CN116445659A

CN116445659A - Kit for detecting novel coronavirus and Omicron variant typing and application

Info

Publication number: CN116445659A
Application number: CN202310103439.6A
Authority: CN
Inventors: 王珊; 张蓉; 郭玉婉; 贺华; 黄青红; 张少铎; 刘中华; 王国强
Original assignee: Jiangsu Bioperfectus Technologies Co ltd
Current assignee: Jiangsu Bioperfectus Technologies Co ltd
Priority date: 2023-02-08
Filing date: 2023-02-08
Publication date: 2023-07-18

Abstract

The invention discloses a kit for detecting novel coronavirus and Omicron variant typing and application thereof; the novel coronavirus is qualitatively detected by detecting the ORF1ab gene of the novel coronavirus, and the 4 specific mutation sites E484A, N679K, S704L, L R and the N gene specific mutation site P151S of the S gene are detected, so that three subtypes of the Omicron variant strain BA.2.12.1, BA.4 and BA.5 are identified, and the detection of the novel coronavirus and the Omicron variant strain typing is simultaneously realized.

Description

Kit for detecting novel coronavirus and Omicron variant typing and application

Technical Field

The invention belongs to the technical field of nucleic acid detection, and particularly relates to a kit for detecting novel coronaviruses and Omicron variant strain typing and application thereof.

Background

Since the onset of a new crown epidemic in month 12 of 2019, the world health organization (World Health Organization, WHO) published information about SARS-CoV2 virus variants that required attention (VOC) and (VOI) was receiving global attention. The global epidemiological trait of the current SARS-CoV-2 variant is that the Omacron variant is globally dominant and Delta is another important epidemic variant.

In month 11 2021, WHO reported a new variant of rapidly transmitted SARS-CoV2 virus in south africa, listed as a new crown variant requiring attention and named omacron. In contrast to Alpha, beta, gamma, delta, the spike protein (S protein) portion of omacron has more than 30 mutation points, with about 50 mutation sites in the whole genome. In contrast, the Beta variant had 3 mutations in the RBD region (K417N, E484K, N501Y), while the Delta variant had only 2 mutations in the same region (L452R, T478K). The omnirange variant has important amino acid mutation sites of Alpha (Alpha), beta (Beta), gamma (Gamma) and Delta (Delta) spike proteins of the first 4 VOC variants, including mutation sites which enhance cell receptor affinity, virus replication capacity and immune escape capacity, resulting in extremely strong transmission capacity and reduced protective efficacy of part of antibody drugs.

New coronavirus variants Omicron were 4.2 times more contagious than the delta variants at their early stages. Studies have shown that omacron variants infect and reproduce 70 times faster in the bronchi than delta variants and new crown original strains. The transmission capacity is stronger, the symptoms are atypical, and the transmission process is more concealed. The infection of Omicron variant in human lungs is significantly lower than that of the original strain of new crown, and lung infection is critical for the severity of the disease, so patients infected with Omicron variant are mainly light and common, symptoms including muscle soreness, tiredness and slight coughing.

Morgana (Moderna) in the United states has issued a modified version of the bivalent new crown candidate vaccine mRNA-1273.214 in its functional network to boost against Omikovia with excellent neutralizing effect, and as a booster needle, can provide 8 times of neutralizing antibodies compared to the normal 2-needle vaccine. Its antigen is mixed with original SARS-CoV-2 strain and the strain of Omikovia is used to cover 32 mutations of S protein of new coronavirus.

The latest progress of new coronary special drugs under the flag is published by the official micro-signals of the Tengsheng Bo drug on the 5 months and 10 days. New research data show that long-acting novel crown neutralizing antibody An Bawei monoclonal antibody and romidepsin monoclonal antibody combination therapy of Tengshengbao maintains neutralizing activity on novel coronavirus Omikovia BA.2 subtype variant. A pair of antibody combination therapy Emergency Use Authority (EUA) applications are under examination by the united states food and drug administration (simply "FDA in the united states").

The existing novel coronavirus nucleic acid detection reagent cannot perform typing detection on Omicron, possibly has the risk of omission, and develops a kit capable of accurately detecting Omicron variant typing, so that the kit has very important significance for epidemic prevention and control and treatment measures.

Disclosure of Invention

In view of the above, the present invention aims to provide a kit for detecting novel coronaviruses and Omicron variant typing and application thereof.

The invention aims to provide a kit and a method for detecting novel coronaviruses based on a multiplex fluorescence quantitative PCR method and combining with a terminal block amplification technology (ARMS-PCR) for omacron variant typing detection.

The invention designs a specific amplification primer and a Taqman probe according to a human genome internal standard fragment (SEQ ID No. 25), a novel coronavirus ORF1ab gene (SEQ ID No. 26) and/or an N gene conserved region (SEQ ID No. 27), a novel coronavirus Omicron variant S protein mutation site E484A (SEQ ID No. 28), N679K (SEQ ID No. 29), S704L (SEQ ID No. 30), L452R (SEQ ID No. 31) and a N gene specific mutation site P151S (SEQ ID No. 32) respectively. Whether the novel coronavirus is detected or not is judged by the negative positive of the ORF1ab gene and/or the N gene of the novel coronavirus, and the typing of the novel coronavirus Omicron variant strain is realized by utilizing the difference of delta Ct values between mutation sites and the ORF1ab gene. Meanwhile, the invention sets an internal standard, wherein the internal standard is human ribonuclease P (RNaseP), so that false negatives of detection results can be effectively avoided, and the acquisition, transportation and extraction processes of detection samples can be monitored.

The invention provides a primer probe group for detecting novel coronaviruses and Omicron variant strain typing based on multiplex PCR, which comprises a primer and a probe group for detecting novel coronavirus Omicron variant strain S protein specific mutation sites and N gene specific mutation sites;

the novel coronavirus Omicron variant S protein specific mutation site comprises at least two of an E484A mutation site, an N679K mutation site, an S704L mutation site, an L452R mutation site and an N gene specific mutation site P151S;

primer sequences for detecting E484A mutation sites are shown in SEQ ID No.1 and SEQ ID No. 2;

the primer sequences for detecting the N679K mutation site are shown in SEQ ID No.3 and SEQ ID No. 4;

the primer sequences for detecting the S704L mutation site are shown in SEQ ID No.5 and SEQ ID No. 6;

the primer sequences for detecting the mutation site of the L452R are shown in SEQ ID No.7 and SEQ ID No. 8;

the primer sequences for detecting the P151S mutation site are shown in SEQ ID No.9 and SEQ ID No. 10;

the probe sequence for detecting the E484A mutation site is shown in SEQ ID No. 17;

the probe sequence for detecting the N679K mutation site is shown in SEQ ID No. 18;

the probe sequence for detecting the S704L mutation site is shown in SEQ ID No. 19;

the probe sequence for detecting the mutation site of L452R is shown in SEQ ID No. 20;

the probe sequence for detecting the P151S mutation site is shown in SEQ ID No. 21.

The primer probe set also comprises a primer probe set for detecting a sequence shown in a conserved sequence SEQ ID No.26 of the ORF1ab gene:

the primer sequences for detecting the ORF1ab gene of the novel coronavirus are shown as SEQ ID No.11 and SEQ ID No. 12;

the probe sequence for detecting the ORF1ab gene of the novel coronavirus is shown as SEQ ID No. 22.

The primer probe set further comprises a primer probe set for detecting the internal reference gene RNaseP:

primer sequences for detecting RNaseP are shown in SEQ ID No.13 and SEQ ID No. 14;

the probe sequence for detecting RNaseP is shown as SEQ ID No. 23.

The primer probe set further comprises a primer probe set for detecting the N gene conserved sequence:

primer sequences for detecting the N gene conserved sequences are shown in SEQ ID No.15 and SEQ ID No. 16;

the probe sequence for detecting the N gene conserved sequence is shown in SEQ ID No. 24.

The invention also provides a kit comprising the primer probe set as described above.

The kit comprises a detection solution and an enzyme mixed solution;

the detection solution comprises PCR buffer solution and MgCl ₂ dNTPs, degranolase water, and the primer probe set of any one of claims 1 to 4;

the enzyme mixture comprises an RNase inhibitor, a DNA polymerase, a reverse transcriptase and a UDG enzyme.

The sample of the novel coronavirus adopted in the detection of the kit is derived from a human nasopharyngeal swab, a sputum sample, an alveolar lavage fluid sample, a blood sample or a fecal sample.

The kit further comprises a positive control and a negative control; the kit further comprises a positive control and a negative control; the positive control is a artificially synthesized gene fragment containing a mutation site of which the RNaseP gene fragment is shown as SEQ ID No.25, the ORF1ab gene is shown as SEQ ID No.26 and/or a partial fragment of a N gene conservation region is shown as SEQ ID No.27, E484A is shown as SEQ ID No.28, N679K is shown as SEQ ID No.29, S704L is shown as SEQ ID No.30, L452R is shown as SEQ ID No.31 and P151S is shown as SEQ ID No. 32; the negative control is artificially synthesized gene containing RNaseP gene fragment shown as SEQ ID No. 25.

The application of the primer probe group in preparing the kit for detecting different novel coronavirus mutant strains also belongs to the protection scope of the invention.

The invention also provides a reaction system for omacron variant typing, which comprises a detection solution A, a detection solution B and an enzyme mixed solution; positive and negative controls;

the detection solution A comprises a PCR buffer solution MgCl ₂ dNTPs, water with RNase, and primer and probe sets as described below:

The probe sequence for detecting RNaseP is shown as SEQ ID No. 23;

the detection liquid B comprises MgCl ₂ dNTPs, water with RNase, and primer and probe sets as described below:

the probe sequence for detecting the P151S mutation site is shown in SEQ ID No. 21;

the probe sequence for detecting the ORF1ab gene of the novel coronavirus is shown as SEQ ID No. 22;

the enzyme mixture comprises RNase inhibitor, DNA polymerase, reverse transcriptase and UDG enzyme;

the positive control is a artificially synthesized gene fragment containing a mutation site of which the RNaseP gene fragment is shown as SEQ ID No.25, the ORF1ab gene is shown as SEQ ID No.26 and/or a partial fragment of a N gene conservation region is shown as SEQ ID No.27, E484A is shown as SEQ ID No.28, N679K is shown as SEQ ID No.29, S704L is shown as SEQ ID No.30, L452R is shown as SEQ ID No.31 and P151S is shown as SEQ ID No. 32; the negative control is artificially synthesized gene containing RNaseP gene fragment shown as SEQ ID No. 25.

The two ends of the specific probe are respectively provided with a fluorescent group and a quenching group, wherein the fluorescent group is selected from one or more of FAM, HEX, VIC, TET, TAMRA, ROX, CY 3.5.5 or CY 5; the quenching group is selected from any one or more of BHQ1, BHQ2, BHQ3, DABCYL and MGB.

ARMS (amplified hindered mutation System) is to place a specific mutation site at the 3 'end of a primer, lack 3' to 5 'exonuclease activity by using thermostable Taq DNA polymerase, and if a mismatch is formed in the 3' end base pair during complementary pairing of the primer and a template, chain extension is hindered, and the amplification result is as follows: the wild template is blocked from being amplified, and the mutant template is effectively amplified. The last second or third base of the 3 'end of the primer can be artificially subjected to sequence mutation so as to ensure that the primer and the wild type sequence have two base mismatch at the 3' end, thereby improving the specificity of target amplification.

The positive control is a artificially synthesized gene fragment containing a mutation site of which the RNaseP gene fragment is shown as SEQ ID No.25, the ORF1ab gene is shown as SEQ ID No.26 and/or a partial fragment of a N gene conserved region is shown as SEQ ID No.27, E484A is shown as SEQ ID No.28, N679K is shown as SEQ ID No.29, S704L is shown as SEQ ID No.30, L452R is lacking as SEQ ID No.31 and P151S is shown as SEQ ID No. 32; the negative control is artificially synthesized gene containing RNaseP gene fragment shown as SEQ ID No. 25.

Compared with the prior art, the invention has the following beneficial effects:

1) The primer and probe composition for detecting novel coronaviruses and typing Omicron variant strains can simultaneously detect mutation conditions of a plurality of sites by adopting a multiplex fluorescence quantitative PCR method and combining with a terminal blocking amplification technology (ARMS-PCR), and can achieve a rapid and accurate target.

2) The invention sets human genome internal standard fragment, new coronavirus ORF1ab gene and/or N gene conservation region, S gene mutation site and N gene mutation site, completes new coronavirus detection and mutation site analysis by one-time test, and meanwhile, adopts delta Ct value difference between mutation site and ORF1ab gene to judge site negative positive, thereby avoiding judgment error caused by virus concentration difference.

3) The 2 mutation sites E484A and N679K adopted by the invention are all unique to Omicron, so that the detection specificity is further improved; both subtypes BA.4 and BA.5 of the Omicron variant possess the S gene L452R mutation site, and can be distinguished from other subtypes of Omicron. The P151S site of the N gene is unique to the BA.4 subtype and can be distinguished from BA.5. The S704L locus of the S gene is unique to the subtype BA.2.12.1 and can be identified with other subtypes.

4) The kit is characterized in that the developed kit can detect novel coronaviruses and simultaneously carry out typing detection on Omicron variant strains, the prior art can only detect novel coronaviruses and Omicron variant strains, and can not carry out typing detection on Omicron variant strains, so that the kit can not play a role in risk prompting for epidemic prevention and control, and the kit solves the problem of typing of Omicron variant strains BA.4, BA.5 and BA.2.12.1 subtype through novel coronavirus S gene L452R, S L mutation sites and N gene P151S mutation sites.

Drawings

Other features, objects and advantages of the present invention will become more apparent upon reading of the detailed description of non-limiting embodiments, given with reference to the accompanying drawings in which:

FIG. 1 is a schematic representation of the amplification curve of a novel variant of coronavirus Omacron BA.4;

FIG. 2 is a schematic representation of the amplification curve of the novel variant Omacron BA.5;

FIG. 3 is a schematic representation of the amplification curve of the novel variant of coronavirus Omicron BA.2.12.1;

FIG. 4 is a schematic representation of amplification curves of other subtypes of novel coronavirus Omacron variants;

FIG. 5 is a summary of mutation sites of novel coronavirus Omicron variant, subtype BA.2.12.1, subtype BA.4, subtype BA.5, alpha, beta, gamma, delta, zeta, kappa, mu, lambda variant with a mutation frequency of 90% or more on the S gene;

FIG. 6 is a summary of mutation sites of novel coronavirus Omicron variant, BA.2.12.1, BA.4, BA.5, alpha, beta, gamma, delta, zeta, kappa, mu, lambda variant N genes with a mutation frequency of 90% or more.

Detailed Description

The present invention will be described in detail with reference to examples. The following examples will assist those skilled in the art in further understanding the present invention, but are not intended to limit the invention in any way. It should be noted that several modifications and improvements can be made by those skilled in the art without departing from the inventive concept. These are all within the scope of the present invention.

The invention provides a detection method for detecting novel coronaviruses and typing Omicron variant strains, which specifically comprises the following steps:

(1) Extracting DNA of a sample to be detected: sample nucleic acid extraction was performed using Qiagen IncViral RNA Mini Kit kit, a sample nucleic acid RNA volume of 60. Mu.L was prepared.

(2) The reaction system of the preparation reagent is 50 mu L, and the composition of the reaction system is shown in Table 1:

TABLE 1 reaction system

(3) Setting up a fluorescent PCR amplification program

The RT-PCR amplification procedure was set as shown in Table 2

TABLE 2 RT setting of PCR amplification procedure

(4) Interpretation of the results:

yin-yang determination:

the amplification curve is S-shaped, the Ct value is less than or equal to 40.0, and the amplification curve is judged to be positive; ct > 40.0 or undetected, and negative.

Mutation site determination:

the delta Ct of a mutation site of a sample X is equal to the Ct value of the mutation site detection reaction (Mx) minus the Ct value of the ORF1ab reaction in the same tube: delta Ct (x) =ct (Mx) -Ct (ORF 1 ab), delta Ct may be negative. The reference value (Cut-off delta Ct) of the mutation site of the kit E484A, N679K, S704L, L452R, P S is shown in Table 3:

TABLE 3 reference values for the mutation sites

Mutation type	E484A	N679K	L452R	S704L	P151S
						Cut-offΔCt	8.0	8.0	8.0	8.0	6.0

When the negative control test result is negative and the positive control test result is positive, the analysis of the sample test result is as follows in table 4:

TABLE 4 interpretation of the mutation sites

Judging a sample detection result:

the novel coronavirus Omicron variant was typed according to the following site-determined results.

TABLE 5 novel typing of coronavirus Omicron variant

Example 1 design of specific primers and probes for detection of novel coronavirus Omacron variants

Specific mutation sites for Omicron variant typing were analyzed and screened. Bioinformatic alignment analysis is carried out on sequences of 3 subtypes of BA.2.12.1, BA.4 and BA.5 of VOC (Alpha, beta, gamma, delta, omicron) variant, VOI (Lambda, mu) variant and Omicron variant, and the analysis result shows that E484A, N679K site is mutation specific to Omicron, and mutation frequencies are respectively 92.7% and 99.4%, so that the mutant can be effectively distinguished from other VOC/VOI variant. Both subtypes BA.4 and BA.5 of the Omicron variant possess S gene L452R mutation site, and the mutation frequency can reach over 95% and can be distinguished from other Omicron subtypes. The P151S site of the N gene is unique to the subtype BA.4, the mutation frequency is 100%, and the N gene can be distinguished from BA.5. S704L locus of S gene is unique to subtype BA.2.12.1, mutation frequency is 97.9%, and can be identified with other subtypes.

Table 6 mutation frequencies of E484A, N679K, S704L, L452R, P151S mutation sites in respective variants

Specific amplification primers and Taqman probes of the mutation sites are designed respectively for the P151S mutation sites, the ORF1ab genes and the RNaseP genes on the novel coronavirus Omicron variant S protein mutation sites E484A, N679K, S704L, L452R and N genes by utilizing Primer 5 software, and are synthesized by Shanghai Shuoyang biotechnology Co.

The amplified sequences of each mutation site and ORF1ab gene, N gene and RNaseP gene are as follows:

RNaseP gene fragment SEQ ID No.25

GAATTCGGCACGAGGTGGGACTTCAGCATGGCGGTGTTTGCAGATTTGGACCTGCGAGCGGGTTCTGACCTGAAGGCTCTGCGCGGACTTGTGGAGACAGCCGCTCACCTTGGCTATTCAGTTGTTGCTATCAATCATATCGTTGACTTTAAGGAAAAGAAACAGGAAATTGAAAAACCAGTAGCTGTTTCTGAACTCTTCACAACTTTGCCAATTGTACAGGGAAAATCAAGACCAATTAAAATTTTAACTAGATTAACAATTATTGTCTCGGATCCATCTCACTGCAATGTTTTGAGA

ORF1ab gene fragment SEQ ID No.26

ATCGTGTTGTCTGTACTGCCGTTGCCACATAGATCATCCAAATCCTAAAGGATTTTGTGACTTAAAAGGTAAGTATGTACAAATACCTACAACTTGTGCTAATGACCCTGTGGGTTTTACACTTAAAAACACAGTCTGTACCGTCTGCGGTATGTGGAAAGGTTATGGCTGTAGTTGTGATCAACTCCGCGAACCCATGCTTCAGTCAGCTGATGCACAATCGTT

TTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACACCGTGCGGCACAGGCA

CTAGTACTGATGTCGTATACAGGGCTTTTGACATCTACAATGATAAAGTAGCTGGTT

TTGCTAAATTCCTAAAAACTAATTGTTGTCGCTTCCAAGAAAAGGACGAAGATGAC

AATTTAATTGATTCTTACTTTGTAGTTAAGAGACACACTTTCTCTAACTACCAACAT

GAAGAAACAATTTATAATTTACTTAAGGATTGTCCAGCTGTTGCTAAACATN Gene fragment SEQ ID No.27

CAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCTTCTAAGAAGC

CTCGGCAAAAACGTACTGCCACTAAAGCATACAATGTAACACAAGCTTTCGGCAG

ACGTGGTCCAGAACAAACCCAAGGAAATTTTGGGGACCAGGAACTAATCAGACA

AGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCCCCCAGCGCTTCAG

CGTTCTTCGGAATGTCGCGCATTGGCATGGAAGTCACACCTTCGGGAACGTGGTTG

ACCTACACAGGTGCCATCAAATTGE484A specific fragment SEQ ID No.28

AGGCTGCGTTATAGCTTGGAATTCTAACAAGCTTGATTCTAAGGTTGGTGGTAATTA

TAATTACCAGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATAT

TTCAACTGAAATCTATCAGGCCGGTAACAAACCTTGTAATGGTGTTGCAGGTTTTA

ATTGTTACTTTCCTTTACGATCATATGGTTTCCGACCCACTTATGGTGTTGGTCACCA

ACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCAACTGTTTG

TGGACCTAAAAAGTCN 679K-specific fragment SEQ ID No.29

ACTCCTACTTGGCGTGTTTATTCTACAGGTTCTAATGTTTTTCAAACACGTGCAGGC

TGTTTAATAGGGGCTGAATATGTCAACAACTCATATGAGTGTGACATACCCATTGGT

GCAGGTATATGCGCTAGTTATCAGACTCAGACTAAGTCTCATCGGCGGGCACGTAG

TGTAGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTTAGT

TGCTTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACA

GAAATTCTACCAGTGS704L specific fragment SEQ ID No.30

TTAATAGGGGCTGAATATGTCAACAACTCATATGAGTGTGACATACCCATTGGTGCA

GGTATATGCGCTAGTTATCAGACTCAGACTAAGTCTCATCGGCGGGCACGTAGTGT

AGCTAGTCAATCCATCATTGCCTACACTATGTCACTTGGTGCAGAAAATTTAGTTGC

TTACTCTAATAACTCTATTGCCATACCCACAAATTTTACTATTAGTGTTACCACAGAA

ATTCTACCAGTGTCTATGACCAAGACATCAGTAGATTGTACAATGTACATTTGTGGT

GATTCAACTGAATGCL452R specific fragment SEQ ID No.31

TTGTAATTAGAGGTAATGAAGTCAGCCAAATCGCTCCAGGGCAAACTGGAAATATT

GCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATT

CTAACAANCTTGATTCTAAGGTTGGTGGTAATTATAATTACCGGTATAGATTGTTTAG

GAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCG

GTAACAAACCTTGTAATGGTGTTGCAGGTGTTAATTGTTACTTTCCTTTACAATCATA

TGGTTTCCGACCCAP151S specific fragment SEQ ID No.32

AAAATGAAAGATCTCAGTCCAAGATGGTATTTCTACTACCTAGGAACTGGGCCAGA

AGCTGGACTTCCCTATGGTGCTAACAAAGACGGCATCATATGGGTTGCAACTGAGG

GAGCCTTGAATACACCAAAAGATCACATTGGCACCCGCAATTCTGCTAACAATGCT

GCAATCGTGCTACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAG

AAGGGAGCAGAGNCGGNAGNCAAGCCTCTTCTCGTTCCTCATCACGTAGTCGCAA

CAGTTCAAGAAATTCAACTCCA

The primer and probe sequences for detecting the P151S mutation site, ORF1ab gene, N gene and RNaseP gene on the mutation site E484A, N679K, S704L, L452R and N genes are shown in table 7:

TABLE 7 primer and probe sequence information

Example 2 method for detecting novel coronavirus (2019-nCoV) and typing Omicron variant

(1) Collecting, storing and transporting clinical samples: is suitable for throat swab, nasopharyngeal swab and sputum sample type.

Pharyngeal swab: the swab is passed over the tongue root, the tonsils of the pharynx on both sides of the person to be collected are slightly rubbed back and forth for at least 3 times, then the swab head is rubbed up and down on the back wall of the pharynx for at least 3 times, the swab head is immersed into a tube containing virus preservation solution (isotonic saline solution, tissue culture solution or phosphate buffer solution can be used), the tail is discarded, and the tube cover is screwed.

Nasopharyngeal swab: when the plastic rod swab with 1 polypropylene fiber head is gently inserted into the back wall of the nasal meatus nasopharyngeal cavity, the swab slowly rotates to withdraw after staying for a moment. Another polypropylene fiber head swab is taken to collect the nostril at the other side in the same way. The two swabs were immersed in the same tube containing 3mL of virus preservation solution, the tail was discarded, and the tube cap was screwed. Sputum: the expectorated sputum was collected in 50mL screw plastic tubes or sputum cassettes containing virus stock. Adding the sputum sample into an equal volume of sputum digestion liquid (1 g/L phosphate buffer solution containing proteinase K), shaking and mixing uniformly, standing for 5 minutes, and digesting and then extracting nucleic acid. The digested sputum sample can be used as a conventional swab sample for subsequent processing. The sample for virus separation and nucleic acid detection should be detected as soon as possible, and the sample which can be detected within 24 hours can be stored at 4 ℃; samples that could not be detected within 24 hours should be stored at-70 ℃ or below (if no-70 ℃ storage conditions exist, the samples should be stored in a refrigerator at-20 ℃). The freezing and thawing of the sample can not be performed for more than 5 times, otherwise, the detection result is affected.

(2) Nucleic acid extraction: sample nucleic acid extraction was performed using Qiagen IncViral RNA Mini Kit kit, nucleic acid extraction was performed according to the instructions. The positive quality control product and the negative quality control product are all required to be extracted.

(3) Preparing a reaction system: the number of reactions of the reagents (n=number of samples+2-tube control) was calculated, and n reaction solutions were prepared using each of the detection solutions a and B, i.e., 2-tube detection per sample. The reaction system was formulated as follows:

table 8 preparation of the reaction System

Reaction system	Addition amount (. Mu.L)/person
		Detection liquid A/detection liquid B	27
Enzyme mixed solution	3
		Sample nucleic acid	20
Total volume of	50

The detection solution A comprises a PCR buffer solution and 3.3mM MgCl ₂ 0.1-0.4mM dNTPs (dATP: dTTP: dCTP: dGTP: dUTP=1:1:1:1:1), primer probes (SEQ ID No.1, SEQ ID No.3, SEQ ID No.11, SEQ ID No.13 at a concentration of 0.4. Mu.M; SEQ ID No.2, SEQ ID No.4, SEQ ID No.12, SEQ ID No.14 at a concentration of 0.04. Mu.M; SEQ ID No.17, SEQ ID No.18, SEQ ID No.22, SEQ ID No.23 at a concentration of 0.2. Mu.M) and de-RNase water.

The detection solution B comprises PCR buffer solution and 3.3mM MgCl ₂ 0.1-0.4mM dNTPs (dATP: dTTP: dCTP: dGTP: dUTP=1:1:1:1:1), primer probes (SEQ ID No.5, SEQ ID No.7, SEQ ID No.9, SEQ ID No.11 at a concentration of 0.4. Mu.M; SEQ ID No.6, SEQ ID No.8, SEQ ID No.10, SEQ ID No.12 at a concentration of 0.04. Mu.M; SEQ ID No.19, SEQ ID No.20, SEQ ID No.21, SEQ ID No.22 at a concentration of 0.2. Mu.M) and de-RNase water.

The enzyme mixture comprises RNase inhibitor, DNA polymerase, reverse transcriptase and UDG enzyme.

The positive control is a synthetic gene fragment containing RNaseP gene fragment, ORF1ab gene and/or N gene conservation region partial fragment, E484A, N679K, S704L, L452R, P S mutation site, and the negative control is a synthetic gene containing RNaseP gene fragment.

(4) Sample adding: and respectively adding 20 mu L of the extracted sample to be detected, 20 mu L of positive control and 20 mu L of negative control into the PCR reaction tube in which the reagent is packaged, covering a tube cover, and performing instantaneous low-speed centrifugation.

(5) Amplification: RT-PCR amplification was performed according to the following procedure: 50 ℃ for 10min;97 ℃ for 1min; 45 cycles were performed in total at 97℃for 5s and 58℃for 30 s.

(6) Analysis of results: the detection condition of each mutation site is determined according to the amplification curve graph and the Ct value condition of each fluorescence channel, and the interpretation standard of each mutation site is shown in Table 9. And judging whether the novel coronavirus to be detected exists in the sample or not according to the mutation condition of 5 mutation sites E484A, N679K, S704L, L452R, P S, and typing the omacron variant strain.

TABLE 9 interpretation of the results at the mutation sites

TABLE 10 novel typing of coronavirus Omicron variant

FIG. 1 shows the results of detection of novel coronavirus Omicron BA.4 variant;

FIG. 2 shows the results of detection of novel coronavirus Omicron BA.5 variant;

FIG. 3 shows the results of detection of novel variants of coronavirus Omicron BA.2.12.1;

FIG. 4 shows the results of detection of other subtypes of novel coronavirus Omacron variant;

Example 3 sensitivity analysis

The synthetic gene containing 5 mutation sites E484A, N679K, S704L, L452R, P151S target fragments of the novel coronavirus Omicron variant is subjected to 2-fold ratioGradient dilution is carried out, and the minimum detection limit of the detection of the multiplex fluorescence quantitative PCR amplification analysis of 20 wells is 5 multiplied by 10 ² copies/mL。

Table 11 LoD verification of detection System

Detecting sample concentration	Detection of the condition	Detection rate of
			2000copies/mL	20/20	100％
1000copies/mL	20/20	100％
			500copies/mL	19/20	95％
250copies/mL	13/20	65％

EXAMPLE 4 specificity analysis

Multiplex fluorescence quantitative PCR amplification assays were performed on coronavirus 229E, coronavirus OC43, coronavirus HKU1, coronavirus NL63, SARS coronavirus, MERS coronavirus, influenza A virus H1N1, influenza A virus H3N2, pharyngeal swabs containing novel coronavirus 2019-nCoV nucleic acids, and human genomes using the methods of the invention.

TABLE 12 specificity test results

All kinds of pathogens and human genome	Detection result
		Coronavirus 229E type	Negative of
Coronavirus OC43 type	Negative of
		Coronavirus HKU1 type	Negative of
Coronavirus NL63	Negative of
		SARS coronavirus	Negative of
MERS coronavirus	Negative of
		Influenza A virus H1N1	Negative of
Influenza A virus H3N2	Negative of
		Novel coronavirus 2019-nCoV-containing nucleusSour pharyngeal swab	Negative of
Human genome	Negative of

Example 5 authentication detection

The method of the invention is used for carrying out multiplex fluorescence quantitative PCR amplification analysis on the pharyngeal swab containing the novel coronavirus Alpha variant nucleic acid, the pharyngeal swab containing the novel coronavirus Beta variant nucleic acid, the pharyngeal swab containing the novel coronavirus Gamma variant nucleic acid, the pharyngeal swab containing the novel coronavirus Delta variant nucleic acid, the pharyngeal swab containing the novel coronavirus Lambda variant nucleic acid and the pharyngeal swab containing the novel coronavirus Mu variant nucleic acid.

TABLE 13 results of novel coronavirus variant assays

The kit comprises a human genome internal standard fragment, a novel coronavirus ORF1ab gene, an N gene conserved region, and 5 pairs of primers and probes for specific mutation sites of S protein and N gene of the novel coronavirus Omicron variant strain, has higher recognition capability, and can realize detection of the novel coronavirus and accurate typing of the Omicron variant strain. The yin-yang property of the mutation site is judged by the delta Ct value difference between the mutation site and the ORF1ab gene in the same reaction tube, so that the judgment error caused by the virus concentration difference is avoided. The E484A, N679K site is a mutation special for Omicron, the mutation frequencies are 92.7 percent and 99.4 percent respectively, and the mutant can be effectively distinguished from other VOC/VOI variants. Both subtypes BA.4 and BA.5 of the Omicron variant possess the S gene L452R mutation site, and can be distinguished from other subtypes of Omicron. The P151S site of the N gene is unique to the BA.4 subtype and can be distinguished from BA.5. The S704L locus of the S gene is unique to the subtype BA.2.12.1 and can be identified with other subtypes.

The foregoing describes specific embodiments of the present invention. It is to be understood that the invention is not limited to the particular embodiments described above, and that various changes and modifications may be made by one skilled in the art within the scope of the claims without affecting the spirit of the invention.

Claims

1. A primer probe group for detecting novel coronavirus and Omicron variant strain type based on multiplex PCR, which is characterized by comprising a primer and probe group for detecting novel coronavirus Omicron variant strain S protein specific mutation site and N gene specific mutation site;

2. The primer probe set of claim 1, further comprising a primer probe set for detecting a sequence represented by the conserved sequence of the ORF1ab gene SEQ ID No. 26:

3. The primer probe set of claim 1, further comprising a primer probe set for detecting the human internal reference gene rnarep:

the probe sequence for detecting RNaseP is shown as SEQ ID No. 23.

4. The primer probe set of claim 1, further comprising a primer probe set that detects a conserved sequence of an N gene:

5. A kit comprising the primer probe set of any one of claims 1-4.

6. The kit according to claim 5, wherein the kit comprises a detection solution and an enzyme mixed solution;

the detection solution comprises PCR buffer solution and MgCl ₂ dNTPs, RNase water and the primer probe group;

7. The kit according to claim 5 or 6, wherein the sample of the novel coronavirus used in the kit for detection is derived from a human nasopharyngeal swab, a sputum sample, an alveolar lavage sample, a blood sample or a fecal sample.

8. The kit of claim 5 or 6, wherein the kit further comprises a positive control and a negative control; the positive control is a artificially synthesized gene fragment containing a mutation site of which the RNaseP gene fragment is shown as SEQ ID No.25, the ORF1ab gene is shown as SEQ ID No.26 and/or a partial fragment of a N gene conservation region is shown as SEQ ID No.27, E484A is shown as SEQ ID No.28, N679K is shown as SEQ ID No.29, S704L is shown as SEQ ID No.30, L452R is shown as SEQ ID No.31 and P151S is shown as SEQ ID No. 32; the negative control is artificially synthesized gene containing RNaseP gene fragment shown as SEQ ID No. 25.

9. Use of a primer-probe set according to any one of claims 1-4 for the preparation of a kit for the detection of different novel coronavirus mutants.

10. A reaction system for omacron variant typing, which is characterized by comprising a detection solution A, a detection solution B, an enzyme mixed solution, a positive control and a negative control;

The probe sequence for detecting RNaseP is shown as SEQ ID No. 23;