CN114250314B - KASP molecular marker related to peanut seed coat color and application thereof - Google Patents

Abstract

The invention discloses a KASP molecular marker related to peanut seed coat color and application thereof. The research of the invention finds that G/A polymorphism exists at 117190528 nucleotide on peanut genome chromosome 12, and the SNP locus is related to peanut seed coat color; based on the SNP locus, the invention develops a KASP molecular marker related to the color of peanut seed coats, and the KASP molecular marker can be used for accurately genotyping the pink seed coats and the deep red peanut seed coats. The method can assist in selecting in the peanut seedling stage, can rapidly and accurately distinguish the pink and dark red peanut seed coats, can effectively improve the peanut breeding efficiency and shorten the breeding period.

Description

KASP molecular marker related to peanut seed coat color and application thereof

Technical Field

The invention relates to the technical field of molecular genetics, in particular to a KASP molecular marker related to peanut seed coat color and application thereof.

Background

Peanut (Arachis hypogaea l.) is an important protein and edible oil raw material, and is also an important leisure and health food. According to different colors of the outer seed coats of the peanut seeds, the peanut seeds can be divided into pink, red, purple, black, purple red, red white, colored grains and the like, and the colors of the peanut seeds influence the commercial value and the nutritional value of the varieties, so that the selection of the peanut varieties with specific seed colors becomes an important target of breeders.

The color difference of peanut seed coats is related to the anthocyanin content, the biosynthesis of flavonoid compounds such as anthocyanin comprises a plurality of enzymatic reactions, and the biosynthesis and conversion of anthocyanin are finally influenced by the regulation of a plurality of enzyme genes. As the peanuts belong to underground results, the color of the peanut seeds cannot be rapidly identified in the breeding period, the color of the seeds can be determined only when the seeds are harvested and examined, and the breeding workload is increased. In recent years, molecular markers widely applied can be selected in an auxiliary mode in a seedling stage, and non-target property materials can be removed in time, so that screening efficiency can be greatly improved. Therefore, molecular markers closely linked with the color of peanut seeds are developed to assist in improving multicolor peanut varieties, so that the peanut breeding efficiency can be effectively improved, and the breeding period can be shortened.

At present, the most widely popularized peanut varieties mainly adopt pink and deep red, and screening of molecular markers capable of rapidly identifying two seed coat colors is a key for accelerating the breeding process.

A Single Nucleotide Polymorphism (SNP) is a genetic polymorphism caused by variation of a single base in the nucleotide sequence of a specific region. SNP is applied to molecular markers of peanuts, belongs to the starting stage, and only few reports exist. Tang-moon et al (2010) obtained 5496 candidate SNP sites from sequencing data of peanut cultivar genomic DNA, and on average, one candidate SNP site appeared every 27.86bp, so peanut genomic sequence candidate SNP showed a higher frequency. In addition, by analyzing 85979 cultivated peanut EST sequences, the occurrence frequency of SNP was found to be 4.71%. However, there are few studies on the functionality of peanut SNP markers.

Kompetitive Allele Specific PCR (KASP) marking technology can distinguish different equivalent variations of SNP markers through fluorescent probes, and is high in flux, rapid and stable, and is an ideal molecular marker. The KASP technique is a technique for identifying SNP sites that is currently common, but the KASP technique for identifying SNPs associated with peanut seed coat color has been rarely reported.

Disclosure of Invention

The invention aims to provide a KASP molecular marker related to peanut seed coat color and application thereof. The research of the invention discovers that the color of peanut seed coats is%Peanut Testa CColor) gene AhPTC12 has a SNP locus in an exon region, wherein the SNP locus is related to peanut seed coat color; based on the SNP locus, the invention develops a KASP molecular marker related to the color of peanut seed coats, and the KASP molecular marker can be used for accurately genotyping the pink seed coats and the deep red peanut seed coats. The method can assist in selecting in the seedling stage of the peanuts, can rapidly and accurately distinguish the pink and dark red peanut shells, can effectively improve the peanut breeding efficiency and shorten the breeding yearAnd (5) limiting.

In order to achieve the above purpose, the invention adopts the following technical scheme:

in a first aspect of the invention, there is provided the use of a substance that detects a specific SNP for the identification or assisted identification of peanut seed coat colour;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

Preferably, the peanut seed coat identified or assisted in identification is pink and/or dark red in color.

In a second aspect of the invention, there is provided the use of a substance for detecting a specific SNP in peanut breeding; the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

In a third aspect of the present invention, there is provided a KASP molecular marker primer set for detecting a specific SNP, comprising: a first allele-specific primer shown in SEQ ID No.5, a second allele-specific primer shown in SEQ ID No.6, and a universal primer shown in SEQ ID No. 7.

The specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

In a fourth aspect of the present invention, there is provided the use of the above-described KASP molecular marker primer set in (1) or (2) as follows:

(1) Identifying or assisting in identifying the color of peanut seed coats;

(2) And (5) breeding peanuts.

Preferably, the peanut seed coat identified or assisted in identification is pink and/or dark red in color.

In a fifth aspect of the present invention, there is provided a method of identifying or assisting in identifying the colour of peanut seed coats, comprising the steps of:

detecting the genotype of the peanut to be detected based on the specific SNP; the seed coats of GG genotype peanuts are pink, and the seed coats of AA genotype peanuts are dark red;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

Preferably, the KASP molecular marker primer group is adopted to detect the genotype of the peanut to be detected based on the specific SNP.

Preferably, the PCR reaction procedure for detection is: pre-denaturation at 94℃for 15min; denaturation at 94℃for 10s, gradient annealing at 61-55℃for 60s, 0.6℃decrease per cycle, 10 cycles; denaturation at 94℃for 20s and annealing at 55℃for 60s,26 cycles.

In a sixth aspect of the present invention, there is provided a method of breeding peanuts comprising the steps of:

detecting genotypes of peanuts based on specific SNP in the seedling stage of the peanuts; the seed coats of GG genotype peanuts are pink, and the seed coats of AA genotype peanuts are dark red; selecting peanut seedlings with corresponding genotypes according to breeding targets;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

The invention has the beneficial effects that:

(1) According to the invention, SNP (single nucleotide polymorphism) for distinguishing pink and dark red seed colors of peanuts is 117190528 th nucleotide G-A on peanut chromosome 12.

(2) By using the SNP, KASP markers were developed, by which pink and deep red peanuts can be accurately genotyped. The method can be used for carrying out auxiliary selection in the peanut seedling stage, can rapidly and accurately distinguish pink and dark red peanuts, can effectively improve the peanut breeding efficiency and shortens the breeding period.

Drawings

Fig. 1: mountain flower No. 15 and medium flower No. 12 seed color.

Fig. 2: RIL population LB (mountain flower No. 15 x medium flower 12) seed coat color.

Fig. 3: RIL population LF (white sand 1016 x ICGV 86699) parent and partial family seed color.

Fig. 4: and detecting SNP loci of peanut seed colors.

Fig. 5: peanut AhPTC12 genotyping results based on KASP technology.

Detailed Description

It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

As described in the background section, screening molecular markers that can rapidly identify peanut seed coat color is critical to accelerate the peanut breeding process. Although the occurrence frequency of candidate SNP of peanut genome sequence is high, the research on the peanut SNP marker functionality is very little.

The color difference of peanut seed coats is related to the anthocyanin content, the biosynthesis of flavonoid compounds such as anthocyanin comprises a plurality of enzymatic reactions, the biosynthesis and conversion of anthocyanin are finally influenced by the regulation and control of a plurality of enzyme genes and transcription factors, the research on metabolic pathway of peanut seed coats anthocyanin is less, and the key genes for controlling anthocyanin synthesis and conversion are not clear at present; meanwhile, cultivated peanuts are heterotetraploids (2n=4x=40, AABB), the genome size is 2.7Gb, the structure is complex, the difficulty in searching SNP related to peanut seed coat color through colony gene positioning is high, and screening of peanut seed color through single SNP is not reported.

The peanut AhPTC12 gene is a candidate gene for influencing the color of peanut seed coats. The invention carries out cDNA sequencing on AhPTC12 genes of flowers 12 'in pink parent varieties' mountain flower 15 'and deep red parent', wherein the cDNA sequence of the mountain flower 15 'is shown as SEQ ID NO.1, the amino acid sequence of the coded protein is shown as SEQ ID NO.2, the cDNA sequence of the flower 12' is shown as SEQ ID NO.3, the amino acid sequence of the coded protein is shown as SEQ ID NO.4, and the gene is found to have a SNP locus in an exon region, and the SNP locus is 117190528 th nucleotide G-A (corresponding to the 611 st nucleotide of the cDNA sequences shown as SEQ ID NO.1 and SEQ ID NO. 3) on peanut genome (https:// www.peanutbase.org/peaut_genome /).

The precondition of KASP marker development is to pinpoint genes controlling related traits and mine SNPs. If the repeated sequences near the excavated SNP site are too many, the GC content is too high or too low, the primer is not suitable to be designed; meanwhile, the tail end of the forward primer designed by the KASP marker is required to be a SNP mutation site, the design of the primer is limited, the quality of the primer is affected, and non-specific amplification can occur, so that typing failure is caused. Proved by verification, the SNP locus meets the requirement of KASP marker development: and the SNP loci are adjacent to other SNP loci, are positioned in non-SNP dense regions, and avoid continuous AT and GC content high-order complex regions.

By utilizing the SNP locus to develop a KASP marker, the invention designs two allele-specific primers and one universal primer.

Allele primer 1: underlined are FAM fluorescent tag sequences

GAAGGTGACCAAGTTCATGCTATCATCGGCAGCTGCAGTGAC；(SEQ ID NO.5)

Allele primer 2: underlined is HEX fluorescent tag sequence

GAAGGTCGGAGTCAACGGATTCATCATCGGCAGCTGCAGTGAT；(SEQ ID NO.6)

Universal primer: CCAAACCTGTCCCATTGAGTTGGTT. (SEQ ID NO. 7)

KASP markers were used to verify that 452 materials were used in the genotype homozygous two higher generation RIL populations and parents, the color traits of the two RIL populations being pink and dark red (see table 1 for specific phenotypic results). DNA from the population material was extracted as an amplification template, PCR amplification was performed using developed KASP primers, and after amplification was completed, the amplified DNA was placed on an Omega fluorescent signal reader and Araya to convert the fluorescent signal into an analyzable value, and then genotyping was performed using the analysis software Krake (TM) supplied by LGC. The detection parting result shows that the pink seed family and the dark red seed family can be accurately parting, and the accuracy is 100%.

In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples of the present invention are all conventional in the art and are commercially available. The experimental procedure, without specifying the detailed conditions, was carried out according to the conventional experimental procedure or according to the operating instructions recommended by the suppliers.

Peanut cultivars used in the present invention include mountain flower No. 15, white sand 1016, medium flower 12 and ICGV86699; among them, the Zhonghua 12 and ICGV86699 were from institute of oil crops, national institute of agricultural sciences, mountain flower 15, white sand 1016, RIL population LF (white sand 1016×ICGV 86699), LB (mountain flower 15×Zhonghua 12) were from Shandong university of agriculture.

Seed color pairs of mountain 15 and medium 12 such as shown in fig. 1; the seed coat color of RIL population LB (mountain flower No. 15 x medium flower 12) is shown in fig. 2; the RIL population LF (white sand 1016X ICGV 86699) parent and part of the family seed colors are shown in FIG. 3.

The color of peanut seed coats in the invention is judged according to peanut germplasm resource description specification and data standard (Jiang Huifang, duan Naixiong. Peanut germplasm resource description specification and data standard [ M ]. Beijing: chinese agriculture Press, 2006).

Example 1: cloning and sequencing of peanut AhPTC12 gene cDNA

And (3) carrying out electrophoresis detection on the extracted RNA, and carrying out subsequent experiments after the detection is qualified.

1.1 Synthesis of first strand cDNA (using Fermentas RevertAid First Strand cDNA Synthesis Kit)

1. Mu.g of total RNA, and 1. Mu.l of 100. Mu.M oligo (dT) primer were added to RNase-free PCR tubes and the volume was 12. Mu.l of DEPC-treated sterilized water; the mixture was treated at 65℃for 5 minutes and then immediately cooled on ice for 1 minute; then, 4. Mu.l of 5X reaction buffer, 1. Mu. l RiboLock RNase Inhibitor (20U/. Mu.l), 2. Mu.l of 10mM dNTP mix, 1. Mu.l of Reverted air M-MuLV Reverse Transcriptase (200U/. Mu.l) were added in this order to the reaction solution; gently mixing, and centrifuging for a short time; incubating for 1 hour at 42 ℃ on a PCR instrument; the reaction was terminated by incubating at 70℃for 5 minutes.

1.2 amplification of AhPTC12 Gene

The primer sequences were synthesized by the company of Shanghai, inc., and the sequences were as follows:

AhANR-F：5’-ATGGCTAGCATCGAGAACC-3’；(SEQ ID NO.8)

AhANR-R：5’-CTAGTTCTTGAGGGCACC-3’。(SEQ ID NO.9)

PCR amplification system: 50 μl of the total system, including PCR-Grade Water:15.0 μl,2× PCR Buffer for KOD FX Neo:25.0 μl, dNTP Mix (10 mM): 1.0 μl, KOD FX Neo (1U/. Mu.l): 1.0 μl, cDNA first strand: 5.0 μl, primer F (10X): 1.5 μl, primer R (10X): 1.5 μl.

PCR reaction procedure: pre-denaturation at 98 ℃ for 5min; denaturation at 98℃for 30s, gradient annealing at 55℃for 30s, extension at 72℃for 1.5min,35 cycles; extending for 10min at 72 ℃.

1.2 agarose gel recovery:

placing a target strip gel block cut from agarose gel after agarose gel electrophoresis into a clean centrifuge tube, and weighing; adding 3 times volume of sol solution into the gel block, placing in 50-55deg.C water bath for 10min, and continuously gently turning the centrifuge tube upside down to ensure the gel block to be fully dissolved. Adding the solution obtained in the last step into an adsorption column, centrifuging at 12000rpm for 30-60 seconds, pouring out waste liquid in a collecting pipe, and putting the adsorption column into the collecting pipe again; adding 600 μl of the rinse solution into the adsorption column, centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into a collecting tube; adding 600 μl of the rinse solution into the adsorption column, centrifuging at 12000rpm for 1min, discarding the waste liquid, and placing the adsorption column into a collecting tube; centrifuging at 12000rpm for 2min, removing rinsing liquid as much as possible, placing the adsorption column in an open room temperature or 50 ℃ incubator for several minutes, removing residual rinsing liquid in the adsorption column, and preventing ethanol in the rinsing liquid from affecting subsequent experiments; placing the adsorption column into a clean centrifuge tube, suspending and dripping a proper amount of eluent preheated by a water bath at 65 ℃ into the center of the adsorption film, standing for 2min at room temperature, and centrifuging for 1min at 12000 rpm; recovering the product and preserving at-20 ℃.

1.3 ligation and transformation:

10 μl of the reaction system was used with the T4 ligase kit from TaKaRa: pMD-18Vector:1.0 μl, PCR recovery of product: 7.0 μl, T4 Ligase buffer:1.0 μl, T4 DNA library: 1.0 μl, overnight at 4deg.C. Taking 100 μl of competent cell suspension from-80deg.C refrigerator, and thawing on ice; adding 10 μl of the ligation product, gently flicking, and standing on ice for 25 minutes; heat-shocking in water bath at 42 deg.c for 45 sec, and cooling in ice for 2min; adding 0.6ml LB liquid culture medium (without ampicillin) into the tube, shaking and culturing at 37 ℃ for 1 hour after uniform mixing to recover the bacteria to a normal growth state, and expressing the antibiotic resistance gene encoded by the plasmid; shaking the bacterial liquid evenly, taking 100 mu l of the bacterial liquid, coating the bacterial liquid on a screening plate containing Amp, standing the bacterial liquid for half an hour in the front side, inverting a culture dish after the bacterial liquid is completely absorbed by a culture medium, and culturing the bacterial liquid at 37 ℃ for 16-24 hours.

1.4 identification and screening of Positive clones

24 round, single white colonies were randomly picked with sterilized toothpicks and transferred to an EP tube containing 300. Mu.l ampicillin medium for incubation at 37℃for 8 hours; positive clones identified 50. Mu.l PCR reaction: taKaRa Taq (5U/. Mu.l): 0.28. Mu.l, 10 XPCR Buffer (Mg ²⁺ Plus): 5.0 μl, dNTP mix (2.5 mM each): 4.0 μl of the bacterial liquid to be detected: 2.5 μl, M13F (20 μM): 1.0 μl, M13R (20 μM): 1.0 μl of sterilized distilled water: 36.25 μl. PCR reaction procedure: pre-denaturation at 94℃for 2min; denaturation at 94℃for 10s, gradient annealing at 55℃for 30s, elongation at 68℃for 1.0min,35 cycles; extending for 10min at 68 ℃.

Based on the size of the DNA bands detected by the electrophoreses, clones meeting the expected size were picked up and sent to the division of biological engineering (Shanghai) for sequencing. Sequence alignment analysis was performed using DNAMAN software, and the results showed that there were 1 mutation sites in the AhPTC12 genes of mountain flower No. 15 and medium flower No. 12, and that the SNP was nucleotide g→a at nucleotide 117190528 on chromosome 12 of peanut (fig. 4).

Example 2: color-related KASP marker development for peanut seeds

The KaSP marker was developed using the pink seed peanut variety mountain flower 15 and white sand 1016, and the deep red seed peanut variety flower 12 and ICGV 86699.

KASP markers were developed using the SNP sites detected in example 1, and two allele-specific primers and one universal primer were designed.

Allele primer 1: underlined are FAM fluorescent tag sequences

GAAGGTGACCAAGTTCATGCTATCATCGGCAGCTGCAGTGAC；

Allele primer 2: underlined is HEX fluorescent tag sequence

GAAGGTCGGAGTCAACGGATTCATCATCGGCAGCTGCAGTGAT；

Universal primer: CCAAACCTGTCCCATTGAGTTGGTT.

Extracting peanut leaf DNA by adopting a CTAB method, and measuring the purity and concentration of a DNA sample by using a spectrophotometer, wherein A260/280:1.8-2.2, 260/230> =2.0; the DNA was diluted to 50-100 ng/. Mu.l.

KASP detection PCR reaction system: DNA:0.8 μl,2×Master mix:0.4 μl, primer: 0.022 μl, H ₂ O：0.4μl。

KASP detection PCR reaction procedure: pre-denaturation at 94℃for 15min; denaturation at 94℃for 10s, gradient annealing at 61-55℃for 60s, 0.6℃decrease per cycle, 10 cycles; denaturation at 94℃for 20s and annealing at 55℃for 60s,26 cycles.

Reading of KASP fluorescent signals

After the completion of the KASP detection PCR reaction procedure, the 96-well plate or Tape was placed on an Omega fluorescent signal reader and Araya, respectively, to convert the fluorescent signal into an analyzable value, and then genotyping was performed using the analysis software Krake (TM) supplied by LGC company.

The genotyping result of peanut AhPTC12 based on KASP technology is shown in FIG. 5, the genotyping result at the upper right corner of the graph is GG, the corresponding material seed coat is pink, the genotyping result at the lower right corner of the graph is AA, and the corresponding material seed is dark red. It can be seen that the SNP markers can be used to distinguish pink and dark red peanut seeds.

The detection result shows that: the KASP marker developed by the invention can be used for typing pink and dark red seed peanut varieties, wherein genotype G: G is the pink seed variety, and genotype A: A is the dark red seed variety.

Example 3: correlation analysis of SNP molecular markers and peanut seed color traits

The SNP of the invention verifies 452 materials in total from two peanut high-generation RIL groups of Shandong agricultural university, and the DNA extraction and KASP technical reaction system is the same as that of example 2; genotyping and phenotypic statistics are shown in Table 1.

Table 1: typing results for identifying peanut seed color materials

As can be seen from Table 1, there are two families with genotype A: G heterozygous, phenotype pink seed, other genotypes G: G pink seed variety, genotype A: A dark red seed variety. The results show that: the molecular marker is used for identifying pink/dark red seed peanuts to be 100% accurate.

The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Shandong agricultural university

<120> KASP molecular marker related to peanut seed coat color and application thereof

<130> 2020

<160> 9

<170> PatentIn version 3.5

<210> 1

<211> 1023

<212> DNA

<213> mountain flower No. 15

<400> 1

ctagttcttg agggcaccct tagtctttaa gtattccaca gtctgatcat aaatttcttc 60

aactccatac ttgaaactga agccttcttt gataagcttc tcagaagaga cgattaactt 120

tgttttggag gggcaatcat tgaattcagt tggaacttta tactgagggt accgtttgtt 180

aagaaactta gcaagctcag gaacactagt gttgtggcca cagcaaatgt atctaccaga 240

agctgattcc ttctctgcca caaatatatg tgcccggcaa atatcctcca catgagttat 300

ggatattgaa cctgacagca tctgcattcc tttcaaacca tttatgagga aatcgttgcc 360

tgttataagg catgtggcaa ggccaacact agatgggata tctggggtga gagaaggacc 420

aactgtgagg gcaggtatga cagtgatgag attaatgtga ttctcttcag caaatttcca 480

tgcagccttc tcagctagtg ttttggatgc tggatatccc caagtaggtg gctttgcagt 540

gttcaagaat tcaatatcag tccagttggt ttcatccatg accaaacctg tcccattgag 600

ttggtttata gtcactgcag ctgccgatga tgtcaggatt actcttttaa cttgttttgc 660

ttttgaacat gctttcaaca cattcaggac accttttatt gctggcttta tcatgtcatt 720

ctcagggtct tcagaagcaa agttcacagg ggtagcaagt tggaagacta gttcacaacc 780

tgctattggg gcatcaaaat cttcttccac tgttaactct gctctaaata tcttcaactc 840

tcccacactt tttagtgcca ataggtgaga tattttctta agattatctg ggtttctaac 900

agtggtgttg acggcataac ctttctcaag caactgcttt atgagcaaag aagccacaaa 960

accagttcca ccaatgacgc atgccttctt cttattctcc atttggttct cgatgctagc 1020

cat 1023

<210> 2

<211> 340

<212> PRT

<213> mountain flower No. 15

<400> 2

Met Ala Ser Ile Glu Asn Gln Met Glu Asn Lys Lys Lys Ala Cys Val

1 5 10 15

Ile Gly Gly Thr Gly Phe Val Ala Ser Leu Leu Ile Lys Gln Leu Leu

20 25 30

Glu Lys Gly Tyr Ala Val Asn Thr Thr Val Arg Asn Pro Asp Asn Leu

35 40 45

Lys Lys Ile Ser His Leu Leu Ala Leu Lys Ser Val Gly Glu Leu Lys

50 55 60

Ile Phe Arg Ala Glu Leu Thr Val Glu Glu Asp Phe Asp Ala Pro Ile

65 70 75 80

Ala Gly Cys Glu Leu Val Phe Gln Leu Ala Thr Pro Val Asn Phe Ala

85 90 95

Ser Glu Asp Pro Glu Asn Asp Met Ile Lys Pro Ala Ile Lys Gly Val

100 105 110

Leu Asn Val Leu Lys Ala Cys Ser Lys Ala Lys Gln Val Lys Arg Val

115 120 125

Ile Leu Thr Ser Ser Ala Ala Ala Val Thr Ile Asn Gln Leu Asn Gly

130 135 140

Thr Gly Leu Val Met Asp Glu Thr Asn Trp Thr Asp Ile Glu Phe Leu

145 150 155 160

Asn Thr Ala Lys Pro Pro Thr Trp Gly Tyr Pro Ala Ser Lys Thr Leu

165 170 175

Ala Glu Lys Ala Ala Trp Lys Phe Ala Glu Glu Asn His Ile Asn Leu

180 185 190

Ile Thr Val Ile Pro Ala Leu Thr Val Gly Pro Ser Leu Thr Pro Asp

195 200 205

Ile Pro Ser Ser Val Gly Leu Ala Thr Cys Leu Ile Thr Gly Asn Asp

210 215 220

Phe Leu Ile Asn Gly Leu Lys Gly Met Gln Met Leu Ser Gly Ser Ile

225 230 235 240

Ser Ile Thr His Val Glu Asp Ile Cys Arg Ala His Ile Phe Val Ala

245 250 255

Glu Lys Glu Ser Ala Ser Gly Arg Tyr Ile Cys Cys Gly His Asn Thr

260 265 270

Ser Val Pro Glu Leu Ala Lys Phe Leu Asn Lys Arg Tyr Pro Gln Tyr

275 280 285

Lys Val Pro Thr Glu Phe Asn Asp Cys Pro Ser Lys Thr Lys Leu Ile

290 295 300

Val Ser Ser Glu Lys Leu Ile Lys Glu Gly Phe Ser Phe Lys Tyr Gly

305 310 315 320

Val Glu Glu Ile Tyr Asp Gln Thr Val Glu Tyr Leu Lys Thr Lys Gly

325 330 335

Ala Leu Lys Asn

340

<210> 3

<211> 1023

<212> DNA

<213> middle flower 12

<400> 3

ctagttcttg agggcaccct tagtctttaa gtattccaca gtctgatcat aaatttcttc 60

aactccatac ttgaaactga agccttcttt gataagcttc tcagaagaga cgattaactt 120

tgttttggag gggcaatcat tgaattcagt tggaacttta tactgagggt accgtttgtt 180

aagaaactta gcaagctcag gaacactagt gttgtggcca cagcaaatgt atctaccaga 240

agctgattcc ttctctgcca caaatatatg tgcccggcaa atatcctcca catgagttat 300

ggatattgaa cctgacagca tctgcattcc tttcaaacca tttatgagga aatcgttgcc 360

tgttataagg catgtggcaa ggccaacact agatgggata tctggggtga gagaaggacc 420

aactgtgagg gcaggtatga cagtgatgag attaatgtga ttctcttcag caaatttcca 480

tgcagccttc tcagctagtg ttttggatgc tggatatccc caagtaggtg gctttgcagt 540

gttcaagaat tcaatatcag tccagttggt ttcatccatg accaaacctg tcccattgag 600

ttggtttata atcactgcag ctgccgatga tgtcaggatt actcttttaa cttgttttgc 660

ttttgaacat gctttcaaca cattcaggac accttttatt gctggcttta tcatgtcatt 720

ctcagggtct tcagaagcaa agttcacagg ggtagcaagt tggaagacta gttcacaacc 780

tgctattggg gcatcaaaat cttcttccac tgttaactct gctctaaata tcttcaactc 840

tcccacactt tttagtgcca ataggtgaga tattttctta agattatctg ggtttctaac 900

agtggtgttg acggcataac ctttctcaag caactgcttt atgagcaaag aagccacaaa 960

accagttcca ccaatgacgc atgccttctt cttattctcc atttggttct cgatgctagc 1020

cat 1023

<210> 4

<211> 340

<212> PRT

<213> middle flower 12

<400> 4

Met Ala Ser Ile Glu Asn Gln Met Glu Asn Lys Lys Lys Ala Cys Val

1 5 10 15

Ile Gly Gly Thr Gly Phe Val Ala Ser Leu Leu Ile Lys Gln Leu Leu

20 25 30

Glu Lys Gly Tyr Ala Val Asn Thr Thr Val Arg Asn Pro Asp Asn Leu

35 40 45

Lys Lys Ile Ser His Leu Leu Ala Leu Lys Ser Val Gly Glu Leu Lys

50 55 60

Ile Phe Arg Ala Glu Leu Thr Val Glu Glu Asp Phe Asp Ala Pro Ile

65 70 75 80

Ala Gly Cys Glu Leu Val Phe Gln Leu Ala Thr Pro Val Asn Phe Ala

85 90 95

Ser Glu Asp Pro Glu Asn Asp Met Ile Lys Pro Ala Ile Lys Gly Val

100 105 110

Leu Asn Val Leu Lys Ala Cys Ser Lys Ala Lys Gln Val Lys Arg Val

115 120 125

Ile Leu Thr Ser Ser Ala Ala Ala Val Ile Ile Asn Gln Leu Asn Gly

130 135 140

Thr Gly Leu Val Met Asp Glu Thr Asn Trp Thr Asp Ile Glu Phe Leu

145 150 155 160

Asn Thr Ala Lys Pro Pro Thr Trp Gly Tyr Pro Ala Ser Lys Thr Leu

165 170 175

Ala Glu Lys Ala Ala Trp Lys Phe Ala Glu Glu Asn His Ile Asn Leu

180 185 190

Ile Thr Val Ile Pro Ala Leu Thr Val Gly Pro Ser Leu Thr Pro Asp

195 200 205

Ile Pro Ser Ser Val Gly Leu Ala Thr Cys Leu Ile Thr Gly Asn Asp

210 215 220

Phe Leu Ile Asn Gly Leu Lys Gly Met Gln Met Leu Ser Gly Ser Ile

225 230 235 240

Ser Ile Thr His Val Glu Asp Ile Cys Arg Ala His Ile Phe Val Ala

245 250 255

Glu Lys Glu Ser Ala Ser Gly Arg Tyr Ile Cys Cys Gly His Asn Thr

260 265 270

Ser Val Pro Glu Leu Ala Lys Phe Leu Asn Lys Arg Tyr Pro Gln Tyr

275 280 285

Lys Val Pro Thr Glu Phe Asn Asp Cys Pro Ser Lys Thr Lys Leu Ile

290 295 300

Val Ser Ser Glu Lys Leu Ile Lys Glu Gly Phe Ser Phe Lys Tyr Gly

305 310 315 320

Val Glu Glu Ile Tyr Asp Gln Thr Val Glu Tyr Leu Lys Thr Lys Gly

325 330 335

Ala Leu Lys Asn

340

<210> 5

<211> 42

<212> DNA

<213> artificial sequence

<400> 5

gaaggtgacc aagttcatgc tatcatcggc agctgcagtg ac 42

<210> 6

<211> 43

<212> DNA

<213> artificial sequence

<400> 6

gaaggtcgga gtcaacggat tcatcatcgg cagctgcagt gat 43

<210> 7

<211> 25

<212> DNA

<213> artificial sequence

<400> 7

ccaaacctgt cccattgagt tggtt 25

<210> 8

<211> 19

<212> DNA

<213> artificial sequence

<400> 8

atggctagca tcgagaacc 19

<210> 9

<211> 18

<212> DNA

<213> artificial sequence

<400> 9

ctagttcttg agggcacc 18

Claims (7)

1. Application of primer for detecting specific SNP in identifying peanut seed coat color;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism;

the seed coats of GG genotype peanuts are pink, and the seed coats of AA genotype peanuts are dark red.

2. A KASP molecular marker primer set for detecting a specific SNP, comprising: a first allele-specific primer shown in SEQ ID NO.5, a second allele-specific primer shown in SEQ ID NO.6 and a universal primer shown in SEQ ID NO. 7;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

3. Use of the KASP molecular marker primer set of claim 2 for identifying peanut seed coat color;

the seed coats of GG genotype peanuts are pink, and the seed coats of AA genotype peanuts are dark red.

4. A method for identifying the color of peanut seed coats, comprising the steps of:

detecting the genotype of the peanut to be detected based on the specific SNP; the seed coats of GG genotype peanuts are pink, and the seed coats of AA genotype peanuts are dark red;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

5. The method according to claim 4, wherein the KASP molecular marker primer set according to claim 2 is used for detecting genotypes of peanuts to be detected based on specific SNP.

6. The method of claim 4, wherein the PCR reaction procedure is: pre-denaturation at 94℃for 15min; denaturation at 94℃for 10s, gradient annealing at 61-55℃for 60s, 0.6℃decrease per cycle, 10 cycles; denaturation at 94℃for 20s and annealing at 55℃for 60s,26 cycles.

7. A method for peanut breeding, comprising the steps of:

detecting genotypes of peanuts based on specific SNP in the seedling stage of the peanuts; the seed coats of GG genotype peanuts are pink, and the seed coats of AA genotype peanuts are dark red; selecting peanut seedlings with corresponding genotypes according to breeding targets;

the specific SNP is 117190528 nucleotide on chromosome 12 of peanut genome; the specific SNP is a G/A polymorphism.

Images