CN104232598B - A kind of Poria nadph oxidase encoding gene Nox and application thereof - Google Patents
A kind of Poria nadph oxidase encoding gene Nox and application thereof Download PDFInfo
- Publication number
- CN104232598B CN104232598B CN201410487383.XA CN201410487383A CN104232598B CN 104232598 B CN104232598 B CN 104232598B CN 201410487383 A CN201410487383 A CN 201410487383A CN 104232598 B CN104232598 B CN 104232598B
- Authority
- CN
- China
- Prior art keywords
- poria
- gene
- nadph oxidase
- nox
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0022—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with oxygen as acceptor (1.4.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y106/00—Oxidoreductases acting on NADH or NADPH (1.6)
- C12Y106/03—Oxidoreductases acting on NADH or NADPH (1.6) with oxygen as acceptor (1.6.3)
- C12Y106/03001—NAD(P)H oxidase (1.6.3.1), i.e. NOX1
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a kind of Poria nadph oxidase encoding gene and application thereof, does the application utilize second filial generation Solexa first? HiSeq2000 carry out Poria transcript profile order-checking and<i>de? novo?</i>splicing, analyzes and finds the candidate gene encoding nadph oxidase in Poria<i>nox</i>and carry out body outer clone expression, it is thus achieved that gene order be SEQ? ID? does is the protein of coding SEQ shown in NO.1? ID? shown in NO.2. Passed through transgenic technology process LAN in Poria, it has been found that it can be accelerated the formation of poria cocos sclerotium and improve sclerotium yield.
Description
Technical field
The invention belongs to biological technical field, relate generally in Poria nadph oxidase encoding gene Nox (PcWNox) and coded product thereof and application.
Background technology
Medicinal Poria refers to the sclerotium of On Polyporaceae Poria (Poriacocos (Schw.) Wolf), it is one of conventional popular medical material kind of China, having high medical value and diet nutritional is worth, being used as medicine can promoting diuresis to eliminate damp pathogen, strengthening the spleen stomach function regulating, mind tranquilizing and the heart calming. Due to the ecological habit that Poria is special, the growth promoter of its sclerotium depends on the parasitism to Masson Pine and draws carbon source therein, nitrogenous source and some other required material, being independent of the new cultivation technique of Masson Pine resource, control accurate Sclerotia forming condition for exploring and improve yield, function and the mechanism of action of research poria cocos sclerotium formation related gene are significant.
Nicotinamide adenine dinucleotide reduced (nicotinamideadeninedinucleotidephosphate, NADPH) oxidasic non-phagocytic cell oxidase (non-phagocyticcelloxidase, NOX) family is the main source of active oxygen (reactionoxygenspecies, ROS) in many non-phagocytic cells. The ROS produced by this approach may participate in cell differentiation as signaling molecule, propagation, the adjustment of apoptosis etc.ROS signal transduction pathway occupies very important status in the growth of plant pathogenic fungi, growth and pathogenic adjustment. PcWNox gene belongs to a gene in ROS signal path, and in the bacterial strain that PcWNox gene is silenced, ROS content substantially reduces, and cannot grow formation sclerotium.
The application utilizes second filial generation SolexaHiSeq2000 to carry out transcript profile order-checking and the Denovo splicing of Poria first. Analyze and find the candidate gene encoding nadph oxidase in Poria and carry out body outer clone expression, passed through transgenic technology process LAN in Poria, it has been found that it can be accelerated the formation of poria cocos sclerotium and improve yield.
Before the present invention comes forth, not yet have any open or reported PcWNox gene mentioned in present patent application and aminoacid sequence thereof. The enzyme of this gene code has important effect in poria cocos sclerotium forming process.
Summary of the invention
It is an object of the invention to provide a kind of Poria nadph oxidase encoding gene Nox (PcWNox), its sequence is shown in SEQIDNO.1. Nox plays requisite effect in Sclerotia forming process, and this gene can accelerate the formation of poria cocos sclerotium.
Another object of the present invention is to provide the protein of Nox gene code, and its sequence is shown in SEQIDNO.2.
Last purpose of the present invention is in that the application providing a kind of Poria nadph oxidase encoding gene Nox (PcWNox) accelerating during poria cocos sclerotium is formed, and is additionally included in the application increased in medicinal Poria yield.
In order to achieve the above object, the present invention takes techniques below measure:
A kind of Poria nadph oxidase encoding gene Nox (PcWNox) (following or title PcWNox gene), its preparation method is as follows:
Using Poria cDNA as template, design primer P1:5'-ATGGGCGAGAGTTGGTT-3'; P2:5'-TTAGAAGTGTTCCTTTGCGA-3' carries out pcr amplification, and PCR condition is as follows:
3min, 95 DEG C; 30s94 DEG C; And30s57 DEG C, 1min72 DEG C 35 circulations; 10min, 72 DEG C; 1min, 25 DEG C.
Being finally obtained PcWNox gene, its sequence is shown in SEQIDNO.1, and the protein of coding is shown in SEQIDNO.2.
The application in accelerating poria cocos sclerotium formation (improving sclerotium yield) of a kind of Poria nadph oxidase encoding gene Nox (PcWNox), its application process is as follows:
Poria nadph oxidase encoding gene Nox (shown in SEQIDNO.1) is proceeded in Poria protoplast by Agrobacterium tumefaciens-mediated Transformation, then carry out inoculation and the cultivation of Poria in the usual way, the transgenic Poria bacterial strain of high yield poria cocos sclerotium can be obtained.
The claimed content of the present invention also includes:
Amino acid whose nucleotide sequence shown in coding SEQIDNO.2; Nucleotide sequence shown in preferred SEQIDNO.1.
Poria nadph oxidase encoding gene Nox (PcWNox) containing the present invention or its ORF sequence recombinant vector; such as protokaryon class carrier; eucaryon class expression vector and RNAi carrier belong to protection scope of the present invention; include but not limited to pRS314 carrier; PE �� p3300, pBARGPE1, pAN7-1; pAN52-1, pBC-hygro.
Poria nadph oxidase encoding gene Nox (PcWNox) complete sequence containing the present invention or the host cell of its ORF sequence; as the host cell containing above-mentioned recombinant vector falls within protection scope of the present invention; include but not limited to Bacillus coli cells, agrobatcerium cell EA101; EA105, LBA4404, Pichia sp..
The application of Poria nadph oxidase encoding gene Nox (PcWNox) of the present invention, including with described recombinant vector, as plant expression vector converts plant cell; Or with described Poria nadph oxidase encoding gene Nox (PcWNox) complete sequence or the Sequence Transformed acquisition transgenic organism of its ORF, including Nicotiana tabacum L., arabidopsis, yeast, Rhizoma Panacis Japonici root of hair.
In the present invention, host cell is prokaryotic cell or eukaryotic cell. Conventional prokaryotic host cell includes escherichia coli; Conventional eukaryotic host cell includes yeast cells, tobacco cell and other plant cell.
Compared with prior art, the invention have the advantages that
Poria nadph oxidase encoding gene Nox (PcWNox) provided by the present invention is that from Poria plant, clone prepares gained first, the funguses such as Poria are carried out genetic engineering modified by the technology utilizing the present invention, accelerated the speed of growth of poria cocos sclerotium by transgenic, increase its yield simultaneously. Nadph oxidase encoding gene Nox (PcWNox) participates in the formation of poria cocos sclerotium, and the research further that therefore present invention is formed for poria cocos sclerotium provides theoretical foundation with industrialized production.
Accompanying drawing explanation
Fig. 1 is the pcr amplification electrophoretogram of Poria RNA and cDNA clone.
Left figure M1 is the Sclerotia forming initial stage, and M2 is the Sclerotia forming phase, and M3 is the sclerotium period of maturation; Right figure is that PcWNoxPCR expands electrophoretogram.
Fig. 2 is PcWNox functional domain forecast analysis schematic diagram.
Detailed description of the invention
Scheme of the present invention if not otherwise specified, is the conventional scheme of this area, agents useful for same if not otherwise specified, all purchased from biochemical shop.
Embodiment 1:
The order-checking of Poria transcript profile and data analysis
1, sample collecting
Poria sample collection, in Poria planting base, Da Bie Mountain area, takes its sclerotium and is immediately placed in liquid nitrogen after quick-freezing, freezen protective in-80 DEG C of refrigerators.
2, the separation of Poria total serum IgE and detection
Taking Poria (P.cocos) sclerotium sample 0.1g, with the quick grind into powder of liquid nitrogen in mortar, fast transfer, to 1.5ml centrifuge tube, adds 1mlTrizol, mixing, is centrifuged 10 minutes, abandons supernatant after placing 10 minutes; Add 200ul chloroform, shake 15 seconds, place 2-3 minute; 4 DEG C, centrifugal 15 minutes of 12000g, abandon supernatant 400ul and add 600ul isopropanol, place 10 minutes after gently mixing; 4 DEG C, centrifugal 10 minutes of 12000g; Abandon supernatant, 1ml75% ethanol purge; 4 DEG C, centrifugal 5 minutes of 7500g; Abandon supernatant, 1ml75% ethanol purge; Abandoning supernatant, precipitation drying at room temperature was dissolved in 25-30ul distilled water after 10 minutes, detected the integrity of RNA by 1.0% sepharose electrophoresis, measured A260, A280 ratio and concentration with GenQuant nucleic acid quantification instrument. It is placed in-80 DEG C of refrigerators standby.
3, transcript profile order-checking
From total serum IgE, mRNA it is enriched with the magnetic bead of oligo (dT), meet addition fragmentationbuffer and mRNA is broken into short-movie section, with mRNA for template, Article 1 cDNA chain is synthesized with hexabasic base random primer (randomhexamers), it is subsequently adding buffer, dNTPs, RNaseH and DNApolymeraseI synthesizes Article 2 cDNA chain, through QiaQuickPCR kits and by EB buffer solution elution after carry out end reparation, add poly (A) and connect sequence measuring joints, agarose gel electrophoresis separates and selects clip size, pcr amplification builds sequencing library, second filial generation SOlexaHiSeq2000 is utilized to carry out RNA order-checking, and Denovo splicing.
4, candidate gene tentatively sieves
Being annotated by GO, Blast comparison is analyzed and the software analysis such as MEGA5.0 phylogenetic tree construction tentatively finds the candidate gene of Poria nadph oxidase encoding gene.
Embodiment 2:
The clone of Poria PcWNox gene
Analyze candidate gene reading frame scope, with Poria cDNA for template, utilize forward primer P1:5'-ATGGGCGAGAGTTGGTT-3'; Reverse primer P2:5'-TTAGAAGTGTTCCTTTGCGA-3' clones candidate gene full length sequence, is linked on cloning vehicle TOPOTA carrier and is transformed in competent escherichia coli cell E.coliDH5 ��, and step is as follows:
A) from-80 DEG C of ultra cold storage freezers, take 100 �� L competent cell suspensions, thaw and be placed on ice;
B) add 5 �� L and connect product, blow and beat mixing, ice bath 30min with pipettor gently;
C) 42 DEG C of heat shock 90s, put rapidly 5min on ice;
D) in EP pipe, 1mLLB fluid medium (without antibiotic), 37 DEG C of 200rpm45min are added;
E) taking 100 �� L bacterium solution after shaking bacterium to coat containing on antibiotic flat board, 37 DEG C of incubators are overnight;
F) picking list bacterium colony is in 4mL containing in antibiotic LB fluid medium, and 37 DEG C of 200rpm shaken cultivation overnight choose the order-checking of positive colony sample presentation.
So far obtaining Poria nadph oxidase encoding gene Nox, its sequence is shown in SEQIDNO.1.
Embodiment 3:
The bioinformatic analysis of Nox gene
The length of Poria nadph oxidase encoding gene Nox (PcWNox) full-length cDNA that the present invention relates to is 1674bp, its sequence is shown in SEQIDNO.1, wherein opening code-reading frame is positioned at 1-1674bp, and the protein sequence of coding is shown in SEQIDNO.2. Poria full length cDNA sequence blast program is carried out nucleotide homology retrieval in Non-redundantGenBank+EMBL+DDBJ+PDB and Non-redundantGenBankCDStranslation+PDB+Swissprot+Superda te+PIR data base. This gene has typical FNR_likesuperfamily, FAD_binding_8superfamily and NAD_binding_6superfamily domain, such as Fig. 2.
Embodiment 4:
The research of PcWNox gene function
1, the structure of expression vector
According to the ORF of PcWNox full length gene sequence (SEQIDNO.1), the primer of design amplification entire open reading frame, on forward and reverse primer, introduce restriction enzyme site kpnI and salI respectively respectively, utilize forward primer P1:5'-GG TACCATGGGCGAGAGTTGGTT-3'; Reverse primer P2:5'-GTCGACTTAGAAGTGTTCCTTTGCGA-3' carries out PCR reaction, agarose gel electrophoresis, takes a picture after half an hour, observes glue figure, and amplified fragments is 1686bp, TA clone, extracts plasmid. With kpnI and salI enzyme action amplified production 2 hours, utilize and reclaim test kit (Takara company, China) purification digestion products. Utilize kpnI and salI enzyme enzyme action pRS314 carrier 2 hours at 37 DEG C simultaneously, add 5ul bromophenol blue and carry out agarose gel electrophoresis, observe glue figure, and utilize test kit recovery size to be about the fragment of 4758bp.
The two linked enzyme connects overnight at 16 DEG C. Convert escherichia coli DH5a competent cell, the LB flat board containing ampicillin screens recon. The positive bacterial plaque of PCR detection, extracts positive colony plasmid, carries out digestion with restriction enzyme electroresis appraisal, preserves and has the recombiant plasmid pRS314-PcWNox of correct target for expressing conversion. This expression vector called after pRS314-PcWNox.
2, the abduction delivering of albumen
With pRS314-PcWNox Plastid transformation Partial digestion yeast host bacterium AB1380, screen positive yeast after cultivating 5 days in the 2ml USM culture medium containing 2% glucose, after 4-5 days in picking monoclonal 2mlUSM fluid medium, 30 DEG C of violent concussion overnight incubation. 5000rpm is centrifugal cultivates 5min, abandons supernatant, dilutes 20 times with the USM fluid medium containing 2% glucose, and 24h is cultivated in 30 DEG C of violent concussions. Extract and cultivate total protein of cell. Choose high expressed transformant, after the violent concussion cultivation 20h of the 50ml USM fluid medium 30 DEG C containing 2% glucose, to be inoculated into the violent concussion of the 1L USM fluid medium without glucose 30 DEG C and to cultivate 40h, to reclaim thalline, separating particles body, purifying protein.
3, enzymatic reaction is identified
Detect the peroxide of its generation by the method for NBT dyeing fungal mycelia, peroxide can form navy blue water-fast first a ceremonial jade-ladle, used in libation with NBT reaction. Intracellular H is detected with DAB dyeing fungal mycelia2O2, xylenol orange can make Fe in acid condition2+Become Fe3+, between absorbance 540 to 620nm, produce purple dot, detect hydrogen peroxide with this further. In order to detect and quantitative intracellular H2O2, fungal mycelia is cultivated 3 days on cellophane agar complete medium, takes the fresh mycelia of 1g, adds liquid nitrogen grinding, adds 3mL phosphate buffer (100mM, pH7.0) and suspend in ground sample. Suspension protein example (50mL) is added in 500mL reaction system: (250mM) Ferrous ammonium sulfate, 25mm sulphuric acid, 100mM Sorbitol, 125mM xylenol orange) react 15min. Then H in solution is detected at 595nm place2O2Content, extracellular H2O2Content measures its absorbance at 240nm place. Fungal mycelia is placed in liquid complete medium and cultivates 3 days, detect H with spectrophotometer again2O2Content. H is calculated with the data Criterion curve announced2O2Concentration, use H2DCFDA method measures ROS.
Result shows, in the Sclerotia forming stage, the expression of NADPHoxidase gene significantly rises, and superoxide dismutase and catalatic activity are also all significantly raised, can observe H around hyphal cell wall and cell membrane2O2Accumulation.
Embodiment 5:
Nox gene is being accelerated poria cocos sclerotium formation and/or is being increased the application in sclerotium yield, and its process is as follows:
By the ordinary skill in the art, Poria Nox gene (shown in SEQIDNO.1) is proceeded in Poria protoplasm, obtain the protoplast of process LAN Poria Nox gene, then carry out inoculation and the cultivation of Poria in the usual way, the transgenic Poria of high yield poria cocos sclerotium can be obtained.
The acceptor material Poria of the present embodiment picks up from Poria planting base, Da Bie Mountain area.
1. the structure of expression vector
According to the ORF of PcWNox full length gene cDNA sequence (SEQIDNO.1), the both forward and reverse directions primer in amplification coding district introduces restriction enzyme digestion sites ApaI and XBaI, forward primer sequence: 5'-GGGCCCATGGGCGAGAGTTGGTT-3'; Reverse primer sequences: 5'-TCTAGATTAGAAGTGTTCCTTTGCGA-3'. With Poria (Wolfiporiacocos) full-length cDNA fragment for template, through pcr amplification, carrying out agarose gel electrophoresis, amplified fragments is approximately 1080bp. With ApaI and XBaI37 DEG C of enzyme action amplified production 3h, utilize and reclaim test kit (Takara company, China) purification digestion products, and digestion products is connected on overexpression vector pEXP3300 (this carrier is with pCAMBIA3300 for template, the CaMV35S promoter on original vector is substituted with the promoter (NCBIAccession:DQ404345.1) of the phosphate dehydrogenase gene of Ganoderma, and by the hygromycin hygromycin gene clone of screening to this carrier).Pcr amplification testing goal fragment, carries out enzyme action and sequence verification, preserves and has the recombiant plasmid of correct target for expressing conversion. This expression vector called after pEXP-PcWNox.
Prepared by 2 Poria protoplasts:
(1) loading 100mlPDB fluid medium in 250ml triangular flask, access Poria mycelia fragment, in 28 DEG C, 150rmp shakes training 2-3 days;
(2) mycelia is collected by filtration with three layers sterilizing lens paper, mycelia is rinsed to bulk again with 0.6M mannitol solution, go in the 50ml centrifuge tube of sterilizing, (1g lywallzyme is dissolved in the 0.6M mannitol solution of 50ml to add lywallzyme solution, the lywallzyme solution adding 1ml according to every g mycelia calculates), in 30 DEG C, 80rmp enzymolysis 2.5-3 hour;
(3) filter through three layers sterilizing lens paper after enzymolysis, repeatedly rinse with 0.6M mannitol solution, collect filtrate, in 4 DEG C, centrifugal 15 minutes of 3000rmp (or not filtering directly centrifugal); Abandon supernatant, precipitation 5mlMTC (0.6M mannitol; 10mMTris-HCl, pH7.5; 50mM calcium chloride) solution is resuspended;
(4) 4 DEG C, centrifugal 15 minutes of 3000rmp, the precipitation obtained is protoplast; With 300ulMTC solution, protoplast is dissolved and microscopy protoplast number, protoplast concentration is adjusted to 1 �� 108Individual/ml, namely can be used for converting (adding DMSO in the protoplast prepared, the concentration making DMSO is 10%, can in-80 DEG C long-term preservations after mixing).
The protoplast transformation of 3PEG mediation:
(1) being dispensed into by protoplast in the 50ml centrifuge tube of sterilizing, often pipe is 150ul. Add overexpression vector pEXP-PcWNox (adding 2ug plasmid according to often pipe to calculate), supply MTC to often pipe 300ul, place 20 minutes on ice;
(2) 2mlPTC (60%PEG3350 or PEG4000,10mMTris-HCl, pH7.5 it are added dropwise over; 50mM calcium chloride) solution, stand 20 minutes on ice;
(3) often pipe adds MTC (the 0.6M mannitol of 30ml pre-cooling; 10mMTris-HCl, pH7.5; 50mM calcium chloride), mixing, 3000rmp, 4 DEG C are centrifuged 15 minutes;
(4) abandoning supernatant, often pipe adds 3ml liquid regeneration culture medium, 28 DEG C of quiescent culture 2-3 days;
(5) culture is poured in culture dish, add the solid regenerated culture medium of about 10ml (being cooled to about 50 DEG C), mixing. after its solidification, repave the solid regenerated culture medium (hygromycin containing 20ug/ml) of about 10ml above, the upgrowth situation of Poria is observed after 3-4 days, the bacterium colony that can grow is transformant, transformant is carried out quantitative fluorescent PCR, primer P1:5'-ATGGGCGAGAGTTGGTT-3', P2:5'-TTAGAAGTGTTCCTTTGCGA-3', with Poria 18SrRNA gene for internal reference (Pr1:5'-GCCGTTCTTAGTTCGTGGAT-3', Pr2:5'-TCGCTGGCTCTGTCAGTGTAG-3'), amplification program is: 95 DEG C of denaturation 10min, 95 DEG C of degeneration 30s, 55 DEG C of annealing 30s, 72 DEG C extend 30s, 40 circulations. . test result indicate that, in the transformant obtained, compared with the wild type Poria of non-transgenic, the expression of Nox gene significantly raises.
Liquid regeneration culture medium: 200g Rhizoma Solani tuber osi in every L culture medium, 20g glucose, 1g peptone, 1g yeast, 0.6M mannitol.
Solid regenerated culture medium: 200g Rhizoma Solani tuber osi in every L culture medium, 20g glucose, 1g peptone, 1g yeast, 0.6M manna; Every 200ml adds 2g agar.
The transformant grown is inoculated in Masson Pine culture medium, observes its sclerotium growing state.
The conventional method that the inoculation of 4 Poria and cultivation are this area, specific as follows:
Little Masson Pine section sheet bottling (plastics) sterilization, adds appropriate culture medium PDB, connects the mycelia that protoplast is formed, and grows the mycelia that white is vigorous in bottle, has the Masson Pine section sheet of mycelia to take out with tweezers by long in bottle, is inoculated on Masson Pine and cultivates. 3 experimental grouies are set. As a control group by the Poria mycelia without pEXP-PcWNox carrier, it is inoculated on Masson Pine and cultivates simultaneously. 3 matched groups are set.
Result: 3 matched group Sclerotia forming time averages are 90 days. The Sclerotia forming time of 3 experimental grouies substantially shortens, average out to 60 days. After 6 months, the sclerotium weight of 3 experimental grouies is 2 times of matched group weight.
PDB culture medium: 200g Rhizoma Solani tuber osi in every L culture medium, 20g glucose, 1g peptone, 1g yeast.
SEQUENCELISTING
<110>Zhu hears monarch Zhao's little dragon Tao Yang's soup and enters old sheet and continue the long tinkling of pieces of jade Deng Chen of roc Zhang Xifeng Lee Wang Qi
<120>a kind of Poria nadph oxidase encoding gene Nox and application thereof
<130>a kind of Poria nadph oxidase encoding gene Nox and application thereof
<160>2
<170>PatentInversion3.1
<210>1
<211>1674
<212>DNA
<213>Poria (Poriacocos (Schw.) Wolf)
<400>1
atgggcgagagttggttccgacgcgagttcctgaccccccggcgggcagtcttcaatgtc60
ctcttctatggcctgcagctggccttctttgcttatgggtggtgggcgcaggaaacgaac120
aagaaattgtctgctctcaatgcgctcaagtggtctgtctgggtgtctcgtggtgctggt180
cttgtcctggcgttcctcgctggctgcatgctcttgcccatgttgcgcaatgtaattcgc240
gtcatccgcccgaaagtggccttcctctttccggcggacgagaacatctggttccacaga300
caggccgcgtacgcgatggcgttctggtccatggtgcatgccaccgctcactatgtaaat360
ttctacaatgtcgagcgcacacaggtccggccggagttcgcgctcgacgtccactacaca420
caggcgggcggcatcactggacacttcatgctcctgatcatggtcctcatgtacacaacc480
gcccaccacaagatccgccaccagtgcttcgaggcattctggtacacgcaccaccttgca540
ttcttcttcttcatcgcgctgtggacccacgccgacgggtgcttcgtgcgcgacagtact600
ggacctgcttacacggacacattcccgttctacgacccaaagttctgcttgggctatgag660
agctggcgcttcactatctggccgggcatcgcgtacttcttcgaacgcgtctggagggag720
atcagggctagaagggcaaccagattgtcgaaggtcttggtgcacccaagcggtgccatg780
gagctgcgtatcgtcaagcccagcttcaaatatgttgccggacagtggctgttcatccaa840
atccctgaagtctcgcgttaccagtggcacccgttcaccatcacgtcagcgccagaggac900
ccgtacgtctcggtccatatccgtcaagttggtgattggacatacgcgctgggcgaccgc960
atcggtgcgggaccctctgtggtgtctgctatgactaaggcggctatggctggcgcggag1020
aaggacgactccatctacggcatgcgtggcgacttcgtcgaggtcgacacgtccgtacgc1080
tcgctgcctgaggtccgcatcgacggtccctacggtgcgccggccgaggatgtcttcaac1140
gtcgaggtcgctgtgctggttggggctggtattggtgtcactcctttcgcctccatcctc1200
aagcacatctggtaccgccagaagaagggtgcccttcagtccctcaagcgcgtcgagttc1260
ttctgggtctgccgtgacgcgccgtctttcggttggttccagacactactgcaggaagtc1320
gaggccgcccaggtcgatcccaacttcctgcgcattaacatctacctcacccagaaggtg1380
aacgaagacatgatgtggaacatcgcggtcaacgacgccggtgcagagtacgacccattg1440
actctgctccgcacgcgcaccatgttcggccgtccggactggcagggtatctacgctcgc1500
atgaggcaagcgattgaggttggtcagtacctgcccggtatcaacgagcagctcaagacc1560
accgtcgggacttatttctgtggacctcctgtcctcgggagggccatccatgaggcgtgc1620
aaggaaaacactaccgccaacattaacttcaccttcgcaaaggaacacttctaa1674
<210>2
<211>557
<212>PRT
<213>Poria (Poriacocos (Schw.) Wolf)
<400>2
MetGlyGluSerTrpPheArgArgGluPheLeuThrProArgArgAla
151015
ValPheAsnValLeuPheTyrGlyLeuGlnLeuAlaPhePheAlaTyr
202530
GlyTrpTrpAlaGlnGluThrAsnLysLysLeuSerAlaLeuAsnAla
354045
LeuLysTrpSerValTrpValSerArgGlyAlaGlyLeuValLeuAla
505560
PheLeuAlaGlyCysMetLeuLeuProMetLeuArgAsnValIleArg
65707580
ValIleArgProLysValAlaPheLeuPheProAlaAspGluAsnIle
859095
TrpPheHisArgGlnAlaAlaTyrAlaMetAlaPheTrpSerMetVal
100105110
HisAlaThrAlaHisTyrValAsnPheTyrAsnValGluArgThrGln
115120125
ValArgProGluPheAlaLeuAspValHisTyrThrGlnAlaGlyGly
130135140
IleThrGlyHisPheMetLeuLeuIleMetValLeuMetTyrThrThr
145150155160
AlaHisHisLysIleArgHisGlnCysPheGluAlaPheTrpTyrThr
165170175
HisHisLeuAlaPhePhePhePheIleAlaLeuTrpThrHisAlaAsp
180185190
GlyCysPheValArgAspSerThrGlyProAlaTyrThrAspThrPhe
195200205
ProPheTyrAspProLysPheCysLeuGlyTyrGluSerTrpArgPhe
210215220
ThrIleTrpProGlyIleAlaTyrPhePheGluArgValTrpArgGlu
225230235240
IleArgAlaArgArgAlaThrArgLeuSerLysValLeuValHisPro
245250255
SerGlyAlaMetGluLeuArgIleValLysProSerPheLysTyrVal
260265270
AlaGlyGlnTrpLeuPheIleGlnIleProGluValSerArgTyrGln
275280285
TrpHisProPheThrIleThrSerAlaProGluAspProTyrValSer
290295300
ValHisIleArgGlnValGlyAspTrpThrTyrAlaLeuGlyAspArg
305310315320
IleGlyAlaGlyProSerValValSerAlaMetThrLysAlaAlaMet
325330335
AlaGlyAlaGluLysAspAspSerIleTyrGlyMetArgGlyAspPhe
340345350
ValGluValAspThrSerValArgSerLeuProGluValArgIleAsp
355360365
GlyProTyrGlyAlaProAlaGluAspValPheAsnValGluValAla
370375380
ValLeuValGlyAlaGlyIleGlyValThrProPheAlaSerIleLeu
385390395400
LysHisIleTrpTyrArgGlnLysLysGlyAlaLeuGlnSerLeuLys
405410415
ArgValGluPhePheTrpValCysArgAspAlaProSerPheGlyTrp
420425430
PheGlnThrLeuLeuGlnGluValGluAlaAlaGlnValAspProAsn
435440445
PheLeuArgIleAsnIleTyrLeuThrGlnLysValAsnGluAspMet
450455460
MetTrpAsnIleAlaValAsnAspAlaGlyAlaGluTyrAspProLeu
465470475480
ThrLeuLeuArgThrArgThrMetPheGlyArgProAspTrpGlnGly
485490495
IleTyrAlaArgMetArgGlnAlaIleGluValGlyGlnTyrLeuPro
500505510
GlyIleAsnGluGlnLeuLysThrThrValGlyThrTyrPheCysGly
515520525
ProProValLeuGlyArgAlaIleHisGluAlaCysLysGluAsnThr
530535540
ThrAlaAsnIleAsnPheThrPheAlaLysGluHisPhe
545550555
Claims (8)
1. the protein separated, its sequence is shown in SEQIDNO.2.
2. the nucleotide sequence of protein described in coding claim 1.
3. nucleotide sequence according to claim 2, its sequence is shown in SEQIDNO.1.
4. contain the carrier of nucleotide described in claim 2.
5. contain the Poria protoplast of carrier described in claim 4.
6. the protein described in claim 1 or the application in improving poria cocos sclerotium yield of the nucleotide described in claim 2.
7. the protein described in claim 1 or the nucleotide described in claim 2 are in the application accelerated during poria cocos sclerotium is formed.
8. the protein described in claim 1 or the nucleotide described in claim 2 improve poria cocos sclerotium yield and the application accelerated during poria cocos sclerotium is formed at the same time.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410487383.XA CN104232598B (en) | 2014-09-22 | 2014-09-22 | A kind of Poria nadph oxidase encoding gene Nox and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410487383.XA CN104232598B (en) | 2014-09-22 | 2014-09-22 | A kind of Poria nadph oxidase encoding gene Nox and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104232598A CN104232598A (en) | 2014-12-24 |
| CN104232598B true CN104232598B (en) | 2016-06-08 |
Family
ID=52221500
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410487383.XA Expired - Fee Related CN104232598B (en) | 2014-09-22 | 2014-09-22 | A kind of Poria nadph oxidase encoding gene Nox and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104232598B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106244614B (en) * | 2016-08-20 | 2018-01-12 | 南京农业大学 | The structure of Trichoderma harzianum engineered strain with strong parasitic broad-spectrum fungi and its application |
-
2014
- 2014-09-22 CN CN201410487383.XA patent/CN104232598B/en not_active Expired - Fee Related
Non-Patent Citations (4)
| Title |
|---|
| Bedard K等.The NOX family of ROS-generating NADPH oxidases: physiology and pathophysiology.《Physiol Rev.》.2007,第87卷(第1期),245-313. * |
| Characterization and antioxidant activities of degraded polysaccharides from Poria cocos sclerotium;Jin Tang等;《Carbohydr Polym》;20140124;121-6 * |
| Reactive oxygen species and development in microbial eukaryotes;Aguirre J等;《Trends Microbiol.》;20050331;第13卷(第3期);111-8 * |
| 马亚男.Rhizoctonia spp.菌核分化不同阶段活性氧代谢及相关酶变化.《中国优秀硕士学位论文全文数据库 农业科技辑》.2011,全文. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104232598A (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN114107340B (en) | Mevalonate kinase gene RKMK and application thereof | |
| CN109628467A (en) | A kind of Chunlan CgWRKY2 gene and its application | |
| CN107541520A (en) | OsSAUR11 genes related to rice root development and resistance and encoding proteins and application | |
| CN106868021A (en) | Control rice paddy seed size gene OsNAC1 and its application | |
| Li et al. | The Rubisco activase (rca) gene is located downstream from rbcS in Anabaena sp. strain CA and is detected in other Anabaena/Nostoc strains | |
| CN110358776A (en) | A kind of Rhizoctonia solani Kuhn pathogenic related gene and its application | |
| CN104140971B (en) | Rice Os MADS27 gene is in the application promoting in the growth of system of taproot plant lateral roots | |
| CN104232598B (en) | A kind of Poria nadph oxidase encoding gene Nox and application thereof | |
| CN108588098A (en) | Eucalyptus urophylla CAD genes and its application | |
| CN109337884B (en) | Pyruvate kinase gene and application thereof | |
| CN108220305A (en) | Tobacco amino acid permease NtAAP2 genes and its application | |
| CN105400800B (en) | A kind of soybean E3 ubiquitin ligase genes GmPUB2 of regulation and control flowering of plant application | |
| CN109517831A (en) | It is a kind of from the chalcone enzyme gene of anoectochilus formosanus and its application | |
| CN109371037A (en) | Tobacco AKT1 gene and application | |
| CN104293758B (en) | A kind of Panax Japonicus Var. Major β armomadendrins synthase gene and its application | |
| CN114573669B (en) | Application of protein Ghd7 in regulating and controlling low nitrogen resistance of plant | |
| CN108424919A (en) | The research and application of transporter gene PbrALMT9 regulation and control pear flesh malic acid contents | |
| CN104195120B (en) | Poria cocos MAPK protein coding gene Smk1 and application thereof | |
| CN107723308B (en) | Biosynthesis method and gene cluster of compound balanol | |
| CN112048516A (en) | Pear proton pump gene PbrVHA-c4 and application thereof in regulation of citric acid content in pulp | |
| CN110305893A (en) | Gossypol biosynthesis pathway is because of CYP71BE79 and its application | |
| CN109628468A (en) | A kind of Chunlan CgWRKY53 gene and its application | |
| CN109355270A (en) | A kind of rice kinases OSK1 and its application | |
| CN109553666A (en) | A kind of potassium transport protein KUP9 and its encoding gene and application from tobacco | |
| CN109553667B (en) | Tobacco KUP2 gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160608 Termination date: 20190922 |