CN114214411A - circRNA marker for glioma diagnosis and glioma diagnosis kit - Google Patents

Abstract

The invention discloses a circRNA marker for glioma diagnosis and a glioma diagnosis kit in the field of biotechnology. The method can be used for diagnosing the glioma patients by detecting the expression level of circRNA hsa _ circ _0010027 in the peripheral plasma of the glioma patients, and the circRNA hsa _ circ _0010027 has obvious difference in expression in the peripheral plasma of the glioma patients and the normal control group and can be used for diagnostic analysis of the glioma patients; the method is characterized in that a primer of the circRNA hsa _ circ _0010027 in the glioma cells is designed to carry out knockdown treatment on hsa _ circ _0010027 highly expressed in the glioma cells, and the hsa _ circ _0010027 can be used as a glioma treatment target point by judging the cell proliferation rate and migration capacity of a knockdown group and a control group, so that the clinical diagnosis rate of early glioma is expected to be improved, and the treatment effect and the survival quality of a patient are improved.

Description

circRNA marker for glioma diagnosis and glioma diagnosis kit

Technical Field

The invention relates to a circRNA marker for glioma diagnosis and a glioma diagnosis kit in the technical field of biology.

Background

Brain glioma is the most frequent brain tumor disease of adults, and accounts for 40.49 percent of intracranial tumors. From the time of diagnosis, the average life span of brain glioma patients does not exceed five years. In order to diagnose glioma, a malignant disease with a very high genetic material correlation, the pathogenesis of glioma must be explored at the molecular biological level from the aspect of genetic information expression. At present, the diagnosis and treatment methods of glioma are in the continuous improvement stage, but the survival rate of glioma patients is not obviously improved. Glioma diagnosis is still in an empirical stage based on clinical, pathological and imaging information, and once diagnosed, most of them are in middle and advanced stages, and the survival rate after surgery is not optimistic. Therefore, the search of early diagnosis markers of glioma for carrying out 'early discovery and early treatment' on patients, the improvement of the life cycle of glioma patients and the corresponding selection of reasonable subsequent treatment schemes are research tasks to be solved urgently in the field of neuroscience.

circular RNA is a type of non-coding long-chain RNA widely found in mammals that does not have a 5 'terminal cap and a 3' terminal poly (A) tail, covalently bonded to form a circular structure. In past studies, it was thought that CircRNA was ineffective and not functional, however, the cenna (competitive endogenous RNA) hypothesis proposed by Pandolfi et al overturns this recognition, and further more biological functions of CircRNA were discovered.

Currently, circRNA has the following potential role in cancer:

1. as a miRNA sponge or trap; 2. as a protein sponge or trap; 3. affecting transcription of a downstream gene; 4. affecting alternative splicing of the target gene; 5. modulating target protein translation function; 6. involved in epigenetic modification of target genes/proteins. Research shows that the circRNA as a protein sponge not only can be combined with RNA-related protein, but also can be combined with transcription factors to directly influence the transcription activity of the protein sponge. It has further been reported that partial circRNA can directly affect post-transcriptional modifications of proteins, such as circ-Amotl1 interacting directly with AKT1, promoting its phosphorylation and nuclear translocation. In the field of oncology research, research into the association of circRNAs with human tumors is currently on the rise. In gallbladder cancer related research, circFOXP1 expression is found to be remarkably up-regulated in gallbladder cancer tissues and is positively correlated with lymph node metastasis, the stage of advanced TNM and poor patient prognosis. In esophageal squamous cell carcinoma, circGSK3 β is a specific circRNA with significant up-regulation of expression in tumors; further functional and mechanistic studies have also demonstrated that circGSK3 β exerts a pro-cancer effect in esophageal squamous cell carcinoma, which promotes esophageal squamous cell carcinoma cell migration and invasion by interacting directly with GSK3 β and inhibiting GSK3 β activity. In liver cancer, circ-RanGAP1 has also been reported as a potential prognostic biomarker and therapeutic target for liver cancer, and is abnormally highly expressed in plasma, tissues and exosomes of liver cancer patients. The research results suggest that the expression abnormality of the circRNAs plays an important role in the occurrence and development of human malignant tumors and is expected to become a new molecular diagnosis and treatment target of some tumors.

Disclosure of Invention

The invention aims to solve the defects in the prior art, and provides a glioma diagnosis marker circRNA (hsa _ circ _0010027) and explores the treatment effect of the glioma diagnosis marker circRNA.

The invention is realized by the following technical scheme:

a circRNA marker for glioma diagnosis, characterized by: the circRNA marker is hsa _ circ _0010027, and the sequence of the circRNA marker is shown in Table 1; the use of the reagent with the expression quantity of the circRNA marker hsa _ circ _0010027 in plasma for preparing a glioma diagnostic preparation;

a glioma diagnostic kit characterized in that: the ability to detect the level of marker hsa _ circ _0010027 in glioma tissue;

the technical scheme is further explained as follows: PCR primers for detecting the content of the marker hsa _ circ _0010027, wherein the sequence numbers of the PCR primers are shown in Table 2; the technical scheme is further explained as follows: comprises shRNA sequence CCAGTCACTCCACGGCCAGCA for interfering with the expression of hsa _ circ _0010027 to inhibit tumor;

the technical scheme is further explained as follows: except the primer of hsa _ circ _0010027, the kit also contains a reagent for extracting RNA from plasma and performing reverse transcription and fluorescent quantitative PCR;

the reagent comprises a reagent for extracting total RNA from glioma tissues, a reagent for reverse transcribing hsa _ circ _0010027 into cDNA by using the total RNA as a template, and a reagent for real-time quantitative PCR of the cDNA; the reagent for extracting total RNA from glioma tissues comprises RNA stable solution, Trizol reagent, trichloromethane, isopropanol and enzyme-free water; the technical scheme is further explained as follows: the reagent for reverse transcription of hsa _ circ _0010027 into cDNA by using total RNA as a template comprises a reverse transcription buffer solution, base triphosphate deoxynucleotides, an RNase inhibitor, MMLV reverse transcriptase and random primers used by hsa _ circ _ 0010027; the reagents used for real-time quantitative PCR of cDNA comprise a circRNA hsa _ circ _0010027 real-time fluorescent quantitative PCR specific primer, a GAPDH reference specific PCR primer, a real-time fluorescent quantitative SYBR dye and enzyme-free water.

Plasma of a high-grade glioma patient (n ═ 20) and a healthy population (n ═ 20) is collected, and hsa _ circ _0010027 expression in the glioma is detected in a qRT-PCR mode, and the expression of the plasma of the high-grade glioma patient is found to be significantly higher than that of the healthy population (p < 0.001). FIG. 1 is a graph of the differential expression of circular RNA in high-grade gliomas and healthy humans, in which: p < 0.01, p <0.001

Further expanding the samples to test the expression of hsa _ circ _0010027, hsa _ circ _0001459 and hsa _ circ _0004907 in the plasma of high-grade glioma patients (n-50) and healthy people (n-60), and evaluating the diagnosis performance by ROC curve, and as a result, finding that the comprehensive performance of hsa _ circ _0010027 is best, and AUC-0.9086; FIG. 2 is a diagnostic performance evaluation chart of hsa _ circ _0010027,

wherein p <0.001

The research of the invention proves that the expression quantity of the circRNA hsa _ circ _0010027 in the peripheral blood of a glioma patient can be used for diagnosing the glioma patient, and the expression quantity of the circRNA hsa _ circ _0010027 in the peripheral blood of the glioma patient and the peripheral blood of a normal control group has a significant difference. Therefore, the method can be used for diagnostic analysis of glioma patients.

The method comprises the following steps of designing a primer for specifically knocking down the circRNA hsa _ circ _0010027 in the glioma cells to knock down the highly expressed hsa _ circ _0010027 in the glioma cells, judging the cell proliferation rate and the migration capacity of a knock-down group and a control group to enable hsa _ circ _0010027 to be used as a glioma treatment target, wherein the specific knock-down sequence of the hsa _ circ _0010027 is as follows: CCAGTCACTCCACGGCCAGCA are provided.

Compared with the prior art, the invention has the beneficial effects that:

1) the circRNA has rich content in plasma, stable property and quantitative detection;

2) the detection index has high indication accuracy, the area under the receiver operating characteristic curve (ROC) (AUC) is 0.9086, which is much higher than the existing common index;

3) the detection indexes are minimally invasive and cheap, can be applied to population screening and clinical detection, and are easy to popularize and apply;

4) the invention also provides technical guidance for the research of other disease biomarkers;

5) the invention combines basis, clinic, theory and application, is hopeful to improve the clinical diagnosis rate of early glioma and improve the treatment effect and the life quality of patients.

Drawings

FIG. 1 is a graph of the differential expression of circular RNA in high-grade glioma versus healthy population;

FIG. 2 is a diagnostic performance evaluation chart of hsa _ circ _ 0010027;

FIG. 3 is a map of the efficiency of the hsa _ circ _0010027 knockdown primer;

FIG. 4 is a graph of the proliferation rate of two glioma cells following knockdown of hsa _ circ _ 0010027;

FIG. 5 is a graph of two glioma cell migration capacity assays following knockdown of hsa _ circ _ 0010027.

Detailed Description

The invention is further described with reference to the following figures and examples:

the first embodiment is as follows: diagnostic kit for glioma

Preparing a reagent for detecting the expression quantity of the circRNA hsa _ circ _0010027 for preparing a glioma diagnosis kit (50 reactions):

50ml RNA stabilizing solution

2. Isopropanol 100ml

3. Chloroform 100ml

Trizol (from Invitrogen corporation) 50ml

5. 10ml of enzyme-free water

6.1 μ M random reverse transcription primer (Roche Co., Ltd.) 50 μ l

7.5 Xreverse transcription buffer (Roche Co.) 200ml

8.10mM base triphosphate deoxynucleotide (Roche Co.) in 100. mu.l

9.40U/. mu.l RNase inhibitor (Roche Co.) 500. mu.l

10.200U/. mu.l MMLV reverse transcriptase (Roche Co.) 50. mu.l

Premix Ex Taq (Roche Co.) 50. mu.l

12.10 μ M of the real-time fluorescent quantitative PCR specific primer for circRNA hsa _ circ _0125365 30 μ l of the circRNA hsa _ circ _0010027 forward primer: 5'-TTCAGAAAGCACAGTCCACG-3' the flow of the air in the air conditioner,

circRNA hsa _ circ _0010027 reverse primer: 5'-GTCACCACATCATCTTCGGC-3', respectively;

13.10 μ M nematode circRNA internal control

A forward primer: 5'-TTGCAGCTCTCATAGAAGGAACCG-3', respectively;

reverse primer: 5'-GTTTCAGCCGAGACTAGACTTTGAGC-3', respectively;

peripheral blood plasma extraction: collecting 5ml of morning-start fasting venous blood by adopting a vacuum anticoagulation EDTA blood collection tube for each research object, centrifuging within 12 hours according to a standard method, separating plasma into 1.5ml centrifuge tubes, and preserving two parts at-80 ℃ for later use;

extraction of plasma RNA: plasma RNA is extracted according to the operational flow of Trizol LS reagent of Invitrogen company and RNeasy Plus Mini Kit of Roche company, 100ng of total nematode RNA is added as a quality control and internal reference standard, the plasma RNA is purified by a centrifugal column and is stored at minus 80 ℃ for standby after elution, and the purity and the concentration of the RNA are detected by a NanoDropND-2000 instrument; Real-Time PCR detection of circRNA: designing a reverse primer specific to the circRNA, carrying out RNA reverse transcription by adopting a reverse transcription kit produced by Roche company, detecting the expression level of the circRNA in plasma by adopting a SYBR-Green dye method, carrying out a reaction system and conditions according to the specification of the kit, carrying out three parallel experiments on each sample, and carrying out standardization by taking the circRNA of nematodes as an internal reference.

Δ CT ═ Δ CT case- Δ CT control. The experimental data was analyzed by a relatively quantitative method, GAPDH was used as the reference gene, and the mean value of Δ CT in glioma patients was used as the control. Data were analyzed using the software GraPhPad Prism and SPSS.

The expression level of hsa _ circ _0010027 in case plasma was significantly higher than that of healthy controls (p <0.001), suggesting a diagnostic marker.

The results show that the area under the receiver operating characteristic curve (ROC) (AUC) is 0.9086, indicating that hsa _ circ _0010027 is more accurate for diagnosing high grade glioma.

Example two: hsa _ circ _0010027 as glioma treatment target

Carrying out knockdown treatment on the glioma cell strains DBTRG and U251 highly expressed by hsa _ circ _0010027, determining a primer with the optimal knockdown efficiency from three alternative primers, and obtaining a sequence shown below;

ShRNA1：AGTCACTCCACGGCCAGCACA

ShRNA2：CCAGTCACTCCACGGCCAGCA

ShRNA3：CTCCACGGCCAGCACAGGCCA

FIG. 3 is a photograph of an hsa _ circ _0010027 knockdown primer efficiency test, wherein: p < 0.05, p < 0.01

Detecting cell proliferation by using an MTT method, wherein detection is estimated to be 5 days; after the pancreatin of each experimental group cell in the logarithmic growth phase is digested, the complete culture medium is re-suspended into cell suspension, and counting is carried out; respectively inoculating 6 holes into a 96-hole plate by using 2000cells/well in a control group and an hsa _ circ _0010027 knock-down group, wherein a culture system is 100 mu L/hole, the number of cells added into each hole is ensured to be consistent in the plate paving process, and in addition, 6 blank holes only containing 100 mu L of complete culture medium are set as reference values; at the beginning of the experiment, 5 plates were spread together and cultured in a 5% CO2 cell culture box at 37 ℃; one plate was examined daily by the MTT method from the second day of culture; MTT detection method: adding 20 mu L of 5mg/mL MTT into the well 4h before the culture is terminated without changing the solution; after 4h, the culture medium was completely aspirated, and the formazan particles were dissolved by adding 100. mu.L of LDMSO, taking care not to aspirate the formazan particles at the bottom of the well plate; oscillating for 2-5min with oscillator, and detecting OD value with enzyme labeling instrument 490/570 nm. A significant decrease in the proliferation rate of glioma cells was found in the two cell knockdown groups (fig. 4).

FIG. 4 is a graph of the proliferation rate of two glioma cells after knockdown of hsa _ circ _0010027, where p is < 0.01

Cell detection using scratch assayThe migration capability changes. A500 μm thick Culture insert was placed on a 12-well plate and pressed gently to ensure tight attachment. The same number of cancer cells were added to two wells of the same insert and incubated overnight at 37 ℃ in 5% CO 2. The insert was then gently removed with forceps to create a 500 μm pore. The cancer cells were then treated according to the experimental design and the width of the same part of the wound was measured by observing the migration of the cancer cells with a microscope at different time points. At a particular point in time during the healing of the wound,

FC software measured area quantification of wound migration. Each experiment was repeated three times.

FIG. 5 shows the cell function experiment of two glioma cell migration capability tests after the deletion of hsa _ circ _0010027, the hsa _ circ _0010027 deletion is carried out on glioma cell lines DBTRG and U251, and the cell proliferation and migration capability is tested, and the result shows that the cell proliferation and migration capability are obviously reduced after the hsa _ circ _0010027 deletion. It was initially demonstrated that hsa _ circ _0010027 is a target for treatment of glioma.

The above is a preferred embodiment of the present invention, the scope of the present invention is not limited thereto, and any simple variation or equivalent replacement of the technical solution that can be obviously obtained by those skilled in the art within the technical scope of the present invention is within the scope of the present invention.

Sequence listing

<110> Shanghai Jieji Biotech Co., Ltd

<120> circRNA marker for glioma diagnosis and glioma diagnosis kit

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 264

<212> RNA

<213> Unknown (Unknown)

<400> 1

ccagcacagg ccagccagaa gaugacacug agacuacagg uuuggaaggc ggcguugcca 60

ugccaggugc cgaagaugau guggugacuc caggaaccag cgaagaccgc uauaagucug 120

gcuugacaac ucugguggca acaaguguca acaguguaac aggcauucgc aucgaggauc 180

ugccaacuuc agaaagcaca guccacgcgc aagaacaaag uccaagcgcc acagccucaa 240

acguggccac cagucacucc acgg 264

Claims (6)

1. A circRNA marker for glioma diagnosis, characterized by: the circRNA marker is hsa _ circ _0010027, and the sequence of the circRNA marker is shown in Table 1.

2. The circRNA marker for glioma diagnosis according to claim 1, characterized in that: the use of the reagent with the expression quantity of the circRNA marker hsa _ circ _0010027 in plasma for preparing a glioma diagnostic preparation.

3. A glioma diagnostic kit characterized in that: the level of marker hsa _ circ _0010027 in glioma tissue can be detected.

4. The glioma diagnostic kit of claim 3, characterized in that: contains PCR primers for detecting the content of the marker hsa _ circ _0010027, and the sequence numbers of the PCR primers are shown in Table 2.

5. The glioma diagnostic kit of claim 3, characterized in that: contains shRNA sequence CCAGTCACTCCACGGCCAGCA for interfering with the expression of hsa _ circ _0010027 to inhibit tumor.

6. The glioma diagnostic kit of claim 3 or 4 or 5, characterized in that: in addition to the primers of hsa _ circ _0010027, reagents for RNA extraction from plasma and for reverse transcription and fluorescent quantitative PCR were included.

Images