CN113943827A - Mixed sample detection method for detecting melon seed purity based on mSNP technology - Google Patents

Abstract

The invention relates to a mixed sample detection method for detecting melon seed purity based on mSNP technology, which is carried out by using a primer pair 1F/R-21F/R, wherein the gene sequence of the primer pair 1F/R-21F/R is shown in SEQ ID No. 1-42; the invention adopts the mSNP technology, and can detect more SNP variations under the condition of unchanging an amplicon; the mixed sample method is adopted for detection, the amplification workload is reduced, the sequencing cost is reduced, the detection speed is accelerated, and the detection of 1440 seeds can be completed at most in one day. The method directly reads the polymorphism of the mononucleotide by using a sequencing technology, directly judges the purity result by a program, has visual and reliable result, and avoids the influence of subjective factors during the seed development period and the result judgment.

Description

Mixed sample detection method for detecting melon seed purity based on mSNP technology

Technical Field

The invention belongs to the field of seed purity detection, and particularly relates to a mixed sample detection method for detecting melon seed purity based on a mSNP technology.

Background

Melons are annual herbaceous plants of the cucumis genus of the cucurbitaceae family and are widely grown around the world. China is the first major country for melon production and consumption, and accounts for more than 50% of the total world production. Because of heterosis, most of melon production uses hybrid seeds, and because new varieties enter the market successively, the hybrid seeds are very easy to interfere with self-cross and cross-cross in the seed production process, so that the seed purity is reduced, the seed quality standard can not be reached, and the method has great significance and application value in identifying the seed purity.

Two important indicators of seed quality: seed authenticity and seed purity. The seed purity is the percentage of the number of seeds of the variety in the number of seeds of the crop sample to be tested. Seeds widely used in the market at present are hybrid seeds, and the purity of field seeds of the muskmelon hybrid seeds is not less than 95 percent according to the regulation of the crop seed quality standard (GB16715.1-2010) established by the state, so that the purity identification of the muskmelon seeds before the seeds are on the market is the requirement of quality control.

In practical application, the ideal determination method needs to have the characteristics of simple method, rapidness, low cost, repeatable detection result and the like. The development stage of the purity identification of the melon hybrid is divided into 3 stages. Firstly, the traditional method is field identification, the identification period of the method is long, and the identification is carried out in protected facilities in the north, so that the period is long, the cost is high, and the melon seeds are not ready for field purity identification due to climate and other problems before being sold in a busy season. Second, biochemical detection. The purity of the hybrid is identified by isoenzyme and protein electrophoresis technology, so that the female parent self-bred species and hybrid species can be identified; because the available isozyme has limited sites and protein types, the hybrid species with close relativity is difficult to distinguish, and the identification of the hybrid purity is greatly limited. Third, molecular labeling techniques. The molecular marker technology has the characteristics of stable heredity, rich polymorphism and low possibility of being influenced by the environment, and provides a new method for identifying the purity of the muskmelon seeds. The method is divided into the following steps according to the principle: RFLP based on molecular hybridization; RAPD and SSR based on PCR reaction; AFLP by PCR combined with enzymatic cleavage. Each molecular marker has the characteristics, RFLP is used for purity identification earlier, but the technology has the disadvantages of high operation difficulty, high purity of required DNA, expensive equipment, radioactive substance and the like, and is not suitable for practical application; RAPD marker repeatability is poor; the SSR primer has the defects of high development difficulty, complex technical system, high cost and long period and is limited to be widely applied.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides a mixed sample detection method for detecting the purity of melon seeds based on the mSNP technology, which is efficient, accurate and low in cost.

In order to achieve the purpose, the technical scheme adopted by the invention is as follows:

the first technical scheme is as follows:

a primer group for detecting melon seed purity based on mSNP technology is characterized by comprising a primer pair 1F/R, a primer pair 2F/R, a primer pair 3F/R, a primer pair 4F/R, a primer pair 5F/R, a primer pair 6F/R, a primer pair 7F/R, a primer pair 8F/R, a primer pair 9F/R, a primer pair 10F/R, a primer pair 11F/R, a primer pair 12F/R, a primer pair 13F/R, a primer pair 14F/R, a primer pair 15F/R, a primer pair 16F/R, a primer pair 17F/R, a primer pair 18F/R, a primer pair 19F/R, a primer pair 20F/R and a primer pair 21F/R; wherein each primer pair consists of a forward primer and a reaction primer;

in the primer pair 1F/R, the sequence of the F primer is shown as SEQ ID No.1, and the sequence of the R primer is shown as SEQ ID No. 2;

in the primer pair 2F/R, the sequence of the F primer is shown as SEQ ID No.3, and the sequence of the R primer is shown as SEQ ID No. 4;

in the primer pair 3F/R, the sequence of the F primer is shown as SEQ ID No.5, and the sequence of the R primer is shown as SEQ ID No. 6;

in the primer pair 4F/R, the sequence of the F primer is shown as SEQ ID No.7, and the sequence of the R primer is shown as SEQ ID No. 8;

in the primer pair 5F/R, the sequence of the F primer is shown as SEQ ID No.9, and the sequence of the R primer is shown as SEQ ID No. 10;

in the primer pair 6F/R, the sequence of the F primer is shown as SEQ ID No.11, and the sequence of the R primer is shown as SEQ ID No. 12;

in the primer pair 7F/R, the sequence of the F primer is shown as SEQ ID No.13, and the sequence of the R primer is shown as SEQ ID No. 14;

in the primer pair 8F/R, the sequence of the F primer is shown as SEQ ID No.15, and the sequence of the R primer is shown as SEQ ID No. 16;

in the primer pair 9F/R, the sequence of the F primer is shown as SEQ ID No.17, and the sequence of the R primer is shown as SEQ ID No. 18;

in the primer pair 10F/R, the sequence of the F primer is shown as SEQ ID No.19, and the sequence of the R primer is shown as SEQ ID No. 20;

in the primer pair 11F/R, the sequence of the F primer is shown as SEQ ID No.21, and the sequence of the R primer is shown as SEQ ID No. 22;

in the primer pair 12F/R, the sequence of the F primer is shown as SEQ ID No.23, and the sequence of the R primer is shown as SEQ ID No. 24;

in the primer pair 13F/R, the sequence of the F primer is shown as SEQ ID No.25, and the sequence of the R primer is shown as SEQ ID No. 26;

in the primer pair 14F/R, the sequence of the F primer is shown as SEQ ID No.27, and the sequence of the R primer is shown as SEQ ID No. 28;

in the primer pair 15F/R, the sequence of the F primer is shown as SEQ ID No.29, and the sequence of the R primer is shown as SEQ ID No. 30;

in the primer pair 16F/R, the sequence of the F primer is shown as SEQ ID No.31, and the sequence of the R primer is shown as SEQ ID No. 32;

in the primer pair 17F/R, the sequence of the F primer is shown as SEQ ID No.33, and the sequence of the R primer is shown as SEQ ID No. 34;

in the primer pair 18F/R, the sequence of the F primer is shown as SEQ ID No.35, and the sequence of the R primer is shown as SEQ ID No. 36;

in the primer pair 19F/R, the sequence of the F primer is shown as SEQ ID No.37, and the sequence of the R primer is shown as SEQ ID No. 38;

in the primer pair 20F/R, the sequence of the F primer is shown as SEQ ID No.39, and the sequence of the R primer is shown as SEQ ID No. 40;

in the primer pair 21F/R, the sequence of the F primer is shown as SEQ ID No.41, and the sequence of the R primer is shown as SEQ ID No. 42.

Further, the primer pair 1F/R-22F/R is obtained by mSNP technology.

The second technical scheme is as follows:

a mixed sample detection method for detecting the purity of melon seeds according to the primer group comprises the following steps:

step 1, selecting materials: selecting 1 or more melon varieties; at least 96 seeds are adopted for each part of melon sample;

step 2, accurately quantifying the genomic DNA of the muskmelon;

step 3, synthesizing primers in the primer group, wherein when synthesizing a forward primer and a reverse primer in each primer pair, 10 primers with different target labels are synthesized; then mixing the primers according to the specified label combination to prepare a primer mixed solution;

step 4, taking the genomic DNA of the melons as a template, and performing one round of PCR amplification on the genomic DNA of the melons by using the primer mixed solution to obtain a target region;

step 5, mixing the obtained PCR amplification products in equal amount;

step 6, screening fragments of the mixed product;

step 7, digesting the single-stranded DNA in the screened system;

step 8, purifying the digested product;

step 9, configuring a two-round PCR system in the system obtained in the step 8;

step 10, purifying the products of the two rounds of PCR to complete the preparation of a sequencing library;

step 11, mixing the sequencing library with the same quality, and then performing on-machine sequencing to obtain sequencing data;

step 12, splitting the sample according to the label combination again for the obtained test data;

and step 13, identifying the genotype result of the target locus of the test sample, and judging the purity of the seed according to the genotype condition of the locus.

Further, when synthesizing a forward primer and a reverse primer in a primer pair, synthesizing 10 primers with different target labels;

in the tag combination of each primer pair, the tag sequence of the forward primer is different from the tag sequence of the reverse primer.

Further, in step 3, in each primer pair, tag sequences of the synthesized 10 tagged forward primers are respectively shown as SEQ ID Nos. 47-56;

in each primer pair, the tag sequences of the synthesized 10 reverse primers with tags are respectively shown as SEQ ID Nos. 57-66.

Further, 10 pairs of labeled primers were synthesized from each pair of primers, and the label combination of the forward primer and the reverse primer was selected from any one or more of the primers shown in Table 1.

Table 1: label combination mode

Further, in the step 3, the F primers in the primer pairs 1F/R-21F/R also comprise an F-terminal universal primer, and the sequence of the F-terminal universal primer is shown as SEQ ID No. 43; the R primers in the primer pairs 1F/R-21F/R also comprise an R-terminal universal primer, and the sequence of the R-terminal universal primer is shown as SEQ ID No. 44;

the sequence of the Frimer F used in the two-round PCR in the step 9 is shown as SEQ ID No.45,

the sequence of the Primer R used is shown as SEQ ID No. 46.

Further, when the melon variety is plural, the sequence of the Primer R further includes a barcode sequence for discriminating the melon variety.

Further, in step 2, in the tag combination of each primer pair, the tag sequence of the forward primer is different from the tag sequence of the reverse primer.

Further, in step 1, the genomic DNA of the melon seeds was extracted using the melon seed genomic DNA extraction kit.

Further, in step 4, the round of PCR amplification system: 8 mul of primer mixed solution; the dosage of DNA is 100 ng; 3. mu.l of Ttase; adding water to complement 45 mu l;

the one-round PCR amplification procedure: 3min at 95 ℃; (95 ℃ for 30s, 60 ℃ for 4min, 72 ℃ for 30s)28 cycles; 4min at 72 ℃.

Further, in step 6, the mixed product is subjected to fragment screening, specifically the following operations:

step 6.1, adding magnetic beads with the volume 0.4 times that of one round of PCR, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing the mixture by using a magnetic frame until the solution is clarified, and transferring the supernatant into a new tube;

step 6.2, adding magnetic beads with the volume 0.6 times that of one round of PCR, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 6.3, adding a magnetic bead suspension with the volume 0.9 time that of one round of PCR, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing the supernatant;

and 6.4, adding 100 mu l of ethanol with the volume concentration of 80%, repeatedly adsorbing the magnetic beads on different two surfaces by using a magnetic frame to fully wash the magnetic beads, adsorbing for 2min by using the magnetic frame, removing the supernatant, and standing at room temperature until the ethanol is completely volatilized.

In step 7, digesting the single-stranded DNA in the system obtained after screening, the specific operation steps are as follows:

step 7.1, adding 20 mul of water into the obtained product, and uniformly mixing the magnetic beads;

step 7.2, adsorbing magnetic beads, and transferring 16 mu l of supernatant into a new EP tube;

step 7.3, adding 2 ul of Exo I and 2 ul of 10 × Reaction Buffer into the system;

and 7.4, the digestion program of the digestion system is as follows: 30min at 37 ℃; 15min at 85 ℃;

in step 8, the specific operation steps for purifying the digested product are as follows:

step 8.1, adding 0.9 time of magnetic beads, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

8.2, adding magnetic bead resuspension liquid with equal PCR volume, resuspending magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing supernatant;

and 8.3, adding 100 mu l of ethanol with the volume concentration of 80%, repeatedly adsorbing the magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads, adsorbing for 2min by using the magnetic frame, removing the supernatant, and standing at room temperature until the ethanol is completely volatilized.

Further, in step 9, the two-round PCR system: 10 μ l of the enzyme tretase; primer F; primer R; H2O 18 μ l;

the two-round PCR procedure: 3min at 95 ℃; (95 ℃ 15s, 58 ℃ 15s, 72 ℃ 30s) for 12 cycles; 4min at 72 ℃;

further, in step 10, the two rounds of PCR products are purified using 0.80 times of magnetic beads, specifically as follows:

step 10.1, adding 0.8 time of magnetic beads, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 10.2, adding magnetic bead resuspension liquid with equal PCR volume, resuspending magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing supernatant;

step 10.3, adding 100 mul of 80% ethanol, repeatedly adsorbing magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads, adsorbing for 2min by using the magnetic frame, removing supernatant, and standing at room temperature until the ethanol is completely volatilized;

step 10.4, adding 23 μ l of Elution Buffer, fully suspending the magnetic beads, standing for 2min at room temperature to elute DNA, adsorbing the magnetic beads by a magnet, and adsorbing the obtained supernatant DNA solution into a new tube to obtain a sequencing library; the Elution Buffer is 10mM Tris-HCl and has the pH value of 8.0-8.5.

Compared with the prior art, the invention has the following beneficial effects:

mSNP technique: the invention adopts mSNP technology, a plurality of SNPs are corresponded in one amplicon, the information obtained by each amplicon fragment is utilized to the maximum extent, and the SNP variation as much as possible can be detected under the condition that the amplicon is not changed. And haplotypes can be formed among the SNPs, so that the detection efficiency of variation is improved. Therefore, variation in and among the mSNP loci can be adopted, and two modes of haplotypes and SNP can be adopted for detection, so that the detection of genetic variation is more precise, and the accuracy and sensitivity of marker identification are improved. In the method, 21 pairs of primer pairs are adopted, more than 100 actually detected variation information exists, and more polymorphism sites meeting the requirements can be screened for purity identification and analysis. Compared with the conventional SNP detection, the method reduces the use of the primer pairs and reduces the cost.

The cost is low: by adopting the mSNP technology, more SNP variations can be detected under the condition that an amplicon is not changed; by adopting the scheme of at least 96 test sample products mixed sample detection after one round of amplification, the workload of two rounds of amplification is reduced, and the sequencing cost is reduced.

High efficiency: by adopting a mixed sample detection scheme, after one round of amplification, at least 96 detection samples are mixed and subjected to subsequent amplification and sequencing, and the detection of 1440 seeds can be completed within one day at most. Compared with other detection methods, the method is simple to operate, does not need field planting, experimental operation with large workload and detection difficulty and the like, and can quickly detect the purity of the seeds.

And (3) accuracy: the method directly reads the polymorphism of the mononucleotide by using a sequencing technology, directly judges the purity result by a program, has visual and reliable result, and avoids the influence of subjective factors during the seed development period and the result judgment.

Drawings

FIG. 1 is a flow chart of the mixed sample detection method of the present invention.

Detailed Description

Example 1: method for obtaining specific primer

The method for obtaining the specific primer specifically comprises the following steps:

single nucleotide variation identification was performed using GATK (https:// software. branched. organisation. org/GATK /) using whole genome re-sequencing data of melon, retro-mapped to the melon reference genome using BWA-mem (http:// bio-bw. sourceform. net /).

The identified single nucleotide variation site set is characterized in that the minimum allelic variation frequency is screened to be more than 0.02, the heterozygosity rate is less than 15%, the deletion rate is less than 20%, the single nucleotide variation sites are combined, the number of the single nucleotide sites is screened to be located in a section of 2-15, namely, mSNP (poly single nucleotide polymorphism) sites, compared with the traditional SNP (single nucleotide polymorphism) sites, the mSNP sites can utilize the information obtained by each primer pair to the maximum extent, namely, the SNP sites are detected as many as possible under the condition that the primer pairs are not changed, and all SNPs in the same primer pair can be combined into a type, so that the polymorphism is higher. For example, there are two A/T variations in a SNP, which can be distinguished by 3 polymorphisms AA, AT, TT, if the mSNP site is detected, there can be 8 (AGC, AGA, ATA, ATC, TGC, TGA, TTA, TTC) polymorphisms if there are 3 SNPs in a primer pair (A/T, G/T, C/A). This allows for more precise detection of genetic variation while improving the accuracy and sensitivity of marker identification. The total number of segments screened by the method is 41.

And (3) designing primers for the 41 target segments, and screening the specificity of the primers to obtain 21 pairs of chromosome specific primers, wherein 144 single nucleotide variation sites are obtained in total. From the comprehensive consideration of detection cost and practical perspective, and according to the principle of 5-10% diversity among melon samples, 21 pairs of primers are finally selected to be mixed for detecting the purity of melon seeds, and about 140 SNP sites can be detected in total.

In the invention, 21 groups of specific primer pairs are obtained in total, namely the primer pairs 1F/R-21F/R, and the gene sequences of the primer pairs 1F/R-21F/R are shown as SEQ ID Nos. 1-42.

Example 2: primer group for detecting purity of muskmelon seeds

The primer group for detecting the purity of the muskmelon seeds comprises a primer pair 1F/R-21F/R, wherein the primer pair 1F/R-21F/R not only comprises specific primer sequences shown as SEQIDNo.1-42, but also comprises a universal primer sequence, and the F-end universal primer sequence of an F primer in the primer pair 1F/R-21F/R is shown as SEQIDNo.43; the sequence of the R-end universal primer of the R primer in the primer pair 1F/R-21F/R is shown as SEQ ID No. 44;

example 3: the method for obtaining the primer mixed solution comprises the following steps:

after obtaining the specific primer, designing a specific tag sequence, and then performing primer synthesis again, where the specific tag sequence is added during primer synthesis, in this embodiment, 96 specific tag combinations are adopted, specifically:

synthesizing 10 primers with different target labels from each specific primer according to the combination condition of the specific labels, wherein the sequence form of the primers with the target labels is shown in table 2, taking 10 mu l of each primer from all F (forward primers) and all R (reverse primers) with the target labels, and metering to 10 ml; the concentration of each primer is 0.1 mu M, and primer pairs containing 96 groups of specific label combinations, namely primer mixed liquor, are prepared in the embodiment;

TABLE 2 primer sets

"FFF" is an F-terminal universal primer sequence, wherein the F-terminal universal primer sequence is AACGACATGGCTACGATCCGACTT, and is shown as SEQ ID No. 43;

the RRR is an R-terminal universal primer sequence which is CTAAGACCGCTTGGCCTCCGACTT and is shown as SEQ ID No. 44.

Wherein "YYY" is a tag sequence,

in each primer pair, the tag sequences of the synthesized 10 forward primers with tags are respectively CCTTC, ACCGA, ATGTG, AATGC, TTCGG, AAGGT, CCCAT, ATGGA, ACGAT and CTCTG, namely respectively shown as SEQIDNo.47-56;

in each primer pair, tag sequences of 10 synthesized reverse primers with tags are respectively ATCCG, TATCG, ACTCG, TAACC, CTTAC, TCCTA, ACACT, TACGT, TCACG and ACGCA, namely respectively shown as SEQIDNo.57-66.

In each pair of primer pairs, 10 labeled primer pairs are synthesized, and the label combination mode of the forward primer and the reverse primer is selected from any one or more of the following table 2.

Example 4: identification of pure species

Step 1, selecting materials, namely numbering 2 parts of melons (96 seeds and 152 seeds are respectively selected from the 2 parts of melons) as the crisp pears 27 and the crisp pears 50, extracting genome DNA of the melon seeds, and accurately quantifying the extracted DNA by adopting a melon seed genome DNA extraction kit produced by Shijiazhuang Boruidi biotechnology limited.

Step 2, taking the genomic DNA of the melon seeds as a template, and carrying out one-round PCR amplification by using a primer mixed solution to obtain a target region;

the one-round PCR amplification system comprises the following steps: 8. mu.l of the primer mixture obtained in example 3; the dosage of DNA is 100 ng; 3. mu.l of Ttase; water was added to make up 45. mu.l.

The one-round PCR amplification procedure: 3min at 95 ℃; (95 ℃ for 30s, 60 ℃ for 4min, 72 ℃ for 30s)28 cycles; 4min at 72 ℃.

And 3, mixing the obtained PCR amplification products in equal quantity, wherein the PCR amplification products can be mixed only if the amplification products are specific labels with different combinations, and the PCR amplification products can be directly mixed according to the ratio of the system 1:1 during mixing. After equal mixing, purifying the product after mixing, namely screening fragments, and the specific steps are as follows;

step 3.1, adding magnetic beads with the volume 0.4 times that of one round of PCR, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing the mixture by using a magnetic frame until the solution is clarified, and transferring the supernatant into a new tube;

step 3.2, adding magnetic beads with the volume 0.6 times that of one round of PCR, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 3.3, adding a magnetic bead suspension with the volume 0.9 time that of the PCR for one round, re-suspending the magnetic beads, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

and 3.4, adding 100 mu l of ethanol with the volume concentration of 80%, and repeatedly adsorbing the magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads. Adsorbing with magnetic frame for 2min, removing supernatant, and standing at room temperature until ethanol volatilizes completely;

the magnetic beads are: novozan magnetic bead

Step 4, digesting single-stranded DNA in the screened system;

in the system containing magnetic beads obtained in step 3, the following operations were performed:

step 4.1, adding 20 mul of water into the obtained product, and uniformly mixing the magnetic beads;

step 4.2, adsorbing magnetic beads, and transferring 16 mu l of supernatant into a new EP tube;

step 4.3, add Exo I2. mu.l, 10 Reaction Buffer 2. mu.l to the system.

And 4.4, the digestion procedure of the system is as follows: 30min at 37 ℃; 15min at 85 ℃.

And 5, purifying the digested product:

step 5.1, adding 0.9 time of magnetic beads, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 5.2, adding magnetic bead resuspension liquid with equal PCR volume, resuspending magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing supernatant;

and 5.3, adding 100 mu l of ethanol with the volume concentration of 80%, and repeatedly adsorbing the magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads. Adsorbing with magnetic frame for 2min, removing supernatant, and standing at room temperature until ethanol is completely volatilized.

And 6, configuring a two-round PCR system in the system obtained in the step 5:

configuring a two-round PCR system in the system containing the magnetic beads obtained in the step 5, and performing two-round PCR amplification;

the two-round PCR system: 10 μ l of the enzyme tretase; primer F; primer R; h₂O 18μl

The two-round PCR procedure: 3min at 95 ℃; (95 ℃ 15s, 58 ℃ 15s, 72 ℃ 30s) for 12 cycles; 4min at 72 ℃.

The sequence of the Primer F is shown as SEQ ID No.45 and is GAACGACATGGCTACGATCCGACTT; the sequence of the Primer R is shown as SEQ ID No.46 and is TGTGAGCCAAGGAGTTGTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT;

since 2 melon varieties are used in this example, in order to distinguish samples, the sequence of Primer R includes a unique Barcode sequence Barcode in addition to the sequence shown as seq id No. 46;

the sequence of the barcoded Primer R is:

TGTGAGCCAAGGAGTTGxxxxxxxxxxTTGTCTTCCTAAGACCGCTTGGCCTCCGACTT；

where "xxxxxxxx" is a unique Barcode used to identify the sample to distinguish the specimens.

The Barcode sequences of 2 parts of melon variety samples in the embodiment are CGGCTAAA and TCCCCGTG respectively; namely as shown in SEQ ID No.67-68 respectively.

Step 7, purifying the products of the two-round PCR amplification by using 0.80-time magnetic beads to complete the preparation of a sequencing library;

step 7.1, adding 0.8 time of magnetic beads, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 7.2, adding magnetic bead resuspension liquid with equal PCR volume, resuspending magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing supernatant;

and 7.3, adding 100 mu l of ethanol with the volume concentration of 80%, and repeatedly adsorbing the magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads. Adsorbing with magnetic frame for 2min, removing supernatant, and standing at room temperature until ethanol is completely volatilized.

Step 7.4 add 23. mu.l of Elution Buffer, suspend the beads well, and let stand at room temperature for 2min to elute the DNA. Adsorbing the magnetic beads by a magnet, and adsorbing the obtained supernatant DNA solution into a new tube to obtain a sequencing library (the solution Buffer is 10mM Tris-HCl, and the pH value is 8.0-8.5);

and 8, mixing the sequencing library with the same quality, and performing computer sequencing to obtain sequencing data.

And 9, identifying the genotype result of the target DNA, respectively selecting and detecting the synthesized seeds from 96 seeds for a subsequent purity judgment basis, and judging the purity of the seeds according to the genotype condition of the site with high polymorphism, wherein the detection result of the embodiment is shown in Table 3.

TABLE 3 detection of nodules

Sample numbering	Number of selfed seeds	Purity of seed	Conclusion
				Crisp pear 27	1	98.91％	Results of conventional identification
Crisp pear 50	4	97.30％	Results of conventional identification

Seed purity program interpretation principle:

firstly, judging whether each locus is hybridized/outcrossed or selfed, wherein the judgment standard is as follows: and calculating the proportion of the genotype type of a batch of seeds at each site. If the genotype of the site is only one and homozygous, the site is discarded because it cannot be judged whether the site is selfed or crossed. If the percentage of one heterozygous genotype exceeds 90%, judging as hybridization; if the genotype of a sample at the site is homozygous, the sample is judged to be self-bred; and if the hybrid genotype is other, judging the cross.

Then, the sample is subjected to judgment of selfing, outcrossing and hybridization. And finally, counting the overall situation of the batch of seeds.

Purity calculation, expressed as percentage of purity of a batch of seeds:

the embodiments described above are only preferred embodiments of the invention and are not exhaustive of the possible implementations of the invention. Any obvious modifications to the above would be obvious to those of ordinary skill in the art, but would not bring the invention so modified beyond the spirit and scope of the present invention.

Sequence listing

<110> Shijiazhuang Boruidi Biotech Co., Ltd

<120> mixed sample detection method for detecting melon seed purity based on mSNP technology

<130> 8

<160> 68

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial sequence (unknown)

<400> 1

tctaacaaaa tgatgatgat tggctaccac 30

<210> 2

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 2

gcattttgcc attgagctaa taaatcacaa t 31

<210> 3

<211> 33

<212> DNA

<213> Artificial sequence (unknown)

<400> 3

atcgaaagta caatgacttt aaattcctta cat 33

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 4

acacacatat cctccaaact ccctt 25

<210> 5

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 5

ccataggatt cctccctttc ccatg 25

<210> 6

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 6

ttcttgcatc tttcattttt gctatgctag t 31

<210> 7

<211> 27

<212> DNA

<213> Artificial sequence (unknown)

<400> 7

ccgggataac catctctatt ggtatga 27

<210> 8

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 8

ttgttcttat cacctaatag aacatggaca a 31

<210> 9

<211> 27

<212> DNA

<213> Artificial sequence (unknown)

<400> 9

gggaaaattt gacttactta actgcct 27

<210> 10

<211> 34

<212> DNA

<213> Artificial sequence (unknown)

<400> 10

ttttcaaagt gttgcttagg tataactaca tcta 34

<210> 11

<211> 29

<212> DNA

<213> Artificial sequence (unknown)

<400> 11

agttggctct ccactttaag tattttgac 29

<210> 12

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 12

tggttattta ggatagtttc aagtaaccgt t 31

<210> 13

<211> 30

<212> DNA

<213> Artificial sequence (unknown)

<400> 13

ccataaccaa tgaagacaca atcaagagtt 30

<210> 14

<211> 32

<212> DNA

<213> Artificial sequence (unknown)

<400> 14

ccatagcttt aatgtcgatt ttaaacatcc gt 32

<210> 15

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 15

gagtgccttc tagtcggaga ttact 25

<210> 16

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 16

cacttaagag agtaatggtt ttagttctgc t 31

<210> 17

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 17

atttgaaagt gatgttaata cgacgagaaa a 31

<210> 18

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 18

cagactttgg aggatagccc atttg 25

<210> 19

<211> 28

<212> DNA

<213> Artificial sequence (unknown)

<400> 19

cattgtacac tgtttggaga aaacacaa 28

<210> 20

<211> 26

<212> DNA

<213> Artificial sequence (unknown)

<400> 20

cacccttaat tgtccttaca tgcacc 26

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence (unknown)

<400> 21

ccaagaagca atctccgagc taa 23

<210> 22

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 22

gaggaatctt tcttggtaac tctagaaacc t 31

<210> 23

<211> 28

<212> DNA

<213> Artificial sequence (unknown)

<400> 23

ttgtaaccag aaaattgaag cagcaaat 28

<210> 24

<211> 29

<212> DNA

<213> Artificial sequence (unknown)

<400> 24

ctttagaaat gtttgtgcct acgagaacc 29

<210> 25

<211> 29

<212> DNA

<213> Artificial sequence (unknown)

<400> 25

tcaaagtttg tgtttagcgg ttgttaaat 29

<210> 26

<211> 30

<212> DNA

<213> Artificial sequence (unknown)

<400> 26

gttcatctcc taagcataaa tatctcgctg 30

<210> 27

<211> 23

<212> DNA

<213> Artificial sequence (unknown)

<400> 27

gcttgccatc gttgtaaacc aag 23

<210> 28

<211> 26

<212> DNA

<213> Artificial sequence (unknown)

<400> 28

aagcacctat ttgtgcaaca ttgtca 26

<210> 29

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 29

gttggctcga acgaatagag atctc 25

<210> 30

<211> 24

<212> DNA

<213> Artificial sequence (unknown)

<400> 30

gtcaaggtga gctgaacctc attg 24

<210> 31

<211> 26

<212> DNA

<213> Artificial sequence (unknown)

<400> 31

ttgatgcctt ttagaactcg gtgaat 26

<210> 32

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 32

ccgaaaggtt taatttcact attcaaccaa a 31

<210> 33

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 33

agagaaaatt ttattgacct tgggagagaa t 31

<210> 34

<211> 27

<212> DNA

<213> Artificial sequence (unknown)

<400> 34

ctccttaaag ttgcagtgtt gcaaaac 27

<210> 35

<211> 26

<212> DNA

<213> Artificial sequence (unknown)

<400> 35

taaccttcca gctcttagtt gcaaga 26

<210> 36

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 36

tcctgtctaa agtcaaattc tcaatcaagg a 31

<210> 37

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 37

gagagcaaat ctcgatgttg aggta 25

<210> 38

<211> 28

<212> DNA

<213> Artificial sequence (unknown)

<400> 38

tgagattcat cgagatctgc acttttct 28

<210> 39

<211> 26

<212> DNA

<213> Artificial sequence (unknown)

<400> 39

tgacgttgta cattgctaca acacta 26

<210> 40

<211> 31

<212> DNA

<213> Artificial sequence (unknown)

<400> 40

gattgcaagt caatttcaaa gagatagagc t 31

<210> 41

<211> 28

<212> DNA

<213> Artificial sequence (unknown)

<400> 41

aagtccaaag aagttgggag atgaaata 28

<210> 42

<211> 26

<212> DNA

<213> Artificial sequence (unknown)

<400> 42

tcttgtatcg ttcattgctt gtggtg 26

<210> 43

<211> 24

<212> DNA

<213> Artificial sequence (unknown)

<400> 43

aacgacatgg ctacgatccg actt 24

<210> 44

<211> 24

<212> DNA

<213> Artificial sequence (unknown)

<400> 44

ctaagaccgc ttggcctccg actt 24

<210> 45

<211> 25

<212> DNA

<213> Artificial sequence (unknown)

<400> 45

gaacgacatg gctacgatcc gactt 25

<210> 46

<211> 49

<212> DNA

<213> Artificial sequence (unknown)

<400> 46

tgtgagccaa ggagttgttg tcttcctaag accgcttggc ctccgactt 49

<210> 47

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 47

ccttc 5

<210> 48

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 48

accga 5

<210> 49

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 49

atgtg 5

<210> 50

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 50

aatgc 5

<210> 51

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 51

ttcgg 5

<210> 52

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 52

aaggt 5

<210> 53

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 53

cccat 5

<210> 54

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 54

atgga 5

<210> 55

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 55

acgat 5

<210> 56

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 56

ctctg 5

<210> 57

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 57

atccg 5

<210> 58

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 58

tatcg 5

<210> 59

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 59

actcg 5

<210> 60

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 60

taacc 5

<210> 61

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 61

cttac 5

<210> 62

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 62

tccta 5

<210> 63

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 63

acact 5

<210> 64

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 64

tacgt 5

<210> 65

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 65

tcacg 5

<210> 66

<211> 5

<212> DNA

<213> Artificial sequence (unknown)

<400> 66

acgca 5

<210> 67

<211> 8

<212> DNA

<213> Artificial sequence (unknown)

<400> 67

cggctaaa 8

<210> 68

<211> 8

<212> DNA

<213> Artificial sequence (unknown)

<400> 68

tccccgtg 8

Claims (10)

1. A muskmelon seed purity detection primer group based on the mSNP technology is characterized by comprising a primer pair 1F/R, a primer pair 2F/R, a primer pair 3F/R, a primer pair 4F/R, a primer pair 5F/R, a primer pair 6F/R, a primer pair 7F/R, a primer pair 8F/R, a primer pair 9F/R, a primer pair 10F/R, a primer pair 11F/R, a primer pair 12F/R, a primer pair 13F/R, a primer pair 14F/R, a primer pair 15F/R, a primer pair 16F/R, a primer pair 17F/R, a primer pair 18F/R, a primer pair 19F/R, a primer pair 20F/R and a primer pair 21F/R; wherein each primer pair consists of a forward primer and a reaction primer;

in the primer pair 1F/R, the sequence of the F primer is shown as SEQ ID No.1, and the sequence of the R primer is shown as SEQ ID No. 2;

in the primer pair 2F/R, the sequence of the F primer is shown as SEQ ID No.3, and the sequence of the R primer is shown as SEQ ID No. 4;

in the primer pair 3F/R, the sequence of the F primer is shown as SEQ ID No.5, and the sequence of the R primer is shown as SEQ ID No. 6;

in the primer pair 4F/R, the sequence of the F primer is shown as SEQ ID No.7, and the sequence of the R primer is shown as SEQ ID No. 8;

in the primer pair 5F/R, the sequence of the F primer is shown as SEQ ID No.9, and the sequence of the R primer is shown as SEQ ID No. 10;

in the primer pair 6F/R, the sequence of the F primer is shown as SEQ ID No.11, and the sequence of the R primer is shown as SEQ ID No. 12;

in the primer pair 7F/R, the sequence of the F primer is shown as SEQ ID No.13, and the sequence of the R primer is shown as SEQ ID No. 14;

in the primer pair 8F/R, the sequence of the F primer is shown as SEQ ID No.15, and the sequence of the R primer is shown as SEQ ID No. 16;

in the primer pair 9F/R, the sequence of the F primer is shown as SEQ ID No.17, and the sequence of the R primer is shown as SEQ ID No. 18;

in the primer pair 10F/R, the sequence of the F primer is shown as SEQ ID No.19, and the sequence of the R primer is shown as SEQ ID No. 20;

in the primer pair 11F/R, the sequence of the F primer is shown as SEQ ID No.21, and the sequence of the R primer is shown as SEQ ID No. 22;

in the primer pair 12F/R, the sequence of the F primer is shown as SEQ ID No.23, and the sequence of the R primer is shown as SEQ ID No. 24;

in the primer pair 13F/R, the sequence of the F primer is shown as SEQ ID No.25, and the sequence of the R primer is shown as SEQ ID No. 26;

in the primer pair 14F/R, the sequence of the F primer is shown as SEQ ID No.27, and the sequence of the R primer is shown as SEQ ID No. 28;

in the primer pair 15F/R, the sequence of the F primer is shown as SEQ ID No.29, and the sequence of the R primer is shown as SEQ ID No. 30;

in the primer pair 16F/R, the sequence of the F primer is shown as SEQ ID No.31, and the sequence of the R primer is shown as SEQ ID No. 32;

in the primer pair 17F/R, the sequence of the F primer is shown as SEQ ID No.33, and the sequence of the R primer is shown as SEQ ID No. 34;

in the primer pair 18F/R, the sequence of the F primer is shown as SEQ ID No.35, and the sequence of the R primer is shown as SEQ ID No. 36;

in the primer pair 19F/R, the sequence of the F primer is shown as SEQ ID No.37, and the sequence of the R primer is shown as SEQ ID No. 38;

in the primer pair 20F/R, the sequence of the F primer is shown as SEQ ID No.39, and the sequence of the R primer is shown as SEQ ID No. 40;

in the primer pair 21F/R, the sequence of the F primer is shown as SEQ ID No.41, and the sequence of the R primer is shown as SEQ ID No. 42.

2. The mixed sample detection method for detecting the purity of the melon seeds by using the primer group according to claim 1, which is characterized by comprising the following steps:

step 1, selecting materials: selecting 1 or more melon varieties; at least 96 seeds are adopted in each melon sample;

step 2, accurately quantifying the genomic DNA of the muskmelon;

step 3, synthesizing primers in the primer group in claim 1, wherein when synthesizing a forward primer and a reverse primer in each primer pair, 10 primers with different target labels are synthesized; then mixing the primers according to the specified label combination to prepare a primer mixed solution;

step 4, taking the genomic DNA of the melons as a template, and performing one round of PCR amplification on the genomic DNA of the melons by using the primer mixed solution to obtain a target region;

step 5, mixing the obtained PCR amplification products in equal amount;

step 6, screening fragments of the mixed product;

step 7, digesting the single-stranded DNA in the screened system;

step 8, purifying the digested product;

step 9, configuring a two-round PCR system in the system obtained in the step 8;

step 10, purifying the products of the two rounds of PCR to complete the preparation of a sequencing library;

step 11, mixing the sequencing library with the same quality, and then performing on-machine sequencing to obtain sequencing data;

step 12, splitting the sample according to the label combination again for the obtained test data;

and step 13, identifying the genotype result of the target locus of the test sample, and judging the purity of the seed according to the genotype condition of the locus.

3. The method for detecting the purity of melon seeds according to claim 2,

in the step 3, the F primers in the primer pairs 1F/R-21F/R also comprise an F-terminal universal primer, and the sequence of the F-terminal universal primer is shown as SEQ ID No. 43; the R primers in the primer pairs 1F/R-21F/R also comprise an R-end universal primer, and the sequence of the R-end universal primer is shown as SEQ ID No. 44;

in step 9, the sequence of Frimer F used in the two rounds of PCR is shown in SEQ ID No. 45; the sequence of Primer R used in the two-round PCR is shown in SEQ ID No. 46.

4. The method for detecting the purity of the melon seeds according to claim 3,

when the melon variety is plural, the sequence of the Primer R further includes a barcode sequence for discriminating the melon variety.

5. The method for detecting the purity of the muskmelon seeds as claimed in claim 2, wherein in step 2, the tag sequence of the forward primer is different from the tag sequence of the reverse primer in the tag combination of each primer pair.

6. The method for detecting the purity of melon seeds according to claim 2,

in step 1, the genomic DNA of the melon seeds was extracted using a melon seed genomic DNA extraction kit.

7. The method for detecting the purity of melon seeds according to claim 2,

in step 4, the round of PCR amplification system: 8 mul of primer mixed solution; the dosage of DNA is 100 ng; 3. mu.l of Ttase; adding water to complement 45 mu l; the one-round PCR amplification procedure: 3min at 95 ℃; (95 ℃ for 30s, 60 ℃ for 4min, 72 ℃ for 30s)28 cycles; 4min at 72 ℃.

8. The method for detecting the purity of melon seeds according to claim 2,

in step 6, the mixed product is subjected to fragment screening, specifically the following operations:

step 6.1, adding magnetic beads with the volume 0.4 times that of one round of PCR, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing the mixture by using a magnetic frame until the solution is clarified, and transferring the supernatant into a new tube;

step 6.2, adding magnetic beads with the volume 0.6 times that of one round of PCR, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 6.3, adding a magnetic bead suspension with the volume 0.9 time that of one round of PCR, re-suspending the magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing the supernatant;

and 6.4, adding 100 mu l of ethanol with the volume concentration of 80%, repeatedly adsorbing the magnetic beads on different two surfaces by using a magnetic frame to fully wash the magnetic beads, adsorbing for 2min by using the magnetic frame, removing the supernatant, and standing at room temperature until the ethanol is completely volatilized.

In step 7, digesting the single-stranded DNA in the system obtained after screening, the specific operation steps are as follows:

step 7.1, adding 20 mul of water into the obtained product, and uniformly mixing the magnetic beads;

step 7.2, adsorbing magnetic beads, and transferring 16 mu l of supernatant into a new EP tube;

step 7.3, adding 2 ul of Exo I and 2 ul of 10 × Reaction Buffer into the system;

and 7.4, the digestion program of the digestion system is as follows: 30min at 37 ℃; 15min at 85 ℃;

in step 8, the specific operation steps for purifying the digested product are as follows:

step 8.1, adding 0.9 time of magnetic beads, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

8.2, adding magnetic bead resuspension liquid with equal PCR volume, resuspending magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing supernatant;

and 8.3, adding 100 mu l of ethanol with the volume concentration of 80%, repeatedly adsorbing the magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads, adsorbing for 2min by using the magnetic frame, removing the supernatant, and standing at room temperature until the ethanol is completely volatilized.

9. The method for detecting the purity of melon seeds according to claim 2,

in step 9, the two-round PCR system: 10 μ l of the enzyme tretase; primer F; primer R; H2O 18 μ l;

the two-round PCR procedure: 3min at 95 ℃; (95 ℃ 15s, 58 ℃ 15s, 72 ℃ 30s) for 12 cycles; 4min at 72 ℃;

10. the method for detecting the purity of melon seeds according to claim 2,

in step 10, the two rounds of PCR products are purified using 0.80 times of magnetic beads, as follows:

step 10.1, adding 0.8 time of magnetic beads, blowing and beating the mixture up and down by using a pipettor, uniformly mixing, standing for 2min, adsorbing by using a magnetic frame until the solution is clarified, and removing the supernatant;

step 10.2, adding magnetic bead resuspension liquid with equal PCR volume, resuspending magnetic beads, standing for 2min, adsorbing by a magnetic frame until the solution is clarified, and removing supernatant;

step 10.3, adding 100 mul of 80% ethanol, repeatedly adsorbing magnetic beads on two different surfaces by using a magnetic frame to fully wash the magnetic beads, adsorbing for 2min by using the magnetic frame, removing supernatant, and standing at room temperature until the ethanol is completely volatilized;

step 10.4, adding 23 μ l of Elution Buffer, fully suspending the magnetic beads, standing for 2min at room temperature to elute DNA, adsorbing the magnetic beads by a magnet, and adsorbing the obtained supernatant DNA solution into a new tube to obtain a sequencing library; the Elution Buffer is 10mM Tris-HCl and has the pH value of 8.0-8.5.

Images