CN114230652A

CN114230652A - Prokaryotic cell high-efficiency expression method of red rice and rice hemopexin

Info

Publication number: CN114230652A
Application number: CN202210072817.4A
Authority: CN
Inventors: 方庆; 黄卉; 王海洋
Original assignee: Hubei University for Nationalities
Current assignee: Hubei University for Nationalities
Priority date: 2022-01-21
Filing date: 2022-01-21
Publication date: 2022-03-25

Abstract

The invention discloses a prokaryotic cell high-efficiency expression method of red rice hemopexin, relating to the technical field of prokaryotic cell expression and comprising the following steps: preparing plant materials, performing sterile disinfection on red rice, performing incubator culture, taking a small amount of sterile red rice seedling samples, and extracting total RNA of the red rice by adopting a Trizol method; the invention adopts the modern gene engineering strategy, and the target gene is extracted from the total RNA of red rice and amplified by RT-PCR. The target gene is connected with a recombinant expression vector, and then the recombinant vector transforms an escherichia coli cell, so that a target protein gene related to heme binding in red rice is efficiently expressed in the escherichia coli of prokaryotic cells, and key technical conditions and bases are provided for the mass obtaining, activity identification and application of the plant-derived heme binding-related protein.

Description

Prokaryotic cell high-efficiency expression method of red rice and rice hemopexin

Technical Field

The invention relates to the technical field of prokaryotic cell expression, in particular to a prokaryotic cell high-efficiency expression method of red rice hemopexin.

Background

Heme is one of the important members of the tetrapyrrole compound (tetrapyrroles) family. As a result of intensive research, the function of heme in human and mammalian cells has now been found to be important and diverse. It not only acts as an important prosthetic group of hemoglobin, but also participates in the regulation of oxygen metabolism and transport, intracellular electron transfer, etc. In most cases, non-free heme in vivo often interacts with protein subunits to form a complex, which exerts its regulatory function. However, excessive free hemoglobin can induce the production of reactive oxygen species that can cause oxidative stress damage to cells. Therefore, intracellular heme needs to be regulated by enzymes or specific proteins to maintain relative stability. Heme binding-related proteins (HBPs), including heme oxygenases and the like, are key factors involved in heme regulation. Phytoheme is relatively insoluble in water and needs to be transported to sites of functional tissue by its prosthetic proteins. Thus, plant-derived heme prosthetic group proteins, including heme binding and transport proteins, have important roles in the proper functioning of heme. Rice is the first large grain crop in China, and colored rice is an important rice variety resource in China. For example, red rice is used as an ancient and precious rice seed resource in China, is named after red precipitate of brown rice peel, and is a nourishing treasure with homology of medicine and food. Under the new situation, the discovery of endogenous active protein factors by using a biotechnology method has important significance for deeply developing genetic resources of red rice and promoting the utilization of the resources. For example, enhancing the genetic research of heme-binding related protein or enzyme in resource rice and identifying the biological activity of the expression product thereof can provide a basis for further developing and applying the functions beneficial to human nutrition and health.

Plant-derived hemopexin genes have important potential in enhancing plant resistance to biotic and abiotic stresses in plants. It is likely to function via an antioxidant pathway. However, few studies on the heme-associated protein in red rice are currently carried out, and the beneficial activity in vitro is to be deeply explored.

Disclosure of Invention

The invention aims to provide a prokaryotic cell high-efficiency expression method of red rice and rice hemopexin, which aims to solve the defects in the prior art.

In order to achieve the above purpose, the invention provides the following technical scheme: a prokaryotic cell high-efficiency expression method of red rice hemopexin comprises the following steps:

step one, preparing plant materials, namely performing sterile disinfection on red rice, placing the red rice on sterile filter paper of a culture dish to keep certain humidity, performing culture in an incubator, and taking the red rice as a red rice seedling sample after the red rice seedlings germinate for 2-4 days;

step two, extracting total RNA of red rice, namely taking a small amount of sterile red rice seedling samples, and extracting the total RNA of the red rice by adopting a Trizol method;

step three, amplifying a target gene by RT-PCR, designing upstream and downstream primers of the target gene OsHBP2, respectively designing restriction endonuclease sites of BamH1 and EcoR1 by the upstream and downstream primers, and amplifying the target gene by taking a reverse transcription product single-stranded cDNA as a template;

step four, connecting the target gene with a recombinant expression vector, carrying out ethanol precipitation recovery on the amplification product, taking the recovered product and the pCold I vector to carry out restriction endonuclease digestion respectively to form a viscous tail end, and recovering the enzyme digestion expression vector and the target gene fragment to carry out a connection reaction;

step five, transforming escherichia coli cells by the recombinant vector, taking 5 mu l of a product in a connection system, mixing the product with escherichia coli competent cells, carrying out heat shock transformation after ice bath for 20-40min, coating an LB + Amp culture medium with the concentration of 100ug/ml with a resuscitation bacteria solution, inverting a plate for culture for 16h, observing and selecting a single colony, carrying out liquid LB culture, extracting plasmids and sequencing to identify clones;

and sixthly, inducing expression and detection of target protein escherichia coli, introducing the recombinant plasmid with correct sequencing into an expression strain BL21 competent cell, inducing by 0.1mM IPTG, inducing expression for 4h, ultrasonically breaking the cell, centrifugally separating supernatant after lysing bacteria, carrying out affinity binding with nickel agarose gel beads, eluting by imidazole solution, collecting samples subjected to fractional elution, preparing electrophoresis samples, and carrying out SDS-PAGE gel electrophoresis analysis.

Preferably, the red rice is sterilized in step one by using 2% sodium hypochlorite solution for 5min and repeatedly washing with sterile water for 4 times.

Preferably, the specific operation of extracting the total RNA of the red rice by using the Trizol method in the step two is as follows:

placing a small amount of sterile red rice seedling samples in a precooled mortar, grinding the sterile red rice seedling samples into powder by using liquid nitrogen, adding Trizol extraction buffer solution, soaking, transferring the soaked red rice seedling samples into an EP tube, turning the upper part and the lower part of the EP tube upside down for 2min, standing for 1min, adding 200ul of chloroform, shaking the mixture for 15 seconds with force, uniformly mixing the mixture, standing for 3min, centrifuging the mixture at 12000rpm for 10min, sucking supernatant into a new EP tube, adding 500 mu l of isopropanol, turning the mixture uniformly, standing for 8min, and centrifuging the mixture at 12000rpm for 10 min; the precipitate was washed with 75% ethanol and air dried, solubilized with RNase-free ddH2O and stored at low temperature.

Preferably, in step three:

the upstream primer is as follows: OsHBP2-F CGGGATCCATGGGGATGGTGCTGGGCA;

the downstream primer is: OsHBP2-R CGGAATTCTCACTCGACGGGGACCAT.

Preferably, the third step includes a PCR reaction program, wherein the PCR reaction program is 95 ℃ for 3min, 95 ℃ for 30s, 50 ℃ for 30s, 72 ℃ for 45s, 72 ℃ for 5min, and 16 ℃ for 10min, and the number of reaction cycles is set to 30.

Preferably, in step four, the reaction system of the gene fragment and pCold I vector enzyme is: 3.0 mul of vector or gene fragment I, 1.0 mul of BamHI, 11.0 mul of EcoR, 5.0 mul of 10 xHbuffer, and 40 mul of ddH2O (containing RNase). after the components are mixed gently, the temperature is kept for 4 hours at 37 ℃, and then the restriction enzyme expression vector and the target gene fragment are recovered for ligation reaction, wherein the system is 1.0 mul of DNA, 4.5 mul of ddH2O4.5 mul, 0.5 mul of pCold I, and 0.5 mul of Solution. The ligation was carried out at 16 ℃ for 10 hours.

Preferably, in the sixth step, the breaking power of the ultrasonic broken cells is 66W, the time is 4-10 s, and the process is repeated for 3 times at an interval of 10 s.

In the technical scheme, the invention provides the following technical effects and advantages:

the invention adopts a modern genetic engineering strategy, and the target gene is amplified by extracting total RNA of the red rice and RT-PCR. The target gene is connected with a recombinant expression vector, and then the recombinant vector transforms an escherichia coli cell, so that a target protein gene related to heme binding in red rice is efficiently expressed in the escherichia coli of prokaryotic cells, and key technical conditions and bases are provided for the mass obtaining, activity identification and application of the plant-derived heme binding-related protein.

Drawings

In order to more clearly illustrate the embodiments of the present application or technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments described in the present invention, and other drawings can be obtained by those skilled in the art according to the drawings.

FIG. 1 is a diagram showing the results of detecting PCR products by electrophoresis according to the present invention.

FIG. 2 is a diagram showing the construction results of the expression vector of the present invention.

FIG. 3 is a graph showing the separation results of the expressed protein of the present invention.

FIG. 4 shows reference sequence 1 (full-length ORF of gene, 651bp) according to the present invention.

FIG. 5 shows the sequence 2 of the present invention (amino acid sequence of protein OsHBP2, 216 aa).

Detailed Description

In order to make the technical solutions of the present invention better understood, those skilled in the art will now describe the present invention in further detail with reference to the accompanying drawings.

The invention provides a prokaryotic cell high-efficiency expression method of red rice hemopexin, which comprises the following steps:

step one, preparing plant materials, and performing sterile disinfection on red rice: sterilizing with 2% sodium hypochlorite solution for 5min, repeatedly washing with sterile water for 4 times, placing on sterile filter paper of culture dish to maintain certain humidity, culturing in incubator, and taking as red rice seedling sample after germinating for 4 d;

and step two, extracting the total RNA of the red rice, namely taking a small amount of sterile red rice seedling samples, and extracting the total RNA of the red rice by adopting a Trizol method. Placing a small amount of sterile red rice seedling samples (1-2 plants, the seedling age of 2d, about 1g) in a precooled mortar, grinding the sterile red rice seedling samples into powder by using liquid nitrogen, adding Trizol extraction buffer solution, soaking, transferring the soaked red rice seedling samples into an EP tube, turning the red rice seedling samples upside down for 2min, standing for 1min, adding 200ul of chloroform, shaking the mixture for 15 seconds with force, uniformly mixing the mixture, standing for 3min, centrifuging the mixture at 12000rpm for 10min, sucking supernatant to a new EP tube, adding 500 mu l of isopropanol, turning the mixture upside down, uniformly mixing the mixture, standing for 8min, and centrifuging the mixture at 12000rpm for 10 min; the precipitate was washed with 75% ethanol and air dried, solubilized with RNase-free ddH2O and stored at low temperature.

Step three, amplifying a target gene by RT-PCR, and designing upstream and downstream primers of the target gene OsHBP2, wherein the upstream and downstream primers are OsHBP2-F CGGGATCCATGGGGATGGTGCTGGGCA and OsHBP2-RCGGAATTCTCACTCGACGGGGACCAT respectively; restriction endonuclease sites of BamH1 and EcoR1 (base sequences are underlined) were designed for the upstream and downstream primers, respectively. The target gene is amplified by using the reverse transcription product single-chain cDNA as a template, the PCR reaction program is 95 ℃ for 3min, 95 ℃ for 30s, 50 ℃ for 30s, 72 ℃ for 45s, 72 ℃ for 5min and 16 ℃ for 10min, and the reaction cycle number is set as 30.

And step four, connecting the target gene with a recombinant expression vector, and performing ethanol precipitation recovery on the amplification product. The recovered product and pCold I vector were separately subjected to restriction endonuclease digestion to form cohesive ends. The enzyme digestion reaction system of the gene fragment and the pCold I vector is as follows: 3.0. mu.l of vector or gene fragment I, 1.0. mu.l of BamHI, 11.0. mu.l of EcoR, 5.0. mu.l of 10 XH buffer, 40. mu.l of ddH2O (containing RNase); the components are mixed evenly and lightly, the temperature is kept at 37 ℃ for 4 hours, and then the restriction enzyme expression vector and the target gene fragment are recovered for ligation reaction, wherein the system comprises 1.0 mu l of DNA, 4.5 mu l of ddH2O4.5, 0.5 mu l of pCold I and 0.5 mu l of Solution. The ligation was carried out at 16 ℃ for 10 hours.

And step five, transforming the escherichia coli cells by the recombinant vector, taking 5 mu l of a product in the connection system, mixing the product with the escherichia coli competent cells, carrying out heat shock transformation after ice bath for 30min, coating LB + Amp (100ug/ml) culture medium with resuscitation bacteria liquid, inverting the plate for culture for 16h, observing and selecting a single bacterial colony to enter liquid LB culture, extracting plasmids and sequencing to identify clones.

And sixthly, inducing, expressing and detecting target protein escherichia coli, introducing the recombinant plasmid with correct sequencing into an expression strain BL21 competent cell, inducing for 0.1mMIPTG, inducing and expressing for 4h, and ultrasonically breaking the cell (the breaking power is 66W, the time is 4-10 s, the repeating is carried out for 3 times, and the interval is 10 s). And (3) centrifugally separating supernatant after the lysis bacteria are subjected to affinity binding with nickel agarose gel beads, then performing imidazole solution (250mM) elution, collecting samples subjected to fractional elution, preparing electrophoresis samples, and performing SDS-PAGE gel electrophoresis analysis.

Extracting total RNA of the red rice seedlings, and performing RT-PCR. The PCR product was detected by electrophoresis on a 1% strength agarose gel. As shown in FIG. 1, the target gene lane (lane L1) shows an amplified single DNA band compared to the empty control (lane L0, no template); the amplified DNA size is between 500 and 750bp, according to the standard molecular weight of DNA (lane Md), which is expected to be better. The target gene fragment is recovered and successfully connected with a pMD18-T cloning vector to send out sequencing. The result showed that the entire coding region of the desired gene was 651bp (SEQ ID NO: 1). As shown above, the clone OsHBP2 was successful.

As shown in FIG. 2, by means of restriction endonuclease (BamH1/EcoR1) and T4-DNA ligase, prokaryotic cell expression vector pCold-OsHBP2 was successfully constructed, and compared with empty vector (Lane Lp1), the target gene recombinant expression vector is slightly larger (Lane Lp2), and sequencing identification shows that the target gene is successfully introduced into the expression vector multiple cloning site. Coli transformed with the recombinant expression vector was induced with 0.1mM IPTG for about 4 h. Then ultrasonic cell disruption treatment is carried out, nickel agarose gel beads are used for affinity precipitation of target protein, and SDS-PAGE is used for detecting separation conditions. The results show that the target protein was successfully isolated, with a molecular weight of approximately 23kDa, corresponding to the gene-precoded protein (FIG. 3, lanes 1 to 6, SEQ ID NO: 2). The amount of protein eluted four subsequent times was reduced compared to the first two eluted proteins (lanes 1 and 2), but the isolated protein was more pure (lanes 3 to 6). The test shows that the red rice and rice heme binding-related protein OsHBP2 can be successfully expressed in Escherichia coli cells in high amount under the test conditions.

In summary, the following steps: the invention adopts a modern genetic engineering strategy, and the target gene is amplified by extracting total RNA of the red rice and RT-PCR. The target gene is connected with a recombinant expression vector, and then the recombinant vector transforms an escherichia coli cell, so that a target protein gene related to heme binding in red rice is efficiently expressed in the escherichia coli of prokaryotic cells, and key technical conditions and bases are provided for the mass obtaining, activity identification and application of the plant-derived heme binding-related protein.

The gene OsHBP2 has a full-length ORF of 651bp, and is used for pre-coding a protein containing 216 amino acids. See sequence 1 in FIG. 4 and sequence 2 in FIG. 5.

While certain exemplary embodiments of the present invention have been described above by way of illustration only, it will be apparent to those of ordinary skill in the art that the described embodiments may be modified in various different ways without departing from the spirit and scope of the invention. Accordingly, the drawings and description are illustrative in nature and should not be construed as limiting the scope of the invention.

Claims

1. A prokaryotic cell high-efficiency expression method of red rice and rice hemopexin is characterized by comprising the following steps:

step five, transforming escherichia coli cells by the recombinant vector, taking 5 mu l of a product in a connection system, mixing the product with escherichia coli competent cells, carrying out heat shock transformation after ice bath for 20-40min, coating a recovery bacterium solution with an LB + Amp culture medium with the concentration of 100ug/ml, carrying out inverted plate culture for 10-20h, observing and selecting a single colony, carrying out liquid LB culture, extracting plasmids and sequencing to identify clones;

and sixthly, inducing expression and detection of target protein escherichia coli, introducing the recombinant plasmid with correct sequencing into an expression strain BL21 competent cell, inducing by 0.1mM IPTG, inducing expression for 1-5h, ultrasonically breaking the cell, centrifugally separating supernatant after lysing bacteria, carrying out affinity binding with nickel agarose gel beads, eluting by imidazole solution, collecting samples subjected to fractional elution, preparing electrophoresis samples, and carrying out SDS-PAGE gel electrophoresis analysis.

2. The method for efficiently expressing the hemopexin of the red rice as claimed in claim 1, which comprises the following steps: in the step one, the red rice is sterilized by using a 2% sodium hypochlorite solution for 5min, and is repeatedly washed by sterile water for 4 times.

3. The method for prokaryotic cell efficient expression of red rice hemopexin according to claim 1, wherein the specific operation of extracting red rice total RNA by Trizol method in the second step is:

4. The method for efficiently expressing the hemopexin of the red rice as claimed in claim 1, which comprises the following steps:

the upstream primer in the third step is as follows: OsHBP2-F CGGGATCCATGGGGATGGTGCTGGGCA;

the downstream primer is: OsHBP2-R CGGAATTCTCACTCGACGGGGACCAT.

5. The method for efficiently expressing the hemopexin of the red rice as claimed in claim 1, which comprises the following steps: the third step comprises a PCR reaction program, wherein the PCR reaction program comprises 95 ℃ for 3min, 95 ℃ for 30s, 50 ℃ for 30s, 72 ℃ for 45s, 72 ℃ for 5min and 16 ℃ for 10min, and the number of reaction cycles is set to be 30.

6. The method for efficiently expressing the hemopexin of the red rice as claimed in claim 1, which comprises the following steps: in the fourth step, the enzyme digestion reaction system of the gene fragment and the pCold I vector is as follows: 3.0. mu.l of vector or gene fragment I, 1.0. mu.l of BamHI, 11.0. mu.l of EcoR, 5.0. mu.l of 10 XH buffer, 40. mu.l of ddH2O (containing RNase); after the components are mixed lightly and evenly, the temperature is kept at 37 ℃ for 4 hours, then the enzyme digestion expression vector and the target gene fragment are recovered for carrying out ligation reaction, and the system comprises 1.0 mu l of DNA, 4.5 mu l of ddH2O4.5, 0.5 mu l of pCold I and 0.5 mu l of Solution; the ligation was carried out at 16 ℃ for 10 hours.

7. The method for efficiently expressing the hemopexin of the red rice as claimed in claim 1, which comprises the following steps: and in the sixth step, the breaking power of the ultrasonic broken cells is 66W, the time is 4-10 s, and the process is repeated for 3 times at intervals of 10 s.