CN113832250B - Mixed sample detection method for detecting corn seed purity based on mSNP technology - Google Patents
Mixed sample detection method for detecting corn seed purity based on mSNP technology Download PDFInfo
- Publication number
- CN113832250B CN113832250B CN202111154587.8A CN202111154587A CN113832250B CN 113832250 B CN113832250 B CN 113832250B CN 202111154587 A CN202111154587 A CN 202111154587A CN 113832250 B CN113832250 B CN 113832250B
- Authority
- CN
- China
- Prior art keywords
- primer
- sequence
- seq
- primer pair
- magnetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 240000008042 Zea mays Species 0.000 title claims abstract description 65
- 235000002017 Zea mays subsp mays Nutrition 0.000 title claims abstract description 65
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 title claims abstract description 60
- 235000005822 corn Nutrition 0.000 title claims abstract description 60
- 238000001514 detection method Methods 0.000 title claims abstract description 30
- 238000005516 engineering process Methods 0.000 title claims abstract description 21
- 238000000034 method Methods 0.000 claims abstract description 27
- 238000002156 mixing Methods 0.000 claims abstract description 27
- 238000012163 sequencing technique Methods 0.000 claims abstract description 20
- 108020004414 DNA Proteins 0.000 claims description 95
- 239000011324 bead Substances 0.000 claims description 69
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 claims description 36
- 239000006228 supernatant Substances 0.000 claims description 36
- 239000000243 solution Substances 0.000 claims description 27
- 239000000047 product Substances 0.000 claims description 25
- 238000007664 blowing Methods 0.000 claims description 12
- 238000012216 screening Methods 0.000 claims description 10
- 238000012408 PCR amplification Methods 0.000 claims description 9
- 239000000725 suspension Substances 0.000 claims description 9
- 239000012634 fragment Substances 0.000 claims description 6
- 239000011259 mixed solution Substances 0.000 claims description 6
- 238000005406 washing Methods 0.000 claims description 6
- 102000053602 DNA Human genes 0.000 claims description 5
- 108020004682 Single-Stranded DNA Proteins 0.000 claims description 5
- 235000016383 Zea mays subsp huehuetenangensis Nutrition 0.000 claims description 5
- 239000000872 buffer Substances 0.000 claims description 5
- 230000029087 digestion Effects 0.000 claims description 5
- 235000009973 maize Nutrition 0.000 claims description 5
- 238000012360 testing method Methods 0.000 claims description 5
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 claims description 5
- 239000000463 material Substances 0.000 claims description 4
- QKNYBSVHEMOAJP-UHFFFAOYSA-N 2-amino-2-(hydroxymethyl)propane-1,3-diol;hydron;chloride Chemical compound Cl.OCC(N)(CO)CO QKNYBSVHEMOAJP-UHFFFAOYSA-N 0.000 claims description 3
- 238000007400 DNA extraction Methods 0.000 claims description 3
- 238000003752 polymerase chain reaction Methods 0.000 claims description 3
- 238000002360 preparation method Methods 0.000 claims description 3
- 239000011535 reaction buffer Substances 0.000 claims description 3
- 230000002194 synthesizing effect Effects 0.000 claims description 3
- 238000006243 chemical reaction Methods 0.000 claims description 2
- 238000001179 sorption measurement Methods 0.000 claims 1
- 239000002773 nucleotide Substances 0.000 abstract description 8
- 125000003729 nucleotide group Chemical group 0.000 abstract description 8
- 230000003321 amplification Effects 0.000 abstract description 6
- 238000003199 nucleic acid amplification method Methods 0.000 abstract description 6
- 108090000623 proteins and genes Proteins 0.000 abstract description 6
- 108091093088 Amplicon Proteins 0.000 abstract description 5
- 230000008117 seed development Effects 0.000 abstract description 2
- 230000000007 visual effect Effects 0.000 abstract description 2
- 239000003550 marker Substances 0.000 description 6
- 108090000790 Enzymes Proteins 0.000 description 4
- 102000004190 Enzymes Human genes 0.000 description 4
- 108010044467 Isoenzymes Proteins 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 102000004169 proteins and genes Human genes 0.000 description 4
- 238000001962 electrophoresis Methods 0.000 description 3
- 102000054766 genetic haplotypes Human genes 0.000 description 3
- 238000007894 restriction fragment length polymorphism technique Methods 0.000 description 3
- 230000035945 sensitivity Effects 0.000 description 3
- 208000003643 Callosities Diseases 0.000 description 2
- 206010020649 Hyperkeratosis Diseases 0.000 description 2
- 101150050559 SOAT1 gene Proteins 0.000 description 2
- 208000005652 acute fatty liver of pregnancy Diseases 0.000 description 2
- 230000015572 biosynthetic process Effects 0.000 description 2
- 210000000349 chromosome Anatomy 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- 230000018109 developmental process Effects 0.000 description 2
- 230000000694 effects Effects 0.000 description 2
- 230000007613 environmental effect Effects 0.000 description 2
- 230000014509 gene expression Effects 0.000 description 2
- 230000007614 genetic variation Effects 0.000 description 2
- 238000009396 hybridization Methods 0.000 description 2
- 239000003147 molecular marker Substances 0.000 description 2
- 230000000877 morphologic effect Effects 0.000 description 2
- 230000035772 mutation Effects 0.000 description 2
- 238000009401 outcrossing Methods 0.000 description 2
- 102000054765 polymorphisms of proteins Human genes 0.000 description 2
- 238000003786 synthesis reaction Methods 0.000 description 2
- 108091028043 Nucleic acid sequence Proteins 0.000 description 1
- 102100021993 Sterol O-acyltransferase 1 Human genes 0.000 description 1
- 238000010521 absorption reaction Methods 0.000 description 1
- 238000004458 analytical method Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 239000003150 biochemical marker Substances 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000013461 design Methods 0.000 description 1
- 239000012149 elution buffer Substances 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 235000013305 food Nutrition 0.000 description 1
- 238000012423 maintenance Methods 0.000 description 1
- 238000004519 manufacturing process Methods 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 238000009331 sowing Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
- 210000001519 tissue Anatomy 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a mixed sample detection method for detecting corn seed purity based on mSNP technology, which is carried out by using a primer pair 1F/R-20F/R, wherein the gene sequence of the primer pair 1F/R-20F/R is shown in SEQ ID No. 1-40; according to the invention, by adopting mSNP technology, more SNP variation can be detected under the condition that the amplicon is unchanged; by adopting the sample mixing method for detection, the sequencing cost is reduced while the amplification workload is reduced, the detection speed is also accelerated, and the detection of 1440 seeds can be finished at most in one day. The method directly reads single nucleotide polymorphism by using a sequencing technology, directly judges the purity result by a program, has visual and reliable result and avoids the influence of subjective factors in the seed development period and the result judging.
Description
Technical Field
The invention belongs to the field of seed purity detection, and particularly relates to a mixed sample detection method for detecting corn seed purity based on mSNP technology.
Background
Corn is one of three large grain crops in the world, and has wide application in the industries of food, feed, energy and the like. According to the data of the Chinese report network, the corn sowing area in 2019 reaches 4128 ten thousand hm 2, and the total yield reaches 2.6 hundred million tons. Corn is also one of the most successful crops for heterosis utilization, and high-purity corn hybrid seeds are the basis for fully exerting the advantages of hybrid seeds. The corn has large planting area, so the demand for seeds is large, and the quality problem of seeds is particularly critical. Therefore, the stable development of corn production is ensured, the corn yield is promoted to be stably improved, and the method has great promotion effects on the stability of the society of China and the maintenance of the living standard of people.
Seed purity is a core indicator of seed quality, and has direct effects on corn yield and quality. The corn seed purity was reduced by 1% and the yield was reduced by 135kg/hm 2. The purity identification of corn hybrid is a key link in a corn seed quality control system. Traditional morphological identification relies on variety phenotype differences, is greatly influenced by environmental influence, long period and large workload, is limited by seasons, professional level of identification staff and the like, and seriously influences the speed of seed quality marketing. The most widely used physiological and biochemical marker identification is the isozyme and seed protein electrophoresis technology. Isozymes are generally extracted from tissues such as coleoptile, roots, leaves and the like of corn, and the results are inaccurate due to the fact that the consistent expression is difficult to ensure during extraction, and the isozymes have high requirements on environment and high cost due to electrophoresis. Protein electrophoresis distinguishes different varieties according to characteristic protein marks generated by the different varieties, and has good stability and good repeatability. However, isozymes and proteins are products of gene expression, and polymorphism among varieties cannot be completely displayed, and particularly in the current breeding work, the germplasm basis is gradually narrowed, and physiological and biochemical identification is difficult to identify hybrid seeds with close relations. With the development of molecular biology, identification of DNA molecular markers is the most widely used method for seed purity identification. The molecular marker directly reflects the difference between genome DNA, and compared with morphological markers and biochemical markers, the molecular marker has the advantages of multiple sites, high polymorphism, no environmental influence and the like, and provides a more accurate and reliable method for variety identification. Common molecular markers are RFLP, RAPD, AFLP, SSR, etc. RFLP markers have the advantages of stable polymorphism, good repeatability and the like, but are complex to operate, large in DNA consumption, and require radioisotopes and the like. RAPD marking is simple to operate, small in DNA requirement and high in sensitivity, and researchers such as McDonald, wu Minsheng, zhao Jiuran and Guo Jinglun all use the technology to carry out purity identification on corn materials in corn purity identification. However, the marker is a dominant marker, and the banding pattern of one of the hybrid and the parent is likely to be consistent, limiting the applicability of the method. AFLP has the reliability of RFLP technology and the high efficiency of PCR technology. The technology is first used by pioneer in the United states to identify maize inbred lines and hybrids; gao Shi and Yuan Lihang have been used for germplasm identification by this technique. The marker has good polymorphism, high stability, more steps and higher technical requirements for operators. SSR markers are co-dominant, have good polymorphism, can be applied to corn purity identification in a plurality of ways, and all of Li Xiaohui, gao Wenwei, wang Fengge and the like carry out variety identification on corn by using the technology. Although the marker can effectively identify a variety whose phenotype is difficult to identify, it cannot be directly identified and analyzed for a DNA sequence or a change of one chromosome which involves only a certain site of the genome.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides a mixed sample detection method for detecting the purity of corn seeds based on mSNP technology, which is efficient, accurate and low in cost.
In order to achieve the above purpose, the technical scheme adopted by the invention is as follows:
the technical scheme is as follows:
primer set for corn seed purity detection according to mSNP technology, characterized in that it comprises primer pair 1F/R, primer pair 2F/R, primer pair 3F/R, primer pair 4F/R, primer pair 5F/R, primer pair 6F/R, primer pair 7F/R, primer pair 8F/R, primer pair 9F/R, primer pair 10F/R, primer pair 11F/R, primer pair 12F/R, primer pair 13F/R, primer pair 14F/R, primer pair 15F/R, primer pair 16F/R, primer pair 17F/R, primer pair 18F/R, primer pair 19F/R, primer pair 20F/R; wherein each primer pair consists of a forward primer and a reaction primer;
In the primer pair 1F/R, the sequence of the F primer is shown as SEQ ID No.1, and the sequence of the R primer is shown as SEQ ID No. 2;
in the primer pair 2F/R, the sequence of the F primer is shown as SEQ ID No.3, and the sequence of the R primer is shown as SEQ ID No. 4;
in the primer pair 3F/R, the sequence of the F primer is shown as SEQ ID No.5, and the sequence of the R primer is shown as SEQ ID No. 6;
In the primer pair 4F/R, the sequence of the F primer is shown as SEQ ID No.7, and the sequence of the R primer is shown as SEQ ID No. 8;
In the primer pair 5F/R, the sequence of the F primer is shown as SEQ ID No.9, and the sequence of the R primer is shown as SEQ ID No. 10;
in the primer pair 6F/R, the sequence of the F primer is shown as SEQ ID No.11, and the sequence of the R primer is shown as SEQ ID No. 12;
in the primer pair 7F/R, the sequence of the F primer is shown as SEQ ID No.13, and the sequence of the R primer is shown as SEQ ID No. 14;
in the primer pair 8F/R, the sequence of the F primer is shown as SEQ ID No.15, and the sequence of the R primer is shown as SEQ ID No. 16;
In the primer pair 9F/R, the sequence of the F primer is shown as SEQ ID No.17, and the sequence of the R primer is shown as SEQ ID No. 18;
in the primer pair 10F/R, the sequence of the F primer is shown as SEQ ID No.19, and the sequence of the R primer is shown as SEQ ID No. 20;
in the primer pair 11F/R, the sequence of the F primer is shown as SEQ ID No.21, and the sequence of the R primer is shown as SEQ ID No. 22;
In the primer pair 12F/R, the sequence of the F primer is shown as SEQ ID No.23, and the sequence of the R primer is shown as SEQ ID No. 24;
in the primer pair 13F/R, the sequence of the F primer is shown as SEQ ID No.25, and the sequence of the R primer is shown as SEQ ID No. 26;
in the primer pair 14F/R, the sequence of the F primer is shown as SEQ ID No.27, and the sequence of the R primer is shown as SEQ ID No. 28;
in the primer pair 15F/R, the sequence of the F primer is shown as SEQ ID No.29, and the sequence of the R primer is shown as SEQ ID No. 30;
in the primer pair 16F/R, the sequence of the F primer is shown as SEQ ID No.31, and the sequence of the R primer is shown as SEQ ID No. 32;
in the primer pair 17F/R, the sequence of the F primer is shown as SEQ ID No.33, and the sequence of the R primer is shown as SEQ ID No. 34;
in the primer pair 18F/R, the sequence of the F primer is shown as SEQ ID No.35, and the sequence of the R primer is shown as SEQ ID No. 36;
In the primer pair 19F/R, the sequence of the F primer is shown as SEQ ID No.37, and the sequence of the R primer is shown as SEQ ID No. 38;
In the primer pair 20F/R, the sequence of the F primer is shown as SEQ ID No.39, and the sequence of the R primer is shown as SEQ ID No. 40.
Further, the primer pair 1F/R-20F/R is obtained by mSNP technology.
The second technical scheme is as follows:
a mixed sample detection method for detecting the purity of corn seeds according to the primer group comprises the following steps:
step 1, selecting materials: selecting 1 or more corn varieties; at least 96 seeds are adopted for each corn sample;
Step 2, accurately quantifying corn genome DNA;
Step 3, synthesizing primers in the primer groups, wherein 10 primers with different target labels are synthesized when the forward primer and the reverse primer in each primer pair are synthesized; then mixing primers according to the appointed label combination to prepare primer mixed solution;
step 4, taking corn genome DNA as a template, and respectively carrying out one-round PCR amplification on the corn genome DNA by using the primer mixed solution to obtain a target region;
Step 5, mixing the obtained PCR amplification products in equal amounts;
Step 6, screening fragments of the mixed products;
step 7, digesting the single-stranded DNA in the system obtained after screening;
step 8, purifying the digested product;
Step 9, configuring a two-round PCR system in the system obtained in the step 8;
step 10, purifying the two rounds of PCR products to finish the preparation of a sequencing library;
Step 11, mixing the sequencing library with the same mass, and then sequencing by a machine to obtain sequencing data;
Step 12, disconnecting the obtained test data again according to the label combination;
and 13, identifying the genotype result of the target site of the test sample, and judging the purity of the seeds according to the genotype condition of the site.
Further, when the forward primer and the reverse primer in the primer pair are synthesized, 10 primers with different target labels are synthesized; in the tag combination of each primer pair, the tag sequence of the forward primer is different from the tag sequence of the reverse primer.
Further, in the step 3, the label sequences in the synthesized 10 forward primers with labels in each primer pair are respectively shown as SEQ ID No. 45-54;
The tag sequences in the synthesized 10 tagged reverse primers are shown in SEQ ID No. 55-64, respectively, for each primer pair.
Further, 10 pairs of tagged primers were synthesized for each primer pair, and the manner of tag combination of the forward primer and the reverse primer was selected from any one or more of Table 1.
Table 1: label combination mode
Further, in the step 3, the F primer in the primer pair 1F/R-20F/R further comprises an F-terminal universal primer, and the sequence of the F-terminal universal primer is shown as SEQ ID No. 41; the R primer in the primer pair 1F/R-20F/R also comprises an R-end universal primer, and the sequence of the R-end universal primer is shown as SEQ ID No. 42;
the sequence of Frimer F used in the two rounds of PCR in the step 9 is shown as SEQ ID No.43,
The sequence of the Primer R is shown as SEQ ID No. 44.
Further, when the maize variety is plural, the sequence of Primer R further includes a barcode sequence for discriminating maize varieties.
Further, in step 2, in the tag combination of each primer pair, the tag sequence of the forward primer is different from the tag sequence of the reverse primer.
Further, in step 1, the genomic DNA of the corn seed is extracted using a corn seed genomic DNA extraction kit.
Further, in step 4, the round of PCR amplification system: 8 μl of primer mix; the DNA dosage is 100ng;3*T enzyme 15. Mu.l; adding water to make up 45 μl;
the round of PCR amplification procedure: 3min at 95 ℃; (95 ℃ C. 30s,60 ℃ C. 4min,72 ℃ C. 30 s) 28 cycles; and at 72℃for 4min.
Further, in step 6, the mixed product is subjected to fragment screening, which comprises the following specific operations:
step 6.1, adding a round of magnetic beads with the volume of 0.4 times of that of the PCR, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and transferring the supernatant into a new tube;
Step 6.2, adding a round of magnetic beads with the volume of 0.6 times of that of the PCR, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;
step 6.3, adding a round of magnetic bead suspension with the volume of 0.9 times of that of the PCR, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
and 6.4, adding 100 mu l of 80% ethanol, repeatedly adsorbing the magnetic beads on different two sides by using a magnetic rack, fully washing the magnetic beads, adsorbing for 2min by using the magnetic rack, removing the supernatant, and standing at room temperature until the ethanol volatilizes cleanly.
In the step 7, single-stranded DNA in the system obtained after screening is digested, and the specific operation steps are as follows:
Step 7.1, adding 20 mu l of water into the obtained product, and uniformly mixing the magnetic beads;
Step 7.2, adsorbing magnetic beads, transferring 16 μl of supernatant to a new EP tube;
Step 7.3, adding 2 μl of Exo I and 2 μl of 10×reaction Buffer into the system;
and 7.4, the digestion procedure of the digestion system is as follows: 30min at 37 ℃; 15min at 85 ℃;
In step 8, the specific operation steps of purifying the digested product are as follows:
8.1, adding magnetic beads of which the number is 0.9, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clear, and removing the supernatant;
8.2, adding a magnetic bead heavy suspension with the same PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
And 8.3, adding 100 mu l of 80% ethanol, repeatedly adsorbing magnetic beads on different sides by using a magnetic rack, fully washing the magnetic beads, adsorbing for 2min by using the magnetic rack, removing the supernatant, and standing at room temperature until the ethanol volatilizes cleanly.
Further, in step 9, the two-round PCR system: 3*T enzyme 10. Mu.l; primer F; a Primer R; H2O18 μl;
the two-round PCR procedure: 3min at 95 ℃; (95 ℃ 15s,58 ℃ 15s,72 ℃ 30 s) 12 cycles; 72 ℃ for 4min;
Further, in step 10, the two rounds of PCR products were purified using 0.80 times of magnetic beads, and the specific procedure was as follows: step 10.1, adding magnetic beads of which the number is 0.8, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clear, and removing the supernatant;
Step 10.2, adding a magnetic bead heavy suspension with the same PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
Step 10.3, adding 100 μl of 80% ethanol, repeatedly adsorbing magnetic beads on different sides by using a magnetic rack, sufficiently washing the magnetic beads, adsorbing for 2min by using the magnetic rack, removing the supernatant, and standing at room temperature until the ethanol volatilizes completely;
Step 10.4, adding 23 μl of an absorption Buffer, fully suspending magnetic beads, standing at room temperature for 2min to elute DNA, adsorbing the magnetic beads with a magnet, and sucking the obtained supernatant DNA solution into a new tube to obtain a sequencing library; the said solution Buffer is 10mM Tris-HCl, pH 8.0-8.5.
Compared with the prior art, the invention has the following beneficial effects:
mSNP technology: the invention adopts mSNP technology, a plurality of SNP are corresponding in one amplicon, the information obtained by each amplicon fragment is utilized to the maximum extent, and SNP variation can be detected as much as possible under the condition that the amplicon is unchanged. And haplotypes can be formed among the SNPs, so that the mutation detection efficiency is improved. Therefore, not only can the variation in mSNP loci and among loci be adopted, but also the detection can be carried out by adopting a haplotype and SNP modes, so that the detection of the genetic variation is finer, and the accuracy and the sensitivity of the marker identification are improved. In the patent, 20 pairs of primer pairs are adopted, and the actually detected mutation information is more than 100, so that more polymorphic sites meeting the requirements can be screened out for purity identification analysis. Compared with the conventional SNP detection, the primer pair number is reduced, and the cost is reduced.
The cost is low: by adopting mSNP technology, more SNP variations can be detected under the condition that the amplicon is unchanged; by adopting a scheme of mixing and detecting at least 96 test sample products after one round of amplification, the sequencing cost is reduced while the workload of two rounds of amplification is reduced.
High efficiency: by adopting the mixed sample detection scheme, at least 96 products of detection samples are mixed for subsequent amplification and sequencing after one round of amplification, and the detection of 1440 seeds can be finished at most in one day. Compared with other detection methods, the method is simple to operate, does not need field planting, does not need experimental operation with large workload and large detection difficulty, and can rapidly detect seed purity.
The accuracy is that: the method directly reads single nucleotide polymorphism by using a sequencing technology, directly judges the purity result by a program, has visual and reliable result and avoids the influence of subjective factors in the seed development period and the result judging.
Drawings
FIG. 1 is a flow chart of the method for detecting mixed samples according to the present invention.
Detailed Description
Example 1: method for obtaining specific primers
The method for obtaining the specific primer comprises the following steps:
The whole genome resequencing data of corn is utilized, BWA-mem (http:// bio-BWA. Sourceforge. Net /) is adopted to be pasted back to the corn reference genome, and GATK (https:// software. Broadenstitute. Org/GATK /) is utilized for single nucleotide variation identification.
The identified single nucleotide variant locus set is screened, the minimum allelic variation frequency is more than 0.01, the heterozygosity rate is less than 15 percent, the deletion rate is less than 20 percent, single nucleotide variant loci are combined, a section with the single nucleotide locus number of 3-15 is screened, namely mSNP (polymononucleotide polymorphism) loci, compared with the traditional SNP (single nucleotide polymorphism) loci, mSNP loci can maximally utilize the information obtained by each primer pair, namely, as many SNP loci as possible are detected under the condition that the primer pair is unchanged, and all SNPs in the same primer pair can be combined into haplotypes, so that the polymorphism is higher. For example, there are two variants of A/T in one SNP, and the distinguishable polymorphisms are AA, AT, TT, 3 in total, if mSNP sites are detected, if there are 3 SNPs (A/T, G/T, C/A) in one primer pair, 8 (AGC, AGA, ATA, ATC, TGC, TGA, TTA, TTC) polymorphisms can be present. This allows for finer detection of genetic variations while improving the accuracy and sensitivity of marker identification. The number of the segments with high polymorphism is 36.
The primer design is carried out on 36 target segments, and the primer specificity is screened, so that 20 pairs of chromosome specific primers are obtained, and the total number of single nucleotide variation sites is 181. From the comprehensive consideration of detection cost and practical angle, according to the principle of 5-10% diversity among corn samples, 21 pairs of primer mixtures are finally selected to detect corn seed purity, and 170 SNP loci can be detected in total.
In the invention, 20 groups of specific primer pairs are obtained in total, namely primer pairs 1F/R-20F/R, and the gene sequences of the primer pairs 1F/R-20F/R are shown as SEQ ID No. 1-40.
Example 2: primer group for corn seed purity detection
The primer group for detecting the purity of the corn seeds comprises a primer pair 1F/R-20F/R, wherein the primer pair 1F/R-20F/R not only comprises a specific primer sequence shown as SEQ ID No. 1-40, but also comprises a general primer sequence, and the general primer sequence of the F end of the F primer in the primer pair 1F/R-20F/R is shown as SEQ ID No. 41; the sequence of the universal primer at the R end of the R primer in the primer pair 1F/R-20F/R is shown as SEQ ID No. 42;
example 3: the method for obtaining the primer mixture comprises the following steps:
After the specific primer is obtained, a specific tag sequence is designed, and then primer synthesis is performed again, wherein the specific tag sequence is added during the primer synthesis, and 96 groups of specific tag combinations are adopted in the embodiment, specifically:
According to the specific label combination condition, synthesizing 10 primers with different target labels from each specific primer, wherein the sequence form of the primers with the target labels is shown in table 2, and taking 10 μl of each primer to 10ml; the concentration of each primer is 0.1 mu M, and the primer pair containing 96 groups of specific tag combinations, namely primer mixed solution, is prepared in total in the embodiment;
TABLE 2 primer set
The FFF is an F-end universal primer sequence, and the F-end universal primer sequence is AACGACATGGCTACGATCCGACTT, as shown in SEQ ID No. 41;
the RRR is an R-end universal primer sequence, and the R-end universal primer sequence is CTAAGACCGCTTGGCCTCCGACTT, as shown in SEQ ID No. 42.
Wherein "YYY" is a tag sequence,
The label sequences in the synthesized 10 forward primers with labels in each primer pair are CCTTC, ACCGA, ATGTG, AATGC, TTCGG, AAGGT, CCCAT, ATGGA, ACGAT, CTCTG respectively, namely shown as SEQ ID No. 45-54 respectively;
Each primer pair has a label sequence ATCCG, TATCG, ACTCG, TAACC, CTTAC, TCCTA, ACACT, TACGT, TCACG, ACGCA in the synthesized 10 reverse primers with labels, namely shown as SEQ ID No. 55-64.
Each primer pair synthesizes 10 primer pairs with labels, and the label combination mode of the forward primer and the reverse primer is selected from any one or a plurality of the primer pairs in the table 2.
Example 4: pure seed identification
Step 1, selecting materials, namely selecting 2 parts of corns (96 seeds are selected for each part of corns respectively), extracting genome DNA of the corn seeds with the numbers of Z-01 and Z-05, and accurately quantifying the extracted DNA by using a corn seed genome DNA extraction kit produced by Shi family Boruidi biotechnology Co.
Step 2, taking corn seed genome DNA as a template, and carrying out one-round PCR amplification by using a primer mixed solution to obtain a target region;
The round of PCR amplification system: 8. Mu.l of the primer mixture obtained in example 3; the DNA dosage is 100ng;3*T enzyme 15. Mu.l; water was added to make up 45. Mu.l.
The round of PCR amplification procedure: 3min at 95 ℃; (95 ℃ C. 30s,60 ℃ C. 4min,72 ℃ C. 30 s) 28 cycles; and at 72℃for 4min.
And 3, mixing the obtained PCR amplification products in equal amounts, wherein the amplification products can be mixed only by using specific labels with different combinations, and the mixing can be directly carried out according to a system 1:1. After equal amount mixing, purifying the mixed product, namely screening fragments, wherein the specific steps are as follows;
Step 3.1, adding a round of magnetic beads with the volume of 0.4 times of that of the PCR, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and transferring the supernatant into a new tube;
step 3.2, adding a round of magnetic beads with the volume of 0.6 times of that of the PCR, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;
Step 3.3, adding a round of magnetic bead suspension with the volume of 0.9 times of the PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic rack until the solution is clear, and removing the supernatant;
Step 3.4, 100 μl of 80% ethanol is added, and the magnetic beads are repeatedly adsorbed on different sides by using a magnetic rack, so that the magnetic beads are sufficiently washed. Adsorbing with a magnetic rack for 2min, removing supernatant, and standing at room temperature until ethanol volatilizes completely;
The magnetic beads are as follows: nuance magnetic bead
Step 4, digesting the single-stranded DNA in the system obtained after screening;
In the magnetic bead-containing system obtained in step 3, the following operations were performed:
step 4.1, adding 20 mu l of water into the obtained product, and uniformly mixing the magnetic beads;
step 4.2, adsorbing magnetic beads, transferring 16 μl of supernatant to a new EP tube;
step 4.3, add 2. Mu.l Exo I, 10*Reaction Buffer 2. Mu.l to the above system.
Step 4.4, the digestion procedure of the system is as follows: 30min at 37 ℃; 15min at 85 ℃.
Step 5, purifying the digested product:
step 5.1, adding magnetic beads of which the number is 0.9, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clear, and removing the supernatant;
step 5.2, adding a magnetic bead heavy suspension with the same PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
And 5.3, adding 100 mu l of 80% ethanol, and repeatedly adsorbing the magnetic beads on different two sides by using a magnetic rack to sufficiently wash the magnetic beads. Adsorbing with a magnetic rack for 2min, removing supernatant, and standing at room temperature until ethanol volatilizes completely.
Step 6, configuring a two-round PCR system in the system obtained in the step 5:
Configuring a two-round PCR system in the system containing the magnetic beads obtained in the step 5, and carrying out two-round PCR amplification;
The two-round PCR system: 3*T enzyme 10. Mu.l; primer F; a Primer R; h 2 O18 μl
The two-round PCR procedure: 3min at 95 ℃; (95 ℃ 15s,58 ℃ 15s,72 ℃ 30 s) 12 cycles; and at 72℃for 4min.
The sequence of the Primer F is GAACGACATGGCTACGATCCGACTT as shown in SEQ ID No. 43; the sequence of the Primer R is TGTGAGCCAAGGAGTTGTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT as shown in SEQ ID No. 44;
because 2 corn varieties are adopted in the embodiment, in order to distinguish samples, the sequence of the Primer R comprises a unique Barcode sequence Barcode besides the sequence shown as SEQ ID No. 44;
The sequence of Primer R with bar code is: TGTGAGCCAAGGAGTTGxxxxxxxxxxTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT;
where "xxxxxxx" is the unique Barcode used to identify the sample to distinguish the sample.
In the embodiment, the Barcode sequences of 2 corn variety samples are CGGCTAAA, TCCCCGTG respectively; i.e. as shown in seq id No.65-66, respectively.
Step 7, purifying the two-round PCR amplified product by using 0.80 times of magnetic beads to finish the preparation of a sequencing library;
Step 7.1, adding magnetic beads of which the number is 0.8, blowing and mixing the magnetic beads up and down by using a pipettor, standing for 2min, adsorbing the magnetic beads by using a magnetic rack until the solution is clarified, and removing the supernatant;
step 7.2, adding a magnetic bead heavy suspension with the same PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
step 7.3, 100 μl of 80% ethanol is added, and the magnetic beads are repeatedly adsorbed on different sides by using a magnetic rack, so that the magnetic beads are sufficiently washed. Adsorbing with a magnetic rack for 2min, removing supernatant, and standing at room temperature until ethanol volatilizes completely.
Step 7.4 Add 23. Mu.l of the Elution Buffer, fully suspend the beads and leave it to stand at room temperature for 2min to elute the DNA. Adsorbing the magnetic beads by using a magnet, and sucking the obtained supernatant DNA solution into a new tube to obtain a sequencing library (the solution Buffer is 10mM Tris-HCl, and the pH is 8.0-8.5);
and 8, mixing the sequencing library with the same mass, and then performing on-machine sequencing to obtain sequencing data.
Step 9, identifying the genotype result of the target DNA, respectively selecting the seeds synthesized by detection from 96 seeds for subsequent purity judgment, and judging the purity of the seeds according to the locus genotype condition with high polymorphism, wherein the detection result of the embodiment is shown in Table 3.
TABLE 3 detection results
| Sample numbering | Number of selfed seeds | Seed purity | Conclusion(s) |
| Z-01 | 4 | 95.83％ | Same as the conventional identification result |
| Z-05 | 3 | 96.74％ | Same as the conventional identification result |
Seed purity program interpretation principle:
Firstly, judging whether each locus is hybridized/outcrossed or selfed, and judging the standard: the proportion of the genotype species of a batch of seeds at each locus is calculated. If the genotype of this locus is only one and homozygous, this locus is discarded, since it cannot be determined whether it is self-mating or hybrid. If the proportion of one heterozygous genotype exceeds 90%, judging as hybridization; the genotype of a sample at this site is homozygous and judged to be selfing; if other heterozygous genotypes are identified as outcrossing.
The samples were then submitted for selfing, outcrossing and hybridization. And finally, counting the whole condition of the batch of seeds.
Purity calculation, expressed as a percentage of seed purity:
The above described embodiments are only preferred examples of the invention and are not exhaustive of the possible implementations of the invention. Any obvious modifications thereof, which would be apparent to those skilled in the art without departing from the principles and spirit of the present invention, should be considered to be included within the scope of the appended claims.
SEQUENCE LISTING
<110> Shijia Boruidi Biotechnology Co., ltd
<120> A mixed sample detection method for detecting corn seed purity based on mSNP technology
<130> 1
<160> 66
<170> PatentIn version 3.3
<210> 1
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 1
agcagcaaag acctgcatac at 22
<210> 2
<211> 29
<212> DNA
<213> Artificial sequence (unknown)
<400> 2
ggtaatgttc tgaactaact caacactga 29
<210> 3
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 3
gggatggtgc ctgatggaat ta 22
<210> 4
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 4
cagctcgacc aagcaaatca ac 22
<210> 5
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 5
gtcgttgtag agctcgtcga aa 22
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 6
cccaatctat tccctaaccc tagt 24
<210> 7
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 7
gctgctgctt tttcatgagc tt 22
<210> 8
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 8
gagaagctca tgaaccacat tgc 23
<210> 9
<211> 20
<212> DNA
<213> Artificial sequence (unknown)
<400> 9
gctgttgcaa agctccttcc 20
<210> 10
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 10
ggagctcaac atggatctct tca 23
<210> 11
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 11
cggaacctaa acatggaagt cct 23
<210> 12
<211> 25
<212> DNA
<213> Artificial sequence (unknown)
<400> 12
catcggcata agtttgcata aagga 25
<210> 13
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 13
ccagcaagta aacgtgtcat cct 23
<210> 14
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 14
cccactgaca aaactgagca tga 23
<210> 15
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 15
tagtgcaatt tcagcctctt cgtt 24
<210> 16
<211> 20
<212> DNA
<213> Artificial sequence (unknown)
<400> 16
ctggccacct gcaagcaagt 20
<210> 17
<211> 25
<212> DNA
<213> Artificial sequence (unknown)
<400> 17
tgcattgact gattctagtg gtctg 25
<210> 18
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 18
ccctcaaaaa tggactgtca aca 23
<210> 19
<211> 26
<212> DNA
<213> Artificial sequence (unknown)
<400> 19
aactgcattg gttactcttc tctctg 26
<210> 20
<211> 27
<212> DNA
<213> Artificial sequence (unknown)
<400> 20
agctccattg ctacttacat aacatgg 27
<210> 21
<211> 28
<212> DNA
<213> Artificial sequence (unknown)
<400> 21
gaatttgcat aaccactcaa ctagcatt 28
<210> 22
<211> 30
<212> DNA
<213> Artificial sequence (unknown)
<400> 22
ctttctccat tgagtttatt gtgccttatc 30
<210> 23
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 23
gcttgtccac ttctccttgt agt 23
<210> 24
<211> 29
<212> DNA
<213> Artificial sequence (unknown)
<400> 24
agacaggctg tattgaaatc acagaataa 29
<210> 25
<211> 29
<212> DNA
<213> Artificial sequence (unknown)
<400> 25
ccaaaattaa gaaacaacat gcatgcaag 29
<210> 26
<211> 19
<212> DNA
<213> Artificial sequence (unknown)
<400> 26
ttgacagagg cacggtgtt 19
<210> 27
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 27
attttctagc gtgcagaaag catg 24
<210> 28
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 28
catgggtaca gcagctctag ag 22
<210> 29
<211> 30
<212> DNA
<213> Artificial sequence (unknown)
<400> 29
tttatgatga ttatgccaca ccaactatga 30
<210> 30
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 30
gggtcacttt cctccatcga at 22
<210> 31
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 31
tcgtgcatta aacctcgtct gt 22
<210> 32
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 32
ggtggtcgag ttgggaagaa ac 22
<210> 33
<211> 28
<212> DNA
<213> Artificial sequence (unknown)
<400> 33
ctcaagagaa gtgctatagg aaacatca 28
<210> 34
<211> 25
<212> DNA
<213> Artificial sequence (unknown)
<400> 34
ttaagggcat ggaatcttcc agatg 25
<210> 35
<211> 23
<212> DNA
<213> Artificial sequence (unknown)
<400> 35
gtgcaatcaa cagaaggcaa tca 23
<210> 36
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 36
ggtcactcat tgcctatcca tctt 24
<210> 37
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 37
gttccaatcg gattccaggg aa 22
<210> 38
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 38
ctgctgtgga aattcgggaa attc 24
<210> 39
<211> 28
<212> DNA
<213> Artificial sequence (unknown)
<400> 39
ttcaaagagc ccaaaaggct aaggagaa 28
<210> 40
<211> 22
<212> DNA
<213> Artificial sequence (unknown)
<400> 40
actcttcact gccaccaaga ag 22
<210> 41
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 41
aacgacatgg ctacgatccg actt 24
<210> 42
<211> 24
<212> DNA
<213> Artificial sequence (unknown)
<400> 42
ctaagaccgc ttggcctccg actt 24
<210> 43
<211> 25
<212> DNA
<213> Artificial sequence (unknown)
<400> 43
gaacgacatg gctacgatcc gactt 25
<210> 44
<211> 49
<212> DNA
<213> Artificial sequence (unknown)
<400> 44
tgtgagccaa ggagttgttg tcttcctaag accgcttggc ctccgactt 49
<210> 45
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 45
ccttc 5
<210> 46
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 46
accga 5
<210> 47
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 47
atgtg 5
<210> 48
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 48
aatgc 5
<210> 49
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 49
ttcgg 5
<210> 50
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 50
aaggt 5
<210> 51
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 51
cccat 5
<210> 52
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 52
atgga 5
<210> 53
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 53
acgat 5
<210> 54
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 54
ctctg 5
<210> 55
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 55
atccg 5
<210> 56
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 56
tatcg 5
<210> 57
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 57
actcg 5
<210> 58
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 58
taacc 5
<210> 59
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 59
cttac 5
<210> 60
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 60
tccta 5
<210> 61
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 61
acact 5
<210> 62
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 62
tacgt 5
<210> 63
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 63
tcacg 5
<210> 64
<211> 5
<212> DNA
<213> Artificial sequence (unknown)
<400> 64
acgca 5
<210> 65
<211> 8
<212> DNA
<213> Artificial sequence (unknown)
<400> 65
cggctaaa 8
<210> 66
<211> 8
<212> DNA
<213> Artificial sequence (unknown)
<400> 66
tccccgtg 8
Claims (10)
1. The primer group for corn seed purity detection based on mSNP technology is characterized by comprising a primer pair 1F/R, a primer pair 2F/R, a primer pair 3F/R, a primer pair 4F/R, a primer pair 5F/R, a primer pair 6F/R, a primer pair 7F/R, a primer pair 8F/R, a primer pair 9F/R, a primer pair 10F/R, a primer pair 11F/R, a primer pair 12F/R, a primer pair 13F/R, a primer pair 14F/R, a primer pair 15F/R, a primer pair 16F/R, a primer pair 17F/R, a primer pair 18F/R, a primer pair 19F/R and a primer pair 20F/R; wherein each primer pair consists of a forward primer and a reaction primer;
In the primer pair 1F/R, the sequence of the F primer is shown as SEQ ID No.1, and the sequence of the R primer is shown as SEQ ID No. 2;
in the primer pair 2F/R, the sequence of the F primer is shown as SEQ ID No.3, and the sequence of the R primer is shown as SEQ ID No. 4;
in the primer pair 3F/R, the sequence of the F primer is shown as SEQ ID No.5, and the sequence of the R primer is shown as SEQ ID No. 6;
In the primer pair 4F/R, the sequence of the F primer is shown as SEQ ID No.7, and the sequence of the R primer is shown as SEQ ID No. 8;
In the primer pair 5F/R, the sequence of the F primer is shown as SEQ ID No.9, and the sequence of the R primer is shown as SEQ ID No. 10;
in the primer pair 6F/R, the sequence of the F primer is shown as SEQ ID No.11, and the sequence of the R primer is shown as SEQ ID No. 12;
in the primer pair 7F/R, the sequence of the F primer is shown as SEQ ID No.13, and the sequence of the R primer is shown as SEQ ID No. 14;
in the primer pair 8F/R, the sequence of the F primer is shown as SEQ ID No.15, and the sequence of the R primer is shown as SEQ ID No. 16;
In the primer pair 9F/R, the sequence of the F primer is shown as SEQ ID No.17, and the sequence of the R primer is shown as SEQ ID No. 18;
in the primer pair 10F/R, the sequence of the F primer is shown as SEQ ID No.19, and the sequence of the R primer is shown as SEQ ID No. 20;
in the primer pair 11F/R, the sequence of the F primer is shown as SEQ ID No.21, and the sequence of the R primer is shown as SEQ ID No. 22;
In the primer pair 12F/R, the sequence of the F primer is shown as SEQ ID No.23, and the sequence of the R primer is shown as SEQ ID No. 24;
in the primer pair 13F/R, the sequence of the F primer is shown as SEQ ID No.25, and the sequence of the R primer is shown as SEQ ID No. 26;
in the primer pair 14F/R, the sequence of the F primer is shown as SEQ ID No.27, and the sequence of the R primer is shown as SEQ ID No. 28;
in the primer pair 15F/R, the sequence of the F primer is shown as SEQ ID No.29, and the sequence of the R primer is shown as SEQ ID No. 30;
in the primer pair 16F/R, the sequence of the F primer is shown as SEQ ID No.31, and the sequence of the R primer is shown as SEQ ID No. 32;
in the primer pair 17F/R, the sequence of the F primer is shown as SEQ ID No.33, and the sequence of the R primer is shown as SEQ ID No. 34;
in the primer pair 18F/R, the sequence of the F primer is shown as SEQ ID No.35, and the sequence of the R primer is shown as SEQ ID No. 36;
In the primer pair 19F/R, the sequence of the F primer is shown as SEQ ID No.37, and the sequence of the R primer is shown as SEQ ID No. 38;
In the primer pair 20F/R, the sequence of the F primer is shown as SEQ ID No.39, and the sequence of the R primer is shown as SEQ ID No. 40.
2. A mixed sample detection method for detecting the purity of corn seeds by using the primer group according to claim 1, which comprises the following steps:
Step 1, selecting materials: selecting 1 or more corn varieties; at least 96 seeds are used for each corn sample;
Step 2, accurately quantifying corn genome DNA;
Step 3, synthesizing primers in the primer groups in claim 1, wherein 10 primers with different target labels are synthesized when the forward primer and the reverse primer in each primer pair are synthesized; then mixing primers according to the appointed label combination to prepare primer mixed solution;
step 4, taking corn genome DNA as a template, and respectively carrying out one-round PCR amplification on the corn genome DNA by using the primer mixed solution to obtain a target region;
Step 5, mixing the obtained PCR amplification products in equal amounts;
Step 6, screening fragments of the mixed products;
step 7, digesting the single-stranded DNA in the system obtained after screening;
step 8, purifying the digested product;
Step 9, configuring a two-round PCR system in the system obtained in the step 8;
step 10, purifying the two rounds of PCR products to finish the preparation of a sequencing library;
Step 11, mixing the sequencing library with the same mass, and then sequencing by a machine to obtain sequencing data;
Step 12, disconnecting the obtained test data again according to the label combination;
and 13, identifying the genotype result of the target site of the test sample, and judging the purity of the seeds according to the genotype condition of the site.
3. The method for detecting corn seed purity according to claim 2, wherein,
In the step 3, the F primer in the primer pair 1F/R-20F/R also comprises an F end universal primer, and the sequence of the F end universal primer is shown as SEQ ID No. 41; the R primer in the primer pair 1F/R-20F/R also comprises an R-end universal primer, and the sequence of the R-end universal primer is shown as SEQ ID No. 42;
In the step 9, the sequence of Frimer F used in the two rounds of PCR is shown as SEQ ID No. 43; the sequence of Primer R used in the two rounds of PCR is shown as SEQ ID No. 44.
4. A mixed sample detection method for detecting the purity of corn seeds according to claim 3, wherein,
When the maize variety is plural, the sequence of Primer R also includes a barcode sequence for distinguishing maize varieties.
5. The method according to claim 2, wherein in step 2, the tag sequence of the forward primer is different from the tag sequence of the reverse primer in the tag combination of each primer pair.
6. The method for detecting corn seed purity according to claim 2, wherein,
In step 1, the genomic DNA of the corn seed is extracted using a corn seed genomic DNA extraction kit.
7. The method for detecting corn seed purity according to claim 2, wherein,
In step 4, the round of PCR amplification procedure: 3min at 95 ℃;95 ℃ for 30s,60 ℃ for 4min,72 ℃ for 30s,28 cycles; and at 72℃for 4min.
8. The method for detecting corn seed purity according to claim 2, wherein,
In step 6, the mixed product is subjected to fragment screening, and the specific operation is as follows:
step 6.1, adding a round of magnetic beads with the volume of 0.4 times of that of the PCR, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and transferring the supernatant into a new tube;
Step 6.2, adding a round of magnetic beads with the volume of 0.6 times of that of the PCR, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;
step 6.3, adding a round of magnetic bead suspension with the volume of 0.9 times of that of the PCR, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
Step 6.4, adding 100 mu l of 80% ethanol, repeatedly adsorbing magnetic beads on different two sides by using a magnetic rack, fully washing the magnetic beads, adsorbing for 2min by using the magnetic rack, removing the supernatant, and standing at room temperature until the ethanol volatilizes cleanly;
In the step 7, single-stranded DNA in the system obtained after screening is digested, and the specific operation steps are as follows:
Step 7.1, adding 20 mu l of water into the obtained product, and uniformly mixing the magnetic beads;
Step 7.2, adsorbing magnetic beads, transferring 16 μl of supernatant to a new EP tube;
Step 7.3, adding 2 μl of Exo I and 2 μl of 10×reaction Buffer into the system;
and 7.4, the digestion procedure of the digestion system is as follows: 30min at 37 ℃; 15min at 85 ℃;
In step 8, the specific operation steps of purifying the digested product are as follows:
8.1, adding magnetic beads of which the number is 0.9, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clear, and removing the supernatant;
8.2, adding a magnetic bead heavy suspension with the same PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
And 8.3, adding 100 mu l of 80% ethanol, repeatedly adsorbing magnetic beads on different sides by using a magnetic rack, fully washing the magnetic beads, adsorbing for 2min by using the magnetic rack, removing the supernatant, and standing at room temperature until the ethanol volatilizes cleanly.
9. The method for detecting corn seed purity according to claim 2, wherein,
In step 9, the two-round PCR procedure: 3min at 95 ℃; 15s at 95 ℃, 15s at 58 ℃, 30s at 72 ℃ and 12 cycles; and at 72℃for 4min.
10. The method for detecting corn seed purity according to claim 2, wherein,
In step 10, the two rounds of PCR products were purified using 0.80-fold beads, as follows:
step 10.1, adding magnetic beads of which the number is 0.8, blowing and mixing uniformly up and down by using a pipettor, standing for 2min, adsorbing by using a magnetic frame until the solution is clear, and removing the supernatant;
Step 10.2, adding a magnetic bead heavy suspension with the same PCR volume, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clear, and removing the supernatant;
step 10.3, adding 100 μl of 80% ethanol, repeatedly adsorbing magnetic beads on different sides by using a magnetic rack, sufficiently washing the magnetic beads, adsorbing for 2min by using the magnetic rack, removing the supernatant, and standing at room temperature until the ethanol volatilizes completely;
Step 10.4, adding 23 μl of an adsorption Buffer, fully suspending magnetic beads, standing at room temperature for 2 min to elute DNA, adsorbing the magnetic beads with a magnet, and sucking the obtained supernatant DNA solution into a new tube to obtain a sequencing library; the said solution Buffer is 10 mM Tris-HCl, pH 8.0-8.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111154587.8A CN113832250B (en) | 2021-09-29 | 2021-09-29 | Mixed sample detection method for detecting corn seed purity based on mSNP technology |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111154587.8A CN113832250B (en) | 2021-09-29 | 2021-09-29 | Mixed sample detection method for detecting corn seed purity based on mSNP technology |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113832250A CN113832250A (en) | 2021-12-24 |
| CN113832250B true CN113832250B (en) | 2024-06-07 |
Family
ID=78967664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111154587.8A Active CN113832250B (en) | 2021-09-29 | 2021-09-29 | Mixed sample detection method for detecting corn seed purity based on mSNP technology |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113832250B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102505044A (en) * | 2011-11-10 | 2012-06-20 | 南京农业大学 | Method for quickly identifying genetic purity of glutinous corn hybrid |
| CN107937596A (en) * | 2017-12-26 | 2018-04-20 | 石家庄博瑞迪生物技术有限公司 | The true and false hybrid identification primer sets of peanut and its identification method based on single nucleotide polymorphism |
| CN110872633A (en) * | 2019-11-27 | 2020-03-10 | 北京市农林科学院 | Method for identifying purity of Jingke 968 corn hybrid based on SNP marker |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925561B (en) * | 2005-06-23 | 2015-09-09 | 科因股份有限公司 | For the high throughput identification of polymorphism and the strategy of detection |
-
2021
- 2021-09-29 CN CN202111154587.8A patent/CN113832250B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102505044A (en) * | 2011-11-10 | 2012-06-20 | 南京农业大学 | Method for quickly identifying genetic purity of glutinous corn hybrid |
| CN107937596A (en) * | 2017-12-26 | 2018-04-20 | 石家庄博瑞迪生物技术有限公司 | The true and false hybrid identification primer sets of peanut and its identification method based on single nucleotide polymorphism |
| CN110872633A (en) * | 2019-11-27 | 2020-03-10 | 北京市农林科学院 | Method for identifying purity of Jingke 968 corn hybrid based on SNP marker |
Non-Patent Citations (2)
| Title |
|---|
| Development of high-resolution multiple-SNP arrays for genetic analyses and molecular breeding through genotyping by target sequencing and liquid chip;Zifeng Guo等;Plant Communications;第2卷(第6期);摘要 * |
| DNA分子标记技术在玉米纯度鉴定中的应用综述;车卓;;农业科技与信息(02);第53-55页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113832250A (en) | 2021-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106282394B (en) | Method for high-throughput detection of southern rust resistance genotyping of corn and kit thereof | |
| CN105256035B (en) | Molecular labeling for differentiating Jinhua both ends crow and duroc genetic background and its application | |
| CN109628628B (en) | Development and application of SNP (single nucleotide polymorphism) marker of rice blast resistance gene Pi2 | |
| CN107354202B (en) | Primer combination and kit for identifying flue-cured tobacco K326, application and identification method | |
| CN108611428A (en) | Genetic marker and application of the TGFB3 gene pleiomorphisms as pig body length and number of nipples | |
| CN110541041B (en) | SNP marker related to Chinese domestic horse dwarf trait and application thereof | |
| Xie et al. | A High‐throughput Genomic Tool: Diversity Array Technology Complementary for Rice Genotyping | |
| CN112251535A (en) | KASP marker for rapidly identifying fertility of onion nuclei in large groups and application thereof | |
| CN113832250B (en) | Mixed sample detection method for detecting corn seed purity based on mSNP technology | |
| CN113755630A (en) | Mixed sample detection method for detecting carrot seed purity based on mSNP technology | |
| CN113755628A (en) | Mixed sample detection method for detecting purity of white radish seeds based on mSNP technology | |
| CN113832251B (en) | SNP locus combination for detecting tomato mosaic virus resistance and application thereof | |
| CN115852033A (en) | Molecular markers of GS3 gene and GW5 gene for improving rice quality | |
| CN116144816A (en) | KASP molecular marker for identifying orange peel color in seedling stage and application thereof | |
| CN112195263B (en) | SNP (Single nucleotide polymorphism) locus and primer set for identifying purity of watermelon hybrid and application | |
| CN113755631B (en) | Mixed sample detection method for detecting purity of pumpkin seeds based on mSNP technology | |
| CN107345251B (en) | Primer combination and kit for identifying flue-cured tobacco Longjiang 911, application and identification method | |
| CN107858448B (en) | Single nucleotide polymorphism marker site, primer pair, kit and application for identifying peach pollen fertility character | |
| CN112322617A (en) | KASP molecular marker capable of identifying waxy property of barley grains and application thereof | |
| CN112410459A (en) | KASP molecular marker for detecting rice blast resistance gene Pi25 and application thereof | |
| CN107354203B (en) | Primer combination and kit for identifying cured tobacco Bina No. 1, application and detection method | |
| CN107354205B (en) | Primer combination and kit for identifying tobacco 100 in flue-cured tobacco, application and detection method | |
| CN113652502A (en) | Mixed sample detection method for detecting pepper seed purity based on mSNP technology | |
| CN113943827A (en) | Mixed sample detection method for detecting melon seed purity based on mSNP technology | |
| CN113652501A (en) | Mixed sample detection method for detecting purity of Chinese cabbage seeds based on mSNP technology |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant |