CN108220305A - Tobacco amino acid permease NtAAP2 genes and its application - Google Patents
Tobacco amino acid permease NtAAP2 genes and its application Download PDFInfo
- Publication number
- CN108220305A CN108220305A CN201711351625.2A CN201711351625A CN108220305A CN 108220305 A CN108220305 A CN 108220305A CN 201711351625 A CN201711351625 A CN 201711351625A CN 108220305 A CN108220305 A CN 108220305A
- Authority
- CN
- China
- Prior art keywords
- tobacco
- amino acid
- ntaap2
- gene
- genes
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8251—Amino acid content, e.g. synthetic storage proteins, altering amino acid biosynthesis
Abstract
The invention belongs to field of plant genetic, and in particular to a tobacco amino acid permease NtAAP2 gene and its patent application applied in terms of amino acid content in tobacco is regulated and controled.The gene includes 1539 bases, and specific base sequence is as shown in SEQ ID NO.1.The amino acid permease of the coded by said gene, including 512 amino acid, specific amino acid sequence is as shown in SEQ ID NO.2.The gene is related to tobacco amino acid content, also related to tobacco plant height.Inventor to tobacco amino acid permease NtAAP2 genes respectively by carrying out overexpression and gene silencing, by to tobacco growing developmental state and amino acid content case study in the case of NtAAP2 gene variable expressions, it is found that the plant height of the gene and plant and amino acids in plants content are highly relevant.Can be that certain theoretical foundation is established in amino acid content adjustment in the adjustment of tobacco plant type and tobacco leaf based on this correlation.
Description
Technical field
The invention belongs to field of plant genetic, and in particular to a tobacco amino acid permease NtAAP2 gene
And its patent application applied in terms of amino acid content in tobacco is regulated and controled.
Background technology
Nitrogen（N）It is one of necessary chemical element for forming nucleic acid, protein, phosphatide, while nitrogen also participates in enzyme
And the structure of coenzyme and prothetic group, plant hormone and chlorophyll etc., it is one of a great number of elements necessary to growth and development of plants.It plants
In object growth course, absorbed from the soil liquid by root inorganic nitrogen-sourced：Nitrate nitrogen（NO3-）And ammonium nitrogen（NH4+）, with this
As nitrogen source.In addition to this, part organic nitrogen source such as amino acid can also be directly absorbed and utilized by plant from soil.
Amino acid has plant growth as organonitrogen compound important in plant, synthesis and its metabolism important
Effect.With regard to plant growth itself, the supply degree of amino acid can directly affect the content of plant vivo protein, and amino
Absorption, the transhipment of acid, then need the assistance by multiple transport proteins on plant cell membrane, through xylem-bast most again
Zhongdao realizes the physiological function of amino acid up to " library " tissues such as flower, seeds.
In existing research, arabidopsis AAP2 genes have participation in the entire transport pathway of plant vivo acid, ginseng
With transport of the amino acid between xylem and bast, N sources are provided for library tissue.Research shows thatataap2Mutant
Blade in 14C contents increase, and 14C and bast amino acid content are reduced in the tissue silique of library, eventually lead to library tissue
C N balance change, and then affect the growth and development of seed.
It is existing research shows that, plant amino acid metabolism it is closely related with glycolytic cycle, at the beginning of most of amino acid are plant
Raw and secondary metabolism hinge, and the metabolite of amino acid is then a variety of including nucleic acid, alkaloid, chlorophyll, polyphenol, esters etc.
Material composition.For tobacco is cultivated, the amino acid in tobacco can not only influence the growth and development of plant, free ammonia in tobacco leaf
There is also highlights correlations between the content of base acid and Flue-cured tobacco Quality and flavor.Therefore with regard to shifting or being metabolized phase in tobacco with amino acid
Correlation gene strengthens research, has highly important theoretical and application value.
Invention content
Present invention aims at a tobacco amino acid permease NtAAP2 gene is provided, ground by the clone to the gene
Study carefully, can be that certain theory and application foundation are established in tobacco improvement and new product of tobacco cultivation.
Details are as follows for the technical solution that the application is taken.
One tobacco amino acid permease NtAAP2 gene, including 1539 bases, specific base sequence such as SEQ ID
Shown in NO.1.
The amino acid permease of tobacco amino acid permease NtAAP2 coded by said gene, including 512 amino acid, specific ammonia
Base acid sequence is as shown in SEQ ID NO.2.
The tobacco amino acid permease NtAAP2 genes are related to tobacco amino acid content；Specifically, tobacco amino
Sour permease NtAAP2 genes can improve amino acid content in tobacco after expressing, being translated as amino acid permease；Further and
Speech, after NtAAP2 genes are overexpressed, can improve the content of the amino acid such as Glu, Gln, Asp, Asn in tobacco plant；And pressing down
After NtAAP2 gene expressions processed, the content of the amino acid such as Glu, Gln, Asp, Asn in tobacco plant can be reduced.
The tobacco amino acid permease NtAAP2 genes are also related to tobacco plant height；Specifically, being overexpressed
After NtAAP2 genes, tobacco plant height can be increased, and after NtAAP2 gene expressions are inhibited, tobacco plant height can be reduced.
Using the overexpression vector constructed by the tobacco amino acid permease NtAAP2 genes, by tobacco amino acid permeability
The base sequence of enzyme NtAAP2 genes is inserted into the expression vector containing 35S promoter built-up；It is described to start containing 35S
The expression vector of son, specifically such as Super pCAMBIA1300 plasmid vectors.
For the rna interference vector constructed by the tobacco amino acid permease NtAAP2 genes, specificity is interfered into sequence
Row be inserted into positive and negative both direction it is built-up in plant expression vector, it is described specificity interference sequence base sequence such as
Shown in SEQ ID NO.3.
A kind of method for cultivating genetically modified plants new varieties will contain constructed by tobacco amino acid permease NtAAP2 genes
Overexpression vector or the rna interference vector constructed by for the tobacco amino acid permease NtAAP2 genes, pass through gene
Engineering technology converts plant, and screening obtains genetically modified plants new varieties.
Amino acid has plant growth as organonitrogen compound important in plant, synthesis and its metabolism important
Effect, the amino acid in tobacco can not only influence the growth and development of plant, the content of free amino acid and flue-cured tobacco product in tobacco leaf
There are certain correlativities between matter and flavor.
On the basis of a large amount of early-stage studies, clone obtains tobacco amino acid permease to inventor from Nicotiana tabacum for the first time
NtAAP2 coding sequences are the function of more fully understanding the gene, and inventor is respectively by building overexpression vector
With RNA interference (RNA interference, RNAi) technology, excess has been carried out to tobacco amino acid permease NtAAP2 genes
Expression（Overexpression, OE）And gene silencing, by sending out tobacco growing in the case of NtAAP2 gene variable expressions
Situation and amino acid content case study are educated, it can be found that the gene and the plant height of plant and amino acids in plants content height phase
It closes.Can be that certain theoretical foundation is established in amino acid content adjustment in the adjustment of tobacco plant type and tobacco leaf, simultaneously based on this correlation
Also it is to cultivate transgene tobacco new varieties using technique for gene engineering to establish theoretical and application foundation.
Description of the drawings
Fig. 1 is each organoid of full-bloom stage in quantitative analysis Nicotiana tabacum：Root, stem, leaf, the transcription table for spending middle NtAAP2 genes
Expression patterns；
Fig. 2 for T1 for RNA interference of transgene positive tobacco plant silencing efficiencies, NtAAP2-RNAi lines represent transgenosis cigarette
The different strains of grass（One transfer-gen plant represents a strain）Gene expression dose, K326 represents non-transgenic opposite
Tobacco；
Fig. 3 is overexpressed transgenic positive tobacco plant silencing efficiency for T1 generations, and NtAAP2-OE lines represent transgene tobacco
Different strains（One transfer-gen plant represents a strain）Gene expression dose, SP1300-Flag representative turns empty carrier
Tobacco, K326 represent non-transgenic opposite tobacco；
Fig. 4 is NtAAP2 transgenic phenotypes, and K326 is the non-non-transgenic control lines of tobacco, and OE is overexpressed for NtAAP2-OE to plant
Strain, RNAi are NtAAP2-RNAi transfer-gen plants；
Fig. 5 is phenotype of the NtAAP2 transgenosis under low N stress, and A represents NtAAP2-RNAi transfer-gen plants, and B is represented
NtAAP2-OE is overexpressed plant；
Fig. 6 is amino acid content in NtAAP2-RNAi transgenic lines, and K326 is non-non-transgenic control lines NtAAP2-RNAi
For NtAAP2-RNAi transfer-gen plants；
Fig. 7 is amino acid content in NtAAP2-OE transgenic lines, and K326 is for non-non-transgenic control lines NtAAP2-OE
NtAAP2-OE transfer-gen plants.
Specific embodiment
Explanation is further explained to the application with reference to embodiment, before specific embodiment is introduced, with regard to following realities
The briefly introduction of the basic conditions such as part biological material, experiment reagent, experimental facilities involved in example is applied to be described as follows.
Biomaterial：
Tobacco：Tobacco K326, a kind of common tobacco material；
Carrier：Super pCAMBIA1300, pHellsgate2 carriers commonly use plasmid vector in molecular biology, can be by open
Channel obtains；
Coli strain, purchased from Gene Answer；
Primer sequence synthesizes and gene sequencing work, and completion is provided by Shanghai Sheng Gong bioengineering Co., Ltd；
Experiment reagent：
RNA extracts kits, DNA extraction kit, plastic recovery kit, reverse transcription reagent box are purchased from Gene Answer；
Experimental facilities：
Gel-electrophoretic apparatus（Bio-Rad）, PCR instrument（Tprofessional）, liquid-transfering gun（Eppendorf）, UVP gel imagings system
System（GelDoc-It310）, it is apparatus ＆ equipment in common use in molecular biology experiment.
Embodiment 1
On the basis of early-stage study, DNAMAN Software for Design upstream and downstream primers, using Nicotiana tabacum stalk cDNA as template, profit are utilized
With round pcr, clone obtains NtAAP2 genes.The present embodiment is only obtained with regard to the clone of tobacco amino acid permease NtAAP2 genes
The process of obtaining is briefly discussed below.
（One）Primer is designed, and prepares cDNA templates：
Specific PCR amplification is designed as follows with primer sequence：
AAP2-F：5'-ATGTTGCCAAGGAGTCGAACTCTTC-3',
AAP2-R：5'-TTAGTAAA TAGTCTT GAAAGGCTTAT-3'；
Using full-bloom stage tobacco stalk as sample, RNA is extracted（It is carried with reference to Gene AnswerRNA extracts kit specifications
It takes）, and reference inversion record kit（Gene Answer）Specification, extracted RNA reverse transcriptions is spare for cDNA；
（Two）PCR amplification
With step（1）In prepared cDNA be template, carry out PCR amplification using designed primer, 50 μ L reactants during PCR amplification
System's design is as follows：
CDNA, 2 μ L；
Primer AAP2-F, 2.5 μ L；
Primer AAP2-R, 2.5 μ L；
DNTP, 4 μ L (10 μM)；
10 × Buffer, 5 μ L；
HiFi ase (Beijing Quanshijin Biotechnology Co., Ltd), 0.5 μ L；
ddH2O, 33.5 μ L；
PCR reaction conditions are：94℃、3 min；94 DEG C, 30 s, 55 DEG C, 30 s, 72 DEG C, 2 min, 35 cycles；72℃、10
min。
Electrophoresis in 1% Ago-Gel is carried out to pcr amplification product, AL2000 DNA Maker, 160V electricity are selected during electrophoresis
About 20 min of swimming is depressed, is then observed under ultraviolet scanner, cuts glue and with DNA plastic recovery kits (Gene Answer)
Recycle PCR product（Target DNA fragment）, subsequent experimental operation is saved backup or directly carried out for -20 DEG C after measured concentration.
（Three）It is sequenced and analyzes NtAAP2 genes
With reference to pBLUE-T carriers rapid ligation kit (Gene Answer) specification, by step（Two）Middle recycled PCR expands
Volume increase object is attached with pBLUE-T carriers, and the design of 10 μ L linked systems is as follows：
2 × Quick Ligation Buffer, 5 μ L；
PBLUE-T Vector, 1 μ L；
T4 DNA Ligation, 1 μ L；
PCR product, 3 μ L；
22 DEG C of 10 min of connection；
It will connect heat-shock transformed (the 42 DEG C, 90s) competent escherichia coli cell of liquid, after picking positive clone identification, further expand
Increase and cultivate and extract plasmid, sequencing obtains the base sequence of tobacco amino acid permease NtAAP2 genes.
Sequencing result shows：Tobacco amino acid permease NtAAP2 genes, including 1539 bases, specific base sequence is such as
Shown in SEQ ID NO.1；
To the base sequence analysis, the results showed that：Tobacco amino acid permease NtAAP2 coded by said gene amino acid permease packets
512 amino acid are included, specific amino acid sequence is as shown in SEQ ID NO.2.
Embodiment 2
By means of real-time fluorescence quantitative PCR (BIO-RAD, USA) technology, the present embodiment is saturating to tobacco amino acid in tobacco plant
The expression pattern of property enzyme NtAAP2 genes has carried out preliminary analysis, and related experiment is briefly discussed below.
（One）Primer is designed, and prepares the cDNA template samples of different tissues sample；
When real-time fluorescence quantitative PCR is analyzed, using 26S as reference gene, specific primer sequences design is as follows：
AAP2-Q-F：5'-CCTGCCAGAATAAACCATGGT-3',
AAP2-Q-R：5'-GCTGTGATTATATGTGATGTTGC-3'；
26S-F：5'-GAAGAAGGTCCCAAGGGTTC-3'；
26S-R：5'-TCTCCCTTTAACACCAACGG-3'；
Respectively using root, stem, flower and the blade of the big gold dollar full-bloom stage of safflower as sample, it is cDNA to extract RNA and reverse transcription respectively
It is spare as template sample；
（Two）Fluorescence quantitative PCR detection；
During quantitative fluorescent PCR, the design of 20 μ L reaction systems is as follows：
CDNA, 4 μ L（40ng/μL）；
Upstream and downstream primer, each 1 μ L；
SYBR Green, 10 μ L；
ddH2O, 4 μ L.
The results are shown in Figure 1 for fluorogenic quantitative detection.Analysis can be seen that NtAAP2 genes in Nicotiana tabacum K326 full-bloom stages
Stem and root in high expression, especially expression quantity is higher in stem, it can be seen that NtAAP2 gene pairs amino acid is in tobacco stem
The loading of bast plays an important roll.
Embodiment 3
Further to study NtAAP2 genes and amino acid content relationship in tobacco plant, by means of RNAi interference techniques, invention
People has carried out silence, and construct transfer-gen plant to NtAAP2 genes in tobacco.Major technique operates thinking：It builds first
For the rna interference vector of NtAAP2 genes；Then the interference carrier is converted into Agrobacterium；Turned using agriculture bacillus mediated heredity
Change technical transform tobacco, card that gene resistance screening is carried out to transformation of tobacco, screening obtains positive transgenic tobacco, continues to cultivate
To bearing seeds；By the row plantation again of obtained seed（T1 is for cigarette strain）, and to NtAAP2 gene transcript expressions feelings in transfer-gen plant
Condition and amino acid metabolite situation are analyzed.Specific experiment process is described as follows.
（One）Primer is designed, using Gateway BP recombinant techniques, is attached most importance to group objects with pHellsgate2 carriers, structure
The RNAi carrier of transformation of tobacco；
Specific primer sequence design is as follows：
NtAAP2-F：5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGAGATTTCCTGGAGCATCATCT- 3',
Wherein GGGGACAAGTTTGTACAAAAAAGCAGGCT partial sequences in 5' ends are attB1 connectors,
NtAAP2-R：GGGGACCACTTTGTACAAGAAAGCTGGGTCTCTACTGTTGGTCTTGTTCTTGG；
Wherein GGGGACCACTTTGTACAAGAAAGCTGGGT partial sequences in 5' ends are attB2 connectors；
The NtAAP2-T plasmids obtained in correct embodiment 1 are sequenced as template, PCR amplification is carried out, amplified production is cut
Glue, recovery purifying obtain NtAAP2-RNAi target fragments.
Then Gateway BP recombinations are carried out, reaction system design is as follows：
AAP2-RNAi target fragments, 4 μ L；
PHellsgate2,0.5 μ L；
TE Buffer, 3.5 μ L；
BP Clonase II enzyme, 2 μ L；
2 h are reacted in 25 DEG C of constant incubators, add the K albumen of 1 μ L, 37 DEG C of 10 min of reaction are reacted with terminating.
10 μ L connections liquid is taken to convert bacillus coli DH 5 alpha competent cell, 150 μ L transformed bacteria solutions is taken to be coated on after culture and are contained
There are 50 μ g/mL spectinomycins（Spe）On the LB plates of resistance, it is inverted to be incubated overnight for 37 DEG C and is screened；
Picking single bacterium colony carries out bacterium colony PCR verifications, obtained positive bacteria；
Positive bacteria is expanded and is cultivated, and extracts plasmid and carries out digestion verification, after confirming correctly, obtains pHellsgate2-
NtAAP2-RNAi plasmids.
（Two）By step（One）In RNAi carrier（PHellsgate2-NtAAP2-RNAi plasmids）Convert Agrobacterium；
Using electric shocking method conversion method, the pHellsgate2-NtAAP2-RNAi positive recombinant plasmids built are converted into Agrobacterium
GV3101, and the correct bacterial strain of conversion is screened, detailed process is：
Agrobacterium GV3101 competent cells is taken to be put into 10 min of freeze thawing on ice；
Add 1 μ L recombinant plasmid dnas（PHellsgate2-NtAAP2-RNAi plasmids）It is thin to be added to 100 μ L Agrobacterium competence
In born of the same parents, and with pipette tips gently mixing；
The mixture of Agrobacterium competence and recombinant plasmid is transferred in -20 DEG C of pretreated electric shock cups, in 2200 v high
Pressure electric shock；
It takes out electric shock cup and adds in the LB culture mediums of 890 μ L in superclean bench（Without antibiotic）, shifted after blowing and beating mixing
Into 1.5 mL centrifuge tubes, it is placed in shake culture 1.5h on 28 DEG C of constant-temperature tables；
100 μ L bacterium solutions is taken to be coated in containing spectinomycin Spe（100 mg/mL）+ rifampin Rif（50 mg/mL）LB tablets on,
28 DEG C of constant temperature incubation carton upside down cultures two days；
Picking Agrobacterium single bacterium colony, bacterium colony PCR are verified as positive, direct transformation of tobacco plant, Huo Zheyu after expanding and cultivating
It is saved backup for -80 DEG C in glycerine.
（Three）Transformation of tobacco plant, and cultivate screening transgenic plant
By step（Two）It is middle to screen the agrobacterium strains containing pHellsgate2-NtAAP2-RNAi positive recombinant plasmids, it connects
In kind to the LB fluid nutrient mediums containing spectinomycin/rifampin, 200 rpm/ min are incubated overnight in 28 DEG C of shaking tables；
Agrobacterium is activated overnight, second day with 1:100 ratio renewed vaccinations, about 50 mL of bacterium solution, the weight in 28 DEG C of constant-temperature tables
It shakes, until OD 600=0.5 ~ 0.8 or so；It will 4 DEG C of bacterium solution of culture, 5000 rpm centrifugation 10 min collection thalline；
By collected thalline liquid MS0（About 50 mL）It is resuspended spare（MS0 is formulated：4.4 g MS salt is taken to be dissolved in ultra-pure water
In, 1 L is settled to, adjusts pH=5.8）.
Using sterile tobacco leaf as sample, the limb edge and vein of aseptic blade are removed, and be cut into 0.5 ~ 1 with knife
cm2The square of size it is noted that preventing from tearing, squeezing during slice, avoids blade injury as possible.
During conversion, thalline re-suspension liquid is poured into put in vaned culture dish and is infected（Dip dyeing）90 s, are then pulled out rapidly
Bacterium solution is blotted with aseptic filter paper, sequence carries out tissue cultures according to the following steps.
Light culture：Sample blade after dip dyeing is uniformly laid in the MS differential mediums without antibiotic（MS (4.4
G/L)+sucrose (30 g/L)+agar powder (2.5 g/L)）In (blade face is upward), 26 DEG C of light cultures 2 days；
Selection culture：After light culture, leaf sample is transferred to respectively in the differential medium with kanamycins and hygromycin and carried out
Selection culture, differential medium formula：MS (4.4 g/L)+sucrose (30 g/L)+6-BA (1 mg/L)+NAA (0.1 mg/L)
+ cephalo (250 mg/L）+ Kan (150 mg/L)+agar powders (2.5 g/L）It is dissolved in ultra-pure water, is settled to 1 L, pH=5.8；
In order to ensure sufficient nutrition, 7 ~ 15 days are a period, change fresh culture until blade differentiates adventitious bud and becomes again
Raw seedling；
Elongation culture：Regrowth is cut when growing to 1 ~ 2 cm, is transferred in elongation medium and is cultivated in bottle, culture medium prescription：MS
(4.4 g/L)+sucrose（30 g/L)+6-BA (1 mg/L)+cephalos (250 mg/L）+ Kan (150 mg/L)+agar powder（2.5
G/L it) is dissolved in ultra-pure water, is settled to 1L, pH=5.8；
Culture of rootage：Root media is transferred to when differentiated independent adventitious bud grows to 5cm or so, is placed in illumination box
In, continue to cultivate, until it is taken root, culture medium prescription：MS (4.4 g/L)+cephalo (250 mg/L)+Kan (150 mg/L)/
Hyg (5 mg/L)+agar powder (2.5 g/L) is dissolved in ultra-pure water, is settled to 1 L, pH=5.8；
Transplanting：Treat that transgene tobacco grows to 3 ~ 4 leaves, after root system development is good, hardening 1 day, then by root culture medium with originally
Washing is clean, plants in the seedlings nursing plate containing fertile soil and vermiculite, obtains T0 for transgenic seedling, be placed in illumination box and continue to give birth to
It is long；
Tobacco regular culture conditions are：（28±1）DEG C, illumination 16h, dark 8h,（60±2）The relative humidity of %.
Continue culture to bearing seeds, the analysis of NtAAP2 gene transcript expressions and metabolin point are carried out for cigarette strain tobacco leaf with T1
Analysis.
In incubation, it is found that apparent dwarfism occurs in transgenic tobacco plant（As shown in figure 4, institute in Fig. 4
Photo when being shown as sowing about 60 days）, sampling（Sowing 60 days or so）Amino acid content situation of change is detected, while to T1 for cigarette
NtAAP2 gene expression amounts are detected in strain tobacco leaf, as a result as shown in Fig. 2, Fig. 7.From figure 2 it can be seen that transgenosis cigarette strain
Middle NtAAP2 gene expression amounts significantly reduce（Decline more than 50%）, illustrate that the inhibition of transfer-gen plant is more apparent, can use
In progress functional verification.And utilize the content of 18 kinds of amino acid in amino-acid analyzer detection transgene tobacco the result shows that：
Glu contents decline about 30%, Gln contents and decline about 65%, Asp contents decline about 30%, Asn contents decline about 30%, have significantly
It reduces, this illustrates that NtAAP2-2 genes affect the content of N in plant, and then affect the normal life of plant after being disturbed
It is long.
Embodiment 4
Operation purpose with embodiment 3 is on the contrary, the present embodiment mainly overexpresses NtAAP2 genes in tobacco, mainly
Technical operation thinking is：Structure is for the overexpression vector of NtAAP2 genes first；Then by this recombinate after overexpression vector turn
Change Agrobacterium；Using Agrobacterium-mediated genetic transformation technical transform tobacco, draw using across target gene and label protein gene
Object carries out positive plant screening, and screening obtains positive transgenic tobacco, continues to cultivate to bearing seeds；By obtained seed again row kind
It plants（T1 is for cigarette strain）, and NtAAP2 gene transcript expressions situation in transfer-gen plant and amino acid metabolite situation are divided
Analysis.Specific experiment process is described as follows.
（One）Primer is designed, is attached most importance to group objects with Super pcambia1300, builds the overexpression vector of transformation of tobacco；
It is as follows to design the primer sequence containing KpnI and SpeI restriction enzyme sites：
AAP2-F：5'-CGAGGTACCATGTTGCCAAGGAGTCGAACTCTTC-3',
Wherein GGTACC partial sequences in 5' ends represent KpnI restriction enzyme sites,
AAP2-R：5'-CCCACTAG TTTAGTAAATAGTCTTGAA AGGCTTATACGTTTT-3',
Wherein ACTAGT partial sequences in 5' ends represent SpeI restriction enzyme sites；
The NtAAP2-T plasmids obtained in correct embodiment 1 are sequenced as template, PCR amplification is carried out, amplified production is cut
Glue, recovery purifying obtain NtAAP2 target fragments.
KpnI and SpeI double digestions are carried out respectively to recycled NtAAP2 target fragments and Super pcambia1300, and
Recycle endonuclease bamhi；System Design is as follows：
NtAAP2 recovery products（Or Super pcambia1300）, 25 μ L；
KpnI, 2.5 μ L；
SpeI, 2.5 μ L；
1 × M Buffer, 5 μ L；
Water, 15 μ L；
3 h of digestion in 37 DEG C of constant incubators, digestion products are separated by electrophoresis with 1 % Ago-Gels, to purpose band into
Row gel extraction, purifying.
Recycled digestion products are attached, linked system design is as follows：
Super pcambia1300,1.5 μ L；
NtAAP2,4.5 μ L；
Solution I, 6 μ L；
30 min are reacted in 16 DEG C of metal baths；
Connection product is converted into bacillus coli DH 5 alpha competent cell, and screen positive bacterium colony, and it is spare to extract plasmid（Specific ginseng
Examine embodiment 3 and prior art operation）.
（Two）By step（One）In constructed recombination overexpression plasmid vector conversion Agrobacterium, and screen positive bacterium colony and expand
Increase spare（With specific reference to embodiment 3 and prior art operation）.
（Three）Transformation of tobacco plant, and cultivate screening transgenic plant（It is with specific reference to embodiment 3 and prior art operation
It can）.
Quantitative result is shown（As shown in Figure 3）, the expression quantity of NtAAP2-OE genes improves 75 % or so, illustrated table
Good effect is obtained up to transfer-gen plant, available for carrying out the functional verification of lower step.And compared with compareing tobacco（Such as Fig. 2
It is shown）, the expression quantity of NtAAP2-RNAi genes is inhibited by 55 % or so, illustrates that the inhibition of transfer-gen plant is more bright
It is aobvious, available for carrying out functional verification.
The content of 18 kinds of amino acid in transgene tobacco is detected using amino-acid analyzer, as shown in Figure 6, the results showed that：
Gln contents in transgenic leaf, which are overexpressed, in NtAAP2 increases 20%；And after low N Stress treatments, Asp increases by 53.3%, Asn and contains
Amount, which increases by 60%, Glu, increases by 26%, Gln contents increase by 53%, in p<0.05 level difference is notable, has statistical significance.
And Gln contents then reduce by 64.8%, Glu contents reduction by 27.7% in NtAAP2-RNA interference of transgene blades；Low N
After Stress treatment, Asp contents, which reduce by 33.3%, Gln contents, reduces 26.3%, in p<0.05 level difference is notable, has statistics
Learn meaning, such as Fig. 7.
The above results illustrate that NtAAP2 gene overexpressions or interference affect the content of N in plant later, so as to
Affect the normal growth of plant.
Embodiment 5
In order to further study effect of the NtAAP2 genes in tobacco, the present embodiment transgenic tobacco plant consistent to growing way
（NtAAP2 genes overexpress plant in NtAAP2 gene silencings plant and embodiment 4 in embodiment 3）With wild-type tobacco point
Low N Stress treatments are not carried out, and related experiment is briefly discussed below.
Experiment condition：
Culture solution：Nutrient solution is in addition to N elements：
KH2PO4 0.136 g/L、K2SO4 0.261 g/L、CaCl2 0.222 g/L、MgSO40.493 g/L,
H3BO3 6.2 mg/L、KI 0.83mg/L、MnSO4 22.3 mg/L、ZnSO4 8.6 mg/L、
Na6MO7O24 0.25 mg/L、 CuSO4 0.025 mg/L、Cocl20.025mg/L、Fe-EDTA 0.042 g/L；
Normal nitrogen nutrition control group is set：In above-mentioned nutrient solution, KNO is added in3 1.01 g/L、 (NH4)2SO4 0.264 g/
L；
Low nitrogen group： KNO3 0.101 g/L、(NH4)2SO40.0264 g/L；
The normal growth transgene tobacco of 50 days and control tobacco are taken, the condition of culture of tobacco is 28 DEG C of temperature, is 60 to humidity
%, 16 h of illumination, 8 h of dark.
The phenotype difference of transgene tobacco and control is observed in processing procedure.
The results are shown in Figure 5 for partial phenotypic, the results showed that：
There is aetiolation after a week in N Stress treatments in NtAAP2-RNAi transfer-gen plants；After continuing with 3 weeks,
NtAAP2-RNAi transfer-gen plants show apparent short and small symptom；
In N stress after two weeks, wild type control starts aetiolation occur；
And NtAAP2-OE transgenic lines, then do not occur significantly lacking N symptoms；After continuing with 3 weeks, can significantly it observe pair
Serious according to tobacco albefaction, blade integrally turns to be yellow, and chlorosis symptom is serious compared with NtAAP2-OE transgene tobaccos, and NtAAP2-OE
The cane of transgene tobacco is apparently higher than control tobacco.
With reference to amino acid content testing result, analysis shows：
Gln, Glu content reduce in tobacco plant after NtAAP2 RNA interference, may result in some compound, chlorophylls containing N
Content reduces, so as to cause plant chlorosis phenomenon；
NtAAP2, which is overexpressed Gln, Glu, Asp content in plant, to be increased, so as to further synthesize other amino acid and containing N
Compound, when tobacco lacks N, NtAAP2 is overexpressed Gln, Glu, Asp and Asn content in transfer-gen plant and dramatically increases, and says
Bright overexpression NtAAP2 genes can alleviate scarce N symptoms, and more N sources are provided for plant.
SEQUENCE LISTING
<110>Zhengzhou Tobacco Research Institute of CNTC
<120>Tobacco amino acid permease NtAAP2 genes and its application
<130> none
<160> 3
<170> PatentIn version 3.5
<210> 1
<211> 1539
<212> DNA
<213> Nicotiana tabacum
<400> 1
atgttgccaa ggagtcgaac tcttcctgcc agaataaacc atggtgaagt agaagaaagg 60
catgatgtta agcactattt ccaagtggat gtccaaccga aacatcaaaa ggaaactgag 120
ccaataaaca ttcaaaccaa ctactccaaa tgctttgatg atgatggccg tttaaagaga 180
acaggaactt tctggactgc aacatcacat ataatcacag ctgttattgg ttcaggagtc 240
ctctcattag catgggcaat aggacaactt ggttgggtag caggacctgc tgtaatgatc 300
ctttttgctt ttgtcatttt atatacttca aatcttctgt ctcaatgcta cagaactgga 360
gatcctgcca atggccctag gaatcacaca tatacggagg ctgtcaaggg aatattagga 420
gggaagaaag tgaaagtgtg tggattgatt cagtacttga acttgtttgg cgtggctatt 480
ggatacacca ttgctgcatc agtcagtatg ttggcaataa aaaggtcaaa ttgtttccac 540
aagagtcaca ggagagatcc ttgccatatg tctagtaatg gatatatgat agcatttggt 600
gtcattgaaa tcttgttctc tcagatccct gattttgatc aagtgtggtg gctctctatt 660
gttgctgcaa ttatgtcctt cacatactct actgttggtc ttgttcttgg aattgctaaa 720
gttgctgaaa ataaaagctt caaagggagc cttactggaa ttagtattgg tactgtaaca 780
tatgttggaa ctgtaacttc cactcaaaaa ttatggagga gtttgcaagc tctaggggca 840
attgcctttg catattcttt ctccatcata cttattgaga ttcaggatac aatcaaatct 900
cctcctgcag aacataaaac aatgaagaaa gccagtatgc tgagcatcgg cgtcacgact 960
attttttatt tactctgtgg atgtatgggc tatgctgctt ttggagatga tgctccagga 1020
aatctcctca ctggttttgg atttttcgat ccatattggt tgctcgacat agcaaatgca 1080
gctattgtca ttcaccttat tggtgcttat caggtatatt gtcaacctct ctttgcattt 1140
gtggagaaat ggagcgcgaa aaaatggtct aacagcaatt ttgtaacagc agaacatggc 1200
attcgtatcc ctttatttgg tgtttaccag cttaacttct ttcgtgtaat atggaggacg 1260
atttttgtaa tattaacaac gatcatagcg atgcttttgc cattctttaa tgacgttgtt 1320
ggattactag gagcgttggg attttggcca ctgactgtat atttcccaat agaaatgtat 1380
attaagcaaa agaagattgg aagatggaca aaccaatgga taggacttca aatgctaagc 1440
gcagcttgtt tatttgtgtc tatagctgca gcagttggtt ctatagcagg tgttgttctt 1500
gatctcaaaa cttataaacc tttcaacact acgtactaa 1539
<210> 2
<211> 512
<212> PRT
<213> Nicotiana tabacum
<400> 2
Met Leu Pro Arg Ser Arg Thr Leu Pro Ala Arg Ile Asn His Gly Glu
1 5 10 15
Val Glu Glu Arg His Asp Val Lys His Tyr Phe Gln Val Asp Val Gln
20 25 30
Pro Lys His Gln Lys Glu Thr Glu Pro Ile Asn Ile Gln Thr Asn Tyr
35 40 45
Ser Lys Cys Phe Asp Asp Asp Gly Arg Leu Lys Arg Thr Gly Thr Phe
50 55 60
Trp Thr Ala Thr Ser His Ile Ile Thr Ala Val Ile Gly Ser Gly Val
65 70 75 80
Leu Ser Leu Ala Trp Ala Ile Gly Gln Leu Gly Trp Val Ala Gly Pro
85 90 95
Ala Val Met Ile Leu Phe Ala Phe Val Ile Leu Tyr Thr Ser Asn Leu
100 105 110
Leu Ser Gln Cys Tyr Arg Thr Gly Asp Pro Ala Asn Gly Pro Arg Asn
115 120 125
His Thr Tyr Thr Glu Ala Val Lys Gly Ile Leu Gly Gly Lys Lys Val
130 135 140
Lys Val Cys Gly Leu Ile Gln Tyr Leu Asn Leu Phe Gly Val Ala Ile
145 150 155 160
Gly Tyr Thr Ile Ala Ala Ser Val Ser Met Leu Ala Ile Lys Arg Ser
165 170 175
Asn Cys Phe His Lys Ser His Arg Arg Asp Pro Cys His Met Ser Ser
180 185 190
Asn Gly Tyr Met Ile Ala Phe Gly Val Ile Glu Ile Leu Phe Ser Gln
195 200 205
Ile Pro Asp Phe Asp Gln Val Trp Trp Leu Ser Ile Val Ala Ala Ile
210 215 220
Met Ser Phe Thr Tyr Ser Thr Val Gly Leu Val Leu Gly Ile Ala Lys
225 230 235 240
Val Ala Glu Asn Lys Ser Phe Lys Gly Ser Leu Thr Gly Ile Ser Ile
245 250 255
Gly Thr Val Thr Tyr Val Gly Thr Val Thr Ser Thr Gln Lys Leu Trp
260 265 270
Arg Ser Leu Gln Ala Leu Gly Ala Ile Ala Phe Ala Tyr Ser Phe Ser
275 280 285
Ile Ile Leu Ile Glu Ile Gln Asp Thr Ile Lys Ser Pro Pro Ala Glu
290 295 300
His Lys Thr Met Lys Lys Ala Ser Met Leu Ser Ile Gly Val Thr Thr
305 310 315 320
Ile Phe Tyr Leu Leu Cys Gly Cys Met Gly Tyr Ala Ala Phe Gly Asp
325 330 335
Asp Ala Pro Gly Asn Leu Leu Thr Gly Phe Gly Phe Phe Asp Pro Tyr
340 345 350
Trp Leu Leu Asp Ile Ala Asn Ala Ala Ile Val Ile His Leu Ile Gly
355 360 365
Ala Tyr Gln Val Tyr Cys Gln Pro Leu Phe Ala Phe Val Glu Lys Trp
370 375 380
Ser Ala Lys Lys Trp Ser Asn Ser Asn Phe Val Thr Ala Glu His Gly
385 390 395 400
Ile Arg Ile Pro Leu Phe Gly Val Tyr Gln Leu Asn Phe Phe Arg Val
405 410 415
Ile Trp Arg Thr Ile Phe Val Ile Leu Thr Thr Ile Ile Ala Met Leu
420 425 430
Leu Pro Phe Phe Asn Asp Val Val Gly Leu Leu Gly Ala Leu Gly Phe
435 440 445
Trp Pro Leu Thr Val Tyr Phe Pro Ile Glu Met Tyr Ile Lys Gln Lys
450 455 460
Lys Ile Gly Arg Trp Thr Asn Gln Trp Ile Gly Leu Gln Met Leu Ser
465 470 475 480
Ala Ala Cys Leu Phe Val Ser Ile Ala Ala Ala Val Gly Ser Ile Ala
485 490 495
Gly Val Val Leu Asp Leu Lys Thr Tyr Lys Pro Phe Asn Thr Thr Tyr
500 505 510
<210> 3
<211> 341
<212> DNA
<213>Engineer
<400> 3
ctctactgtt ggtcttgttc ttggaattgc taaagttgct gaaaataaaa gcttcaaagg 60
gagccttact ggaattagta ttggtactgt aacatatgtt ggaactgtaa cttccactca 120
aaaattatgg aggagtttgc aagctctagg ggcaattgcc tttgcatatt ctttctccat 180
catacttatt gagattcagg atacaatcaa atctcctcct gcagaacata aaacaatgaa 240
gaaagccagt atgctgagca tcggcgtcac gactattttt tatttactct gtggatgtat 300
gggctatgct gcttttggag atgatgctcc aggaaatctc c 341
Claims (9)
- A 1. tobacco amino acid permease NtAAP2 gene, which is characterized in that including 1539 bases, specific base sequence is such as Shown in SEQ ID NO.1.
- 2. the amino acid permease of tobacco amino acid permease NtAAP2 coded by said gene described in claim 1, which is characterized in that The amino acid permease includes 512 amino acid, and specific amino acid sequence is as shown in SEQ ID NO.2.
- 3. application of the tobacco amino acid permease NtAAP2 genes described in claim 1 in tobacco is cultivated, which is characterized in that should Gene is related to tobacco amino acid content；Specifically, tobacco amino acid permease NtAAP2 genes are being translated, are being expressed as amino After sour permease, amino acid content in tobacco can be improved.
- 4. application of the tobacco amino acid permease NtAAP2 genes as claimed in claim 3 in tobacco is cultivated, which is characterized in that After being overexpressed NtAAP2 genes, the content of these amino acid of Glu, Gln, Asp, Asn in tobacco plant can be improved；And inhibiting After NtAAP2 gene expressions, the content of these amino acid of Glu, Gln, Asp, Asn in tobacco plant can be reduced.
- 5. application of the tobacco amino acid permease NtAAP2 genes described in claim 1 in tobacco is cultivated, which is characterized in that institute Tobacco amino acid permease NtAAP2 genes are stated, it is related to tobacco plant height.
- 6. using the overexpression vector constructed by tobacco amino acid permease NtAAP2 genes described in claim 1, feature exists In the base sequence of tobacco amino acid permease NtAAP2 genes is inserted into the expression vector containing 35S promoter and is built It forms.
- 7. the overexpression vector constructed by tobacco amino acid permease NtAAP2 genes, feature are utilized as claimed in claim 6 It is, the expression vector containing 35S promoter is Super pCAMBIA1300 plasmid vectors.
- 8. for the rna interference vector constructed by tobacco amino acid permease NtAAP2 genes described in claim 1, feature exists In specific interference sequence to be inserted into positive and negative both direction to built-up in plant expression vector, the specificity interference The base sequence of sequence is as shown in SEQ ID NO.3.
- A kind of 9. method for cultivating genetically modified plants new varieties, which is characterized in that tobacco amino acid permease NtAAP2 will be contained Overexpression vector constructed by gene or interfered for the RNA constructed by the tobacco amino acid permease NtAAP2 genes carries Body converts plant by technique for gene engineering, and screening obtains genetically modified plants new varieties.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711351625.2A CN108220305A (en) | 2017-12-15 | 2017-12-15 | Tobacco amino acid permease NtAAP2 genes and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711351625.2A CN108220305A (en) | 2017-12-15 | 2017-12-15 | Tobacco amino acid permease NtAAP2 genes and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108220305A true CN108220305A (en) | 2018-06-29 |
Family
ID=62649651
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711351625.2A Pending CN108220305A (en) | 2017-12-15 | 2017-12-15 | Tobacco amino acid permease NtAAP2 genes and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108220305A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL2027897A (en) * | 2020-11-27 | 2021-07-13 | Univ Henan Agricultural | Use of gmaap protein and gmaap gene in breeding soybeans |
| CN113373166A (en) * | 2021-06-30 | 2021-09-10 | 中国烟草总公司郑州烟草研究院 | Application of tobacco NtAAP3 gene in tobacco |
| CN113403331A (en) * | 2021-06-30 | 2021-09-17 | 中国烟草总公司郑州烟草研究院 | Application of tobacco NtAAP6 gene in tobacco |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5942399A (en) * | 1998-05-06 | 1999-08-24 | Incyte Pharmaceuticals, Inc. | Amino acid permease homolog |
| CN101880687A (en) * | 2010-07-15 | 2010-11-10 | 福建农林大学 | Method for breeding bacterial wilt resistant tobacco strain by inducible promoter with anti-disease gene |
| CN102943091A (en) * | 2012-11-07 | 2013-02-27 | 中国烟草总公司郑州烟草研究院 | Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique |
| CN104046638A (en) * | 2014-05-09 | 2014-09-17 | 吉林农业大学 | Arabidopis thaliana AAP1 gene cloning and plant expression vector construction method |
| CN104152439A (en) * | 2014-08-30 | 2014-11-19 | 中国烟草总公司郑州烟草研究院 | RNA extraction method suitable for tobacco seeds |
| CN106518993A (en) * | 2016-10-25 | 2017-03-22 | 武汉生物工程学院 | Application of amino acid transporter gene OsAAP3 in rice seed selection |
-
2017
- 2017-12-15 CN CN201711351625.2A patent/CN108220305A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5942399A (en) * | 1998-05-06 | 1999-08-24 | Incyte Pharmaceuticals, Inc. | Amino acid permease homolog |
| CN101880687A (en) * | 2010-07-15 | 2010-11-10 | 福建农林大学 | Method for breeding bacterial wilt resistant tobacco strain by inducible promoter with anti-disease gene |
| CN102943091A (en) * | 2012-11-07 | 2013-02-27 | 中国烟草总公司郑州烟草研究院 | Method for cultivating tobacco capable of resisting various viruses by adopting RNAi (RNA interference) technique |
| CN104046638A (en) * | 2014-05-09 | 2014-09-17 | 吉林农业大学 | Arabidopis thaliana AAP1 gene cloning and plant expression vector construction method |
| CN104152439A (en) * | 2014-08-30 | 2014-11-19 | 中国烟草总公司郑州烟草研究院 | RNA extraction method suitable for tobacco seeds |
| CN106518993A (en) * | 2016-10-25 | 2017-03-22 | 武汉生物工程学院 | Application of amino acid transporter gene OsAAP3 in rice seed selection |
Non-Patent Citations (4)
| Title |
|---|
| NCBI: "PREDICTED: amino acid permease 4-like isoform X1 [Nicotiana tabacum]", 《GENBANK》 * |
| NCBI: "PREDICTED: Nicotiana tabacum amino acid permease 4-like (LOC107807369), transcript variant X1, mRNA", 《GENBANK》 * |
| ZHAO YINGYING ET AL.: "Genome-wide identification and characterization of an amino acid permease gene family in Nicotiana tabacum", 《THE ROYAL SOCIETY OF CHEMISTRY》 * |
| 赵影影: "烟草 NtAAP2 基因的克隆及功能研究", 《中国学位论文全文数据库》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL2027897A (en) * | 2020-11-27 | 2021-07-13 | Univ Henan Agricultural | Use of gmaap protein and gmaap gene in breeding soybeans |
| CN113373166A (en) * | 2021-06-30 | 2021-09-10 | 中国烟草总公司郑州烟草研究院 | Application of tobacco NtAAP3 gene in tobacco |
| CN113403331A (en) * | 2021-06-30 | 2021-09-17 | 中国烟草总公司郑州烟草研究院 | Application of tobacco NtAAP6 gene in tobacco |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107435047B (en) | Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof | |
| CN116004656B (en) | Banana maturation associated gene MabHLH130 and application thereof | |
| CN104903444B (en) | Highly yielding ability nucleic acid, the method for preparing the increased genetically modified plants of yield, the method for increasing the yield of plant are assigned to plant | |
| CN116004657B (en) | Musa paradisiaca maturation-related gene MbGRF1 and application thereof | |
| CN104611359B (en) | The application of ZmSPL1 albumen and its encoding gene in regulation and control Maize Kernel Development | |
| CN108220305A (en) | Tobacco amino acid permease NtAAP2 genes and its application | |
| CN112779234A (en) | Phyllostachys pubescens PeAPX5 gene and application thereof | |
| CN109762828B (en) | Apple fruit hexose transporter gene MdHT2.2 and application thereof | |
| CN108715852B (en) | Tomato fruit mature gene Sl0658 and application thereof | |
| CN109468333A (en) | Citrus laccase family gene CsiLAC4 and its application | |
| CN115851823B (en) | Cymbidium CgARF18 gene and application thereof | |
| CN115851765B (en) | Musa paradisiaca maturation-related gene MaMYC2-10 and application thereof | |
| CN108424919A (en) | The research and application of transporter gene PbrALMT9 regulation and control pear flesh malic acid contents | |
| CN104805093B (en) | Applications of the paddy gene OsLOL3 in delaying plant leaf blade aging and improving drought resistance in plants | |
| CN111705074B (en) | Method for cultivating novel germplasm of short-vine delayed watermelon by using transgenic technology | |
| CN108359670A (en) | Improve microRNA genes and its application of arsenic stress rice tolerance | |
| CN108148849B (en) | Apple MdPHR1 gene and preparation method and application thereof | |
| CN115927363B (en) | Cymbidium CgARF8 gene and application thereof | |
| CN110904106A (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN110982921B (en) | Application of cymbidium miR159a in accelerating plant life cycle | |
| CN104945493B (en) | A kind of soybean protein GmIDD influencing plant growth period and its encoding gene and application | |
| CN117210490B (en) | PCHR gene for regulating and controlling malus plant self-flower fructification and application thereof | |
| CN115058433B (en) | Tobacco leaf yellowing regulatory gene NtMYB2, protein and application thereof | |
| KR100496028B1 (en) | A Method for Producing Herbicide-Resistant Chili Pepper Plant | |
| JPH09201190A (en) | Highly iron-containing plant produced by molecular breeding and method for producing the plant |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20180629 |