 th, 15 th and 17 th positions from the 5' end of the probe shown in SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are modified by locked nucleic acid. The locked nucleic acid is an oligonucleotide or an oligonucleotide derivative containing one or more locked nucleic acid monomers, namely 2' -O,4' -C-methylene-beta-D-ribofuranose, and the 2' -O,4' -C position of the beta-D-ribofuranose forms a ring-shaped oxygen methylene bridge, sulfur methylene bridge or amine methylene bridge rigid condensation structure through different glycidation, and the ring bridge locks the N configuration of the C3' -endo form of the furanose, so that the flexibility of the ribose structure is reduced, and the stability of the partial structure of the phosphate skeleton is increased. The locked nucleic acid has good identification capability and strong affinity to DNA and RNA, and is not easy to be enzymolyzed, so that the complex formed by combining the locked nucleic acid serving as a probe and an RNA/DNA chain has high thermal stability. The mismatch of one base can greatly reduce the melting temperature (Tm value) of RNA/DNA, and a locked nucleic acid probe is added to enrich a target segment in the PCR process, thereby further improving the detection sensitivity and specificity.
The 5' end of the probe is labeled with different fluorophores: FAM, HEX, TET, JOE, VIC, ROX, Cy3, and Cy5, the 3' end labeled with different quenching groups: TAMRA, BHQ1, BHQ2 and DABCYL, in this example, locked nucleic acid modified fluorescent probes are shown in table 1:
TABLE 1 fluorescent probes
Remarking: wherein the lower case letters indicate that the base is modified by the locked nucleic acid.
The PCR amplification reaction system comprises: primers and probes shown as SEQ ID NO. 1-9, Taq polymerase, dNTPs, Tris-HCl and MgSO4And enhancers TMAC and PEG 6000.
Wherein the primer concentrations shown by SEQ ID NO. 1-2, SEQ ID NO. 4-5 and SEQ ID NO. 7-8 are all 0.25-0.35 mu mol/L, and the probe concentrations shown by SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are all 0.08-0.15 mu mol/L.
The final concentration of Taq polymerase is 8-12U, dNTPs, the final concentration of Taq polymerase is 0.05-0.10mmol/L, Tris-HCl, and the final concentration of Taq polymerase is 50-60mmol/L, MgSO4The final concentration of (b) is 5-8mmol/L, Tris-HCl is 50-60mmol/L, MgSO4The final concentration of the PEG-N-methyl-propyl-N-methyl-N-methyl-propyl-ethyl-methyl-propyl-methyl-propyl-ethyl-propyl-methyl-propyl-ethyl-methyl-propyl-ethyl-propyl-butyl-ethyl-propyl-methyl-propyl-ethyl-propyl-methyl-propyl-ethyl-propyl-butyl-propyl-butyl-methyl-propyl-butyl-propyl-butyl-propyl-methyl-butyl-propyl-ethyl-propyl-methyl-ethyl-propyl-ethyl-propyl-butyl alcohol is 5-methyl-propyl-methyl-propyl-butyl-propyl-butyl-methyl-propyl-methyl-propyl-butyl.
In this example, the components and contents of the PCR reaction solution are shown in Table 2.
TABLE 2 PCR reaction solution composition and concentration
| Components | Volume/concentration in each reaction |
| Taq | 9U |
| dNTPs | 0.08mmol/L |
| Tris-HCL | 52mmol/L |
| MgSO4 | 6mmol/L |
| TMAC | 18mmol/L |
| PEG 6000 | 4％ |
| SEQ ID NO:1-2、4-5、7-8 | 0.3μmol/L |
| SEQ ID NO:3、6、9 | 0.1μmol/L |
| Adding sterile water | To 45 μ L |
TMAC and PEG6000 in the PCR reaction solution can improve the DNA denaturation and renaturation condition and remove non-specific amplification, and the kit carries out targeted optimization on each component, thereby improving the reaction efficiency and specificity.
A PCR amplification step:
(1) taking pseudovirion particles respectively containing HSV1, HSV2 and VZV genomes, and diluting the pseudovirion particles to 10 degrees with negative serum6copies/mL, 5000copies/mL, and 1000 copies/mL. Extracting nucleic acid with nucleic acid extraction reagent of Wuhanbaitai genetic engineering Co., Ltd, wherein 106The copies/mL and 5000copies/mL were extracted 10 times each, and the 1000copies/mL was extracted 20 times.
(2) A reaction system was prepared in 45. mu.L/reaction in accordance with the PCR amplification system described herein, and 45. mu.L/reaction solution + 5. mu.L of sample nucleic acid were mixed.
(3) And (3) PCR amplification: reverse transcription at 50 ℃ for 2min for 1 cycle; pre-denaturation at 95 ℃ for 3min for 1 cycle; denaturation at 95 ℃ for 10s, annealing at 60 ℃ and extension for 1min, collecting fluorescence signals, and performing denaturation, annealing and extension for 40 cycles. The results are shown in FIGS. 1-3.
As shown in FIGS. 1-3, the sample concentration is 106The copies/mL, 5000copies/mL detection 10 times have good repeatability, 1000copies/mL detection 20 times have good repeatability, all have obvious S-shaped amplification curves, all show positive, show that the detection limit of 3 viruses of the kit can reach 1000copies/mL, and the specificity is good.
TABLE 3 kit precision
Table 3 shows the respective viruses 106Average Ct values of copies/mL and 5000copies/mL concentration measurements 10 times, indicating a sample concentration of 106CV average values of less than 5% when the copies/mL and 5000copies/mL are detected for 10 times indicate that the reagent has good repeatability.
In order to prove the cross reactivity of the kit, the kit and the detection method are utilized to verify the specificity of a detection system, and the detection is carried out on measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human cytomegalovirus samples, and the detection steps are as follows:
(1) measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human cytomegalovirus are extracted by nucleic acid extraction reagent of Wuhanbaitai gene engineering Co.
(2) A reaction system was prepared in 45. mu.L/reaction in accordance with the PCR amplification system described herein, and 45. mu.L/reaction solution + 5. mu.L of sample nucleic acid were mixed.
(3) And (3) PCR amplification: reverse transcription at 50 ℃ for 2min for 1 cycle; pre-denaturation at 95 ℃ for 3min for 1 cycle; denaturation at 95 ℃ for 10s, annealing at 60 ℃ and extension for 1min, collecting fluorescence signals, and performing denaturation, annealing and extension for 40 cycles. The results are shown in FIG. 4.
As shown in FIG. 4, all the results have no S-type amplification curve, which indicates that the kit has no cross reaction with measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human cytomegalovirus infection samples, and has good specificity.
Comparative example
And (3) performing PCR amplification and detection by taking the probe as a common probe without locking nucleic acid modification and taking the PCR reaction system without adding enhancers TMAC and PEG6000 as a comparative example. The result shows that the specificity and the stability of the kit are poor, and the concrete expression is that the stability is poor when 10 times of detection are carried out. When the kit is used for detecting measles virus, human respiratory syncytial virus, EB virus, hepatitis B virus, hepatitis C virus, hepatitis A virus and human cytomegalovirus, an S-type amplification curve can appear, cross reaction exists, and false positive is easy to appear.
The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.
Sequence listing
<110> Wuhan Baitai Gene engineering Co., Ltd
<120> HSV1/HSV2/VZV virus triple fluorescent PCR detection kit and using method thereof
<130> 2021
<160> 12
<170> SIPOSequenceListing 1.0
<210> 1
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gacatcgaca cggtcatc 18
<210> 2
<211> 17
<212> DNA
<213> GACATCGACACGGTCATC
<400> 2
atcccctcga agaacgc 17
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
<210> 4
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
<210> 5
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
atcccctcga agaacgcgca cagcc 25
<210> 7
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
tccaaagcat ggcatactac caa 23
<210> 8
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
<210> 9
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
ttccgggggt tccggcaacc atgtac 26
<210> 10
<211> 74
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
gacatcgaca cggtcatcca cgccgacgcc aacgccgcca tgtttgcggg cctgggcgcg 60
ttcttcgagg ggat 74
<210> 11
<211> 113
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
acatcgacac ggtcatccgc gccgacgcca acgccgccat gttcgcgggg ctgtgcgcgt 60
tcttcgaggg gatgggggac ttggggcgcg cggtcggcaa ggtcgtcatg gga 113
<210> 12
<211> 95
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tccaaagcat ggcatactac caatgacacg tacatggttg ccggaacccc cggaacatat 60
aggacgggca cgtcggtgaa ttgcatcatt gagga 95
Claims (10)
1. An HSV1/HSV2/VZV virus triple fluorescent PCR detection kit is characterized in that: comprises primers and probes which can simultaneously detect HSV1gB gene, HSV2gB gene and VZV gB gene:
the primer and the probe for detecting HSV1gB genes comprise a forward primer shown by SEQ ID NO. 1, a reverse primer shown by SEQ ID NO. 2 and a probe shown by SEQ ID NO. 3;
the primers and the probes for detecting HSV2gB genes comprise a forward primer shown by SEQ ID NO. 4, a reverse primer shown by SEQ ID NO. 5 and a probe shown by SEQ ID NO. 6;
the primer and the probe for detecting the VZV gB gene comprise a forward primer shown by SEQ ID NO. 7, a reverse primer shown by SEQ ID NO. 8 and a probe shown by SEQ ID NO. 9;
the probes shown in SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are all nucleic acid-locked modified probes, and the 5 'ends are all marked with fluorescent groups, and the 3' ends are all marked with quenching groups.
2. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 1, wherein: the bases of 1 or more positions of the probes shown as SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are modified by locked nucleic acid.
3. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 2, wherein: 1 or more bases of 9 th, 11 th, 12 th, 15 th and 17 th positions from the 5' end of the probe shown in SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 are modified with a locked nucleic acid.
4. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 1, wherein: also comprises Taq polymerase, dNTPs, Tris-HCl and MgSO4And an enhancer.
5. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 4, wherein: the enhancer is TMAC and PEG 6000.
6. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 4, wherein: the final concentration of the Taq polymerase is 8-12U, dNTPs, the final concentration of the Taq polymerase is 0.05-0.10mmol/L, Tris-HCl, and the final concentration of the Taq polymerase is 50-60mmol/L, MgSO4The final concentration of the PEG6000 is 5-8mmol/L, TMAC, the final concentration is 15-25mmol/L, and the mass fraction of the PEG6000 is 3-7%.
7. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 1, wherein: the fluorescent group is one or more of FAM, HEX, TET, JOE, VIC, ROX, Cy3 and Cy5, and the quenching group is one or more of TAMRA, BHQ1, BHQ2 and DABCYL.
8. The HSV1/HSV2/VZV virus triple fluorescent PCR detection kit of claim 1, wherein: the primer concentrations shown by SEQ ID NO. 1-2, SEQ ID NO. 4-5 and SEQ ID NO. 7-8 are all 0.25-0.35 mu mol/L; the concentration of the probes shown by SEQ ID NO. 3, SEQ ID NO. 6 and SEQ ID NO. 9 is 0.08-0.15 mu mol/L.
9. The use of the HSV1/HSV2/VZV virus triple fluorescent PCR assay kit of any one of claims 1-8, wherein: the method comprises the following steps:
s1, diluting HSV1 pseudovirus, HSV2 pseudovirus and VZV pseudovirus with negative serum, and extracting DNA;
and S2, performing PCR amplification detection, and judging the existence and genotype of HSV1gB gene, HSV2gB gene and VZV gB gene in the sample by using the intensity of fluorescence signals of the amplification template of three detection channels on a fluorescence PCR instrument and a cycle threshold value.
10. The use of an HSV1/HSV2/VZV virus triple fluorescent PCR assay kit according to any one of claims 1 to 8 for clinical testing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111611241.6A CN114250323B (en) | 2021-12-27 | 2021-12-27 | HSV1/HSV2/VZV virus triple fluorescence PCR detection kit and using method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111611241.6A CN114250323B (en) | 2021-12-27 | 2021-12-27 | HSV1/HSV2/VZV virus triple fluorescence PCR detection kit and using method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114250323A true CN114250323A (en) | 2022-03-29 |
| CN114250323B CN114250323B (en) | 2023-09-29 |
Family
ID=80798052
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111611241.6A Active CN114250323B (en) | 2021-12-27 | 2021-12-27 | HSV1/HSV2/VZV virus triple fluorescence PCR detection kit and using method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114250323B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024097392A1 (en) * | 2022-11-04 | 2024-05-10 | Abbott Molecular, Inc. | Compositions and methods for the detection and analysis of herpes simplex virus 1 (hsv-1), herpes simplex virus 2 (hsv-2) and varicella zoster virus (vzv) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007113388A2 (en) * | 2006-03-31 | 2007-10-11 | Licentia Oy | Method and microarray for detecting herpesviruses |
| CN108441580A (en) * | 2017-03-03 | 2018-08-24 | 绍兴迅敏康生物科技有限公司 | One-step method detects HSV-1, HSV-2, the kit and detection method of VZV herpesvirals simultaneously |
| CN110317902A (en) * | 2019-06-20 | 2019-10-11 | 上海伯杰医疗科技有限公司 | I/II/III/V type nucleic acid parting detecting reagent of herpes virus hominis and detection method |
| US20200385784A1 (en) * | 2019-06-07 | 2020-12-10 | National University Corporation Tokyo Medical And Dental University | Method for detecting microorganisms |
-
2021
- 2021-12-27 CN CN202111611241.6A patent/CN114250323B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2007113388A2 (en) * | 2006-03-31 | 2007-10-11 | Licentia Oy | Method and microarray for detecting herpesviruses |
| CN108441580A (en) * | 2017-03-03 | 2018-08-24 | 绍兴迅敏康生物科技有限公司 | One-step method detects HSV-1, HSV-2, the kit and detection method of VZV herpesvirals simultaneously |
| US20200385784A1 (en) * | 2019-06-07 | 2020-12-10 | National University Corporation Tokyo Medical And Dental University | Method for detecting microorganisms |
| CN110317902A (en) * | 2019-06-20 | 2019-10-11 | 上海伯杰医疗科技有限公司 | I/II/III/V type nucleic acid parting detecting reagent of herpes virus hominis and detection method |
Non-Patent Citations (5)
| Title |
|---|
| D H BLACK等: "Detection and Differentiation of Primate α-herpesviruses by PCR", J VET DIAGN INVEST, vol. 9, no. 3, pages 225 - 231 * |
| MARTIN E ADELSON等: "Simultaneous detection of herpes simplex virus types 1 and 2 by real-time PCR and Pyrosequencing", J CLIN VIROL, vol. 33, no. 1, pages 25 - 34 * |
| THOMAS KÖLLER等: "Implementation and Evaluation of a Fully Automated Multiplex Real-Time PCR Assay on the BD Max Platform to Detect and Differentiate Herpesviridae from Cerebrospinal Fluids", PLOS ONE, vol. 11, no. 4, pages 0153991 * |
| 姬玉涵: "建立和应用多重PCR方法研究造血干细胞移植早期多种疱疹病毒感染", no. 1, pages 060 - 543 * |
| 张岩: "多引物PCR检测供体角膜疱疹病毒及角膜移植术后病毒传播途径的研究", 中国博士学位论文全文数据库医药卫生科技辑, no. 3, pages 073 - 29 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024097392A1 (en) * | 2022-11-04 | 2024-05-10 | Abbott Molecular, Inc. | Compositions and methods for the detection and analysis of herpes simplex virus 1 (hsv-1), herpes simplex virus 2 (hsv-2) and varicella zoster virus (vzv) |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114250323B (en) | 2023-09-29 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111394431B (en) | Method for detecting nucleic acid by using double real-time fluorescent isothermal amplification technology | |
| CN111206123B (en) | Nucleic acid compositions and kits for blood screening | |
| US20120196274A1 (en) | Materials and methods for genotyping and quantifying a high-risk human papillomavirus | |
| CN113249522A (en) | Method for detecting SARS-CoV-2variant strain nucleic acid and its application | |
| CN114250323B (en) | HSV1/HSV2/VZV virus triple fluorescence PCR detection kit and using method thereof | |
| CN113388701A (en) | Primer probe composition and application thereof in preparation of parainfluenza virus typing detection kit | |
| CN112501358B (en) | Primer probe combination and kit for detecting 9 children digestive tract pathogens | |
| CN111893217A (en) | Novel coronavirus composition, kit and detection method thereof | |
| CN116024386B (en) | Primer probe combination and kit for detecting novel coronaviruses and distinguishing Omicron different mutant strains | |
| CN112575118A (en) | Method for simultaneously detecting various diarrhea viruses by using melting curve | |
| CN113817870B (en) | Primer composition for simultaneously detecting seven respiratory tract related viruses and application thereof | |
| CN116445659A (en) | Kit for detecting novel coronavirus and Omicron variant typing and application | |
| CN113278736B (en) | Reagents and methods for qualitative detection of bovine herpesvirus type I | |
| CN112501349B (en) | Primer probe composition and kit for synchronously detecting 8 children digestive tract infection fungi and parasite-related pathogens | |
| CN113278738A (en) | Primer probe composition for parainfluenza virus typing detection and real-time fluorescent quantitative PCR kit | |
| CN111676319A (en) | LAMP primer group and kit for detecting classical swine fever virus and using method thereof | |
| JP2020074774A (en) | Compositions, methods and kits to detect adenovirus, metapneumovirus and/or rhinovirus nucleic acids | |
| CN114250324A (en) | Novel coronavirus fluorescent PCR detection kit and use method thereof | |
| CN113801966B (en) | Fluorescent quantitative PCR method and kit for detecting novel coronavirus subgenomic | |
| CN107287346B (en) | Multiplex fluorescence quantitative PCR detection kit for avian influenza virus N subtype genotyping and application thereof | |
| CN118076733A (en) | Polynucleotides for amplification and detection of influenza a virus | |
| EP3601617B3 (en) | Compositions and methods for detecting or quantifying parainfluenza virus | |
| CN109628642B (en) | Nucleic acid composition for detecting respiratory viruses and application thereof | |
| CN118139993A (en) | Polynucleotide for amplifying and detecting influenza B virus | |
| CN117089654A (en) | Integrated HIV-1DNA real-time fluorescence quantitative detection primer probe group and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |