CN109868319B - MicroRNA molecular marker for screening saliva of acute altitude stress susceptible and application thereof - Google Patents

Abstract

The invention relates to a microRNA marker for screening saliva of a person susceptible to acute altitude stress, and application of the microRNA in preparation of a reagent or a kit for screening the person susceptible to acute altitude stress. And further provides a kit for detecting hsa-miR-134-3p and hsa-miR-15b-5p molecules in the plain saliva of a tested person by a real-time fluorescent quantitative PCR method, and the acute altitude reaction risk is predicted according to the expression level of the kit. The method uses microRNA in a saliva sample as a molecular marker, has the characteristics of strong specificity, high sensitivity, no wound, convenience and the like, and is suitable for screening of large-scale acute altitude reaction susceptible people in plains.

Description

MicroRNA molecular marker for screening saliva of acute altitude stress susceptible and application thereof

Technical Field

The invention belongs to the field of molecular biotechnology and application thereof, and relates to a microRNA molecular marker for screening saliva of a susceptible patient with acute altitude reaction, and further relates to application and a kit thereof. The expression levels of hsa-miR-134-3p and hsa-miR-15b-5p in saliva are used for screening the risk of acute altitude stress, so that the method is used for evaluating the susceptibility of a human body to the acute altitude stress and reducing the risk of the human body caused by the acute altitude stress.

Background

Acute altitude sickness (AMS) occurs in plain people who live in low altitude areas for a long time, and occurs 1-3 days after the plain people rapidly enter the plateau without adapting to a new environment, and comprises a series of symptoms such as headache, dizziness, fatigue, insomnia, emotional restlessness, flatulence, diarrhea, vomiting and the like, wherein severe headache is a typical symptom of AMS. Geographically, a wide area with an altitude higher than 500m and a relatively flat or fluctuating terrain is called a plateau, and medically, a place with an altitude higher than 2500-3000m is called a plateau. AMS has a high incidence rate, which can reach 50-85% according to The rising speed and The specific altitude (Bartsch P. and Swenson E. R., Clinical practice: Acute high-availability vaccines, The New England and Journal of Medicine, 2013,368(24), 2294-302.). It is not only highly dangerous and seriously affects the ability of an individual to rapidly advance to a High plateau, but, more seriously, if AMS is not effectively controlled and treated, it is likely to develop into High Altitude cerebral edema with High lethality (Boos C.J.et al, High Altitude and Acute Motor therapy and Changes in Circulating Endothelin-1, Interleukin-6, and Interleukin-17a. High Altitude Medicine & Biology, 2016,17(1), 25-31.).

AMS has obvious genetic tendency and individual susceptibility, and both environmental factors and genetic factors of high altitude hypoxia can influence the occurrence of AMS. For many years, AMS genetic predisposition and individual susceptibility have been the focus of scholars both at home and abroad, although some have proposed using SNP sites such as hypoxia-associated genes EGLN1, HIF-1AN, NOS3 to predict AMS susceptible populations, these markers are currently not satisfactory in terms of accuracy and specificity (Luks A.M., Swenson E.R., Bartsch P., Acute high-activity site). And the plateau area of China is very large (about 1/5 of the area of the national land) and the altitude is higher (the average altitude of the Qinghai-Tibet plateau is more than 4000 meters). In recent years, with the vigorous development of the highland tourism industry and the economic construction of the plateaus at home and abroad, more and more plains enter the plateaus, and the high development of the AMS not only causes very serious influence on the life and work of the people, but also constructs heavy burden on the fragile sanitary machines in the plateau areas. Therefore, an effective method for predicting the susceptibility of AMS to pathogenesis in plain is urgently needed to be found.

MicroRNA is a non-coding RNA molecule which is widely existed in eukaryote and has the length of 18-24 nucleotides. MicroRNA inhibits the expression of target genes horizontally after transcription, participates in the regulation of cell differentiation, proliferation, apoptosis and other life activities, and plays an important role in various physiological and pathological processes such as embryonic development, organism metabolism, disease occurrence and development and the like. In recent years, researchers have proposed the concept of circulating microRNA by detecting microRNA in various body fluids such as blood, saliva, and urine. And the expression level of the microRNA is highly related to the difference of the genetic genes of the microRNA. It is important to note that in recent years, a large number of researches show that circulating microRNA has good specificity and sensitivity on advanced diagnosis and disease prediction of tumors, hypertension, stroke and a series of diseases. Furthermore, saliva and other body fluid samples are easy to obtain, strong in clinical operability, small in wound, good in stability of Circulating microRNA and convenient to detect, so that the Circulating microRNA has the potential of serving as an AMS noninvasive biomarker and is suitable for AMS susceptibility population screening (Toffolo K., Wang J.et al., Circulating microRNAs as biomarkers in Circulating vaccine in 2018.). However, the correlation between circulating microRNA and AMS susceptibility is rarely reported at present.

Disclosure of Invention

In view of the above, the invention aims to provide a microRNA molecular marker for screening saliva of a person susceptible to acute altitude reaction, and hsa-miR-134-3p and hsa-miR-15b-5p expression levels in saliva of the person to be examined are used for screening the acute altitude reaction onset risk, so as to evaluate the susceptibility of a human body to the acute altitude reaction. Also provides application and a kit of the microRNA molecular marker.

In order to achieve the purpose, the invention provides the following technical scheme:

1. a microRNA molecular marker for screening saliva of a susceptible patient with acute altitude reaction is hsa-miR-134-3p and hsa-miR-15b-5 p.

Further, the sequence of the hsa-miR-134-3p is shown in SEQ ID NO: 1, the sequence of the hsa-miR-15b-5p is shown as SEQ ID NO: 2, respectively.

Further, the expression of said nucleic acid molecule in saliva is down-regulated compared to the expression in control saliva.

Further, the saliva is a saliva supernatant.

Further, the saliva supernatant is obtained by centrifuging saliva at 3000 Xg at 4 ℃ for 15-20 minutes, and then taking the supernatant with an RNase-free and bacteria-free tip into an RNase-free and bacteria-free EP tube; then 12000 Xg, 4 ℃ for 10-20 minutes, in sterile enzyme-free EP tube-80 ℃ storage for standby.

2. The application of microRNA molecular markers in preparation of a reagent or a kit for screening acute altitude reaction susceptible persons is provided, wherein the microRNA molecular markers are hsa-miR-134-3p and hsa-miR-15b-5 p.

3. The kit can detect two microRNAs of hsa-miR-134-3p and hsa-miR-15b-5, and comprises primers which can be specifically combined with reverse transcription products of hsa-miR-134-3p and hsa-miR-15b-5p respectively and perform PCR amplification.

Furthermore, the sequence of the hsa-miR-134-3p forward primer is SEQ ID No.5, and the sequence of the hsa-miR-134-3p reverse primer is SEQ ID No. 7.

Furthermore, the sequence of the hsa-miR-15b-5p forward primer is SEQ ID No.6, and the sequence of the hsa-miR-15b-5p reverse primer is SEQ ID No. 8.

Further, the kit also comprises a miRNA RT reaction system, wherein the miRNA RT reaction system comprises, per 10 ul: reverse transcription primer 1ul, 5 × reverse transcription Buffer 2ul, RTase Mix 2ul, RNase-free H₂O3 ul, the remaining 2ul are test RNAs.

Furthermore, the hsa-miR-134-3p reverse transcription primer is shown in SEQ ID No. 3.

Furthermore, the hsa-miR-15b-5p reverse transcription primer is shown in SEQ ID No. 4.

Further, the test RNA is derived from saliva.

Further, the test RNA is derived from saliva supernatant.

Further, the kit RT reaction temperature parameters are as follows: 60min at 42 ℃ and 10min at 70 ℃.

Further, the kit also comprises a miRNA qPCR reaction system, wherein the miRNA qPCR reaction system comprises 20ul per unit: SYBR Green Mix 10ul, miRNA Forward primer 0.8ul, miRNA Reverse primer 0.8ul, ddH2O 6.4.4 ul, and the balance of RT reaction product 2 ul.

Further, the kit miRNA qPCR reaction conditions are pre-denaturation at 95 ℃ for 10min, denaturation at 95 ℃ for 2s, annealing at 60 ℃ for 20s, and extension at 70 ℃ for 10 s.

The invention has the beneficial effects that: according to the invention, through screening of chip spectrums of circulating microRNA in the plain plasma of a plain life resident, after people enter a plateau, AMS and healthy people are distinguished according to an AMS international universal diagnosis standard Louis lake scoring diagnosis system, and one or two of circulating hsa-miR-134-3p and hsa-miR-15b-5p in saliva are further found to have obvious difference between AMS susceptible persons and healthy persons by combining the morbidity of the AMS after the plateau is exposed in an anoxic way. And detecting the expression level of each microRNA circulating in the plain saliva of another independent population by a SYBR (SYBR Green dye, abbreviated as SYBR) real-time fluorescent quantitative PCR (polymerase chain reaction) method, and confirming that the expression levels of hsa-miR-134-3p and hsa-miR-15b-5p circulating in the plain saliva and the susceptibility of AMS have correlation. The microRNA marker provided by the invention can be detected through saliva, a sample is convenient to obtain, the pain and risk of blood drawing of a person to be detected after a needle is pricked are reduced, and the saliva sample collection has the advantages of non-wound, safety, convenience and the like. The saliva sample cases verified by the invention are large in quantity and strong in reliability, and the reliable effect of the microRNA indicated by the invention on prevention and treatment of AMS can be fully proved. According to the invention, miRNA which is abnormally expressed and has an obvious and constant low level in saliva of a susceptible person of AMS is determined as a primary research object, miRNA which is closely related to the susceptible person of AMS in a saliva specimen is found out, the screened miRNA has good screening efficiency on AMS, the risk of disease of altitude reaction after the altitude is screened in the plain, the prevention and treatment of AMS are guided, and the health and life threat of the altitude reaction to people are reduced. The method carries out new effective and reliable supplementation on the existing laboratory evidence of the microRNA as a potential acute altitude reaction diagnosis biomarker and provides reliable basis for detection from new body fluid.

Drawings

In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:

FIG. 1 is a comparison of the levels of hsa-miR-134-3p expression in saliva supernatants of AMS-susceptible and healthy controls;

FIG. 2 is a graph of the working characteristics of hsa-miR-134-3p in the saliva supernatant of AMS-susceptible individuals;

FIG. 3 is a comparison of the levels of hsa-miR-15b-5p expression in saliva supernatants of AMS-susceptible and healthy controls;

FIG. 4 is a graph of the working characteristics of hsa-miR-15b-5p in the saliva supernatant of AMS-susceptible individuals;

FIG. 5 is a graph showing the working characteristics of the combination of hsa-miR-134-3p and hsa-miR-15b-5p in the saliva supernatant of AMS-susceptible individuals;

FIG. 6 is a comparison of the expression levels of hsa-miR-134-3p in whole saliva for AMS-susceptible and healthy controls;

FIG. 7 is a graph of the working characteristics of whole saliva hsa-miR-134-3p of AMS-susceptible individuals;

FIG. 8 is a comparison of the expression levels of hsa-miR-15b-5p in whole saliva for AMS-susceptible and healthy controls;

FIG. 9 is a graph of the working characteristics of hsa-miR-15b-5p in whole saliva of AMS-susceptible individuals.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

In the quantitative tests in the following examples, three replicates were set, and the data are the mean or the mean ± standard deviation of the three replicates.

Firstly, plasma microRNA expression profiles of 20 AMS patients and 15 healthy controls are compared and analyzed, then saliva expression levels of 75 AMS patients and 49 healthy controls are detected and compared, correlation between each microRNA and AMS is researched, and sensitive and credible AMS susceptibility biological genetic markers are searched. Collecting 5ml of saliva of people who want to enter the plateau from the plain quickly by using a 50ml centrifuge tube, centrifuging for 15-20 minutes at 3000 Xg and 4 ℃, taking supernatant by using an RNase-free and bacteria-free suction head, and placing the supernatant into an RNase-free and bacteria-free EP tube. Then, the mixture was centrifuged again at 12000 Xg at 4 ℃ for 10 to 20 minutes, and the supernatant was collected with a sterile enzyme-free tip and stored at-80 ℃ in a sterile enzyme-free EP tube. The microRNA expression level in plasma is detected by a microRNA expression profile chip (mircurytM LNA Array (v.18.0)), after the population enters a plateau, AMS and healthy population are distinguished according to AMS international universal diagnostic standard Louis lake scoring diagnostic system (Maggiorini M.et al, Assessment of acid methyl amino acids assay by differential reagent protocol in the Swiss Alps. Aviat Space Environ Med, 1998,69(12),1186-92.), AMS susceptibility related microRNA expression profiles are compared, AMS susceptibility related microRNAs are screened, and some microRNAs including hsa-miR-134-3p and hsa-miR-15b-5p in saliva supernatant are found to have significant difference in expression of AMS susceptible persons and healthy population.

The expression profile of some microRNAs, including hsa-miR-134-3p and hsa-miR-15b-5p, in AMS susceptible (75 cases) and healthy control (49 cases) were tested in another independent population using the qPCR technique. In the whole process, the RNA of the saliva sample is extracted by a microRNA column extraction Kit (miRNeasy Serum/Plasma Kit, cat # 217184) of the Germany Qiagen technology Limited company, and then real-time fluorescence quantitative PCR (Bulge-Loop)^TMmiRNA qRT-PCR Starter Kit, cat No.: r10039.2) is carried out to amplify each microRNA and the external reference cel-miR-39; and then respectively calculating the normalized expression level of each microRNA of each sample to the external reference cel-miR-39, and detecting the result through SPSS 19.0, wherein P is less than 0.05 as a significance detection standard, and the significant difference exists between the expression levels of the salivary hsa-miR-134-3P and the expression levels of the salivary hsa-miR-15b-5P of an AMS susceptible group (75 cases) and a healthy group (49 cases).

The invention aims to solve the technical problem that AMS susceptible persons and healthy persons can be screened by finding one or more than one plain saliva microRNA markers. The method is characterized in that related microRNA markers in human plateau saliva are detected, AMS susceptible persons and healthy persons are distinguished through the expression level, and then the disease risk of AMS entering the plateau is screened, so that more risks caused by the occurrence of diseases are avoided.

The technical scheme for solving the problems is as follows: and detecting the content of one or two of hsa-miR-134-3p and hsa-miR-15b-5p in saliva of the plain human to distinguish AMS susceptible persons from healthy persons.

The invention also comprises application of saliva microRNA (one or two of hsa-miR-134-3p and hsa-miR-15b-5p) in preparation of a kit for screening AMS (AMS) morbidity risk.

Example 1 correlation study of MicroRNA expression from saliva samples with AMS onset Risk

Description of Material and specimen Collection

AMS susceptible saliva specimens were collected from AMS patients in the population of rapidly advancing plateaus, and counted in 75 cases before entering plateaus. Saliva specimens of normal people are collected from normal healthy people in the population who rapidly enters the plateau, and 49 specimens are collected before the normal healthy people enter the plateau. Diagnosis of AMS was confirmed by the International Universal diagnostic Standard-Louis lake score. All people did not take any preventive medication before taking saliva. Each sample was collected in 10ml total using sterile, enzyme-free 50ml centrifuge tubes. The clinical case characteristics of the patients are shown in table 1. The study was approved by the medical ethics committee of the army medical university (third military medical science), and all specimens were collected with informed consent from the patients.

TABLE 1 clinical data on saliva samples

Second, sample treatment and RNA extraction

Fasting, water deprivation and mouth rinse are forbidden 2h before saliva collection. After collecting 5ml of saliva using a 50ml centrifuge tube and centrifuging at 3000 Xg for 15 minutes at 4 degrees Celsius, the supernatant was removed using RNase-free and bacteria-free tips and placed in RNase-free and bacteria-free EP tubes. Thereafter, the cells were centrifuged again at 12000 Xg at 4 ℃ for 10 minutes, and the supernatant was taken out using a sterile enzyme-free tip and stored at-80 ℃ in a sterile enzyme-free EP tube for use as a saliva supernatant. Whole saliva is saliva that has not been centrifuged. RNA in all samples was extracted and purified by a microRNA column extraction Kit (miRNeasy Serum/Plasma Kit, cat # 217184) from Qiagen technologies, Germany, according to the procedure described in the specification.

1. The concentration of saliva microRNA is low, about 25-40 ng/ul;

a260/280 is 1.4-1.6;

3, cDNA synthesis adopts microRNA fluorescent quantitative PCR reverse transcription kit (Bulge-Loop)^TMmiRNA qRT-PCR Starter Kit, cat No.: r10039.2): 10ul reverse transcription reaction system: 2ul of RNA stock solution, 1ul (5uM) of reverse transcription primer, 2ul of 5x reverse transcription Buffer, 2ul of RTase Mix, Nase-free H₂O3 ul; the reverse transcription primer sequences are shown in table 1;

RT reaction temperature parameters: 60min at 42 ℃ and 10min at 70 ℃.

TABLE 1 reverse transcription primer sequences

Three, real-time fluorescent quantitative PCR (SYBR dye method)

MicroRNA real-time fluorescence quantitative PCR kit (Bulge-Loop) using Chinese Guangzhou Ruibo Biotechnology Ltd^TMmiRNA qRT-PCR Starter Kit, cat No.: r10039.2) respectively amplifying hsa-miR-1183, hsa-miR-3654, hsa-miR-134-3p, hsa-miR-15b-5p, hsa-miR-23b-5p (target microRNA) and exogenous cel-miR-39; ct values (cycle threshold) were obtained, respectively, by the formula: and (3) respectively calculating the expression level of microRNA of each sample when the expression quantity is 2Ct (cel-miR-39) -Ct (target microRNA), wherein the specific operation process is shown in the kit instruction. Three replicates per sample were performed. The basic information of hsa-miR-134-3p and hsa-miR-15b-5p is shown in Table 2.

1. An amplification reaction system: (20ul system): RT reaction product 2ul, SYBR Green Mix 10ul, miRNA Forward primer (5uM)0.8ul, miRNA Reverse primer (5uM)0.8ul, ddH₂O6.4 ul; the primer sequences are shown in Table 3.

2. Reaction conditions are as follows: pre-denaturation at 95 deg.C for 10min, denaturation at 95 deg.C for 2s, annealing at 60 deg.C for 20s, and extension at 70 deg.C for 10 s;

3. the Realtime PCR amplification curves of the miRNA to be detected and the exogenous cel-miR-39 are S-shaped;

and 4, melting curves of PCR products are all unimodal, which shows that the amplified target gene has good specificity and reliable results.

TABLE 2 basic MicroRNA information

ID	Sequence	Accession number	SEQ ID No
				hsa-miR-134-3p	ccugugggccaccuagucaccaa	MIMAT0026481	SEQ ID No.1
hsa-miR-15b-5p	uagcagcacaucaugguuuaca	MIMAT0000417	SEQ ID No.2

TABLE 3 primer sequences

Fourth, statistical analysis method

Statistics were performed using statistical software SPSS 19.0. The positive Test adopts a Shapiro-Wilk method, and the significant difference is evaluated by using a Mann-Whitney Test (Mann-Whitney Test), a working characteristic curve (ROC curve for short) and an area under line (AUC) to evaluate the screening efficiency of each microRNA (hsa-miR-134-3p and hsa-miR-15b-5 p). Statistical differences were considered when P < 0.05. Wherein the AUC reflects the predicted efficiency (AUC is 0.5, no predicted efficiency; AUC < 0.5 is less than 0.7; AUC < 0.7 is more than 0.9, rather accurate predicted value; AUC < 0.9 is less than 1, rather accurate predicted value).

Fifth, result analysis

1. FIG. 1 is a comparison of the levels of hsa-miR-134-3p expression in saliva supernatants of AMS-susceptible and healthy controls; as shown in FIG. 1, there was a statistically significant difference between AMS-susceptible individuals and healthy controls in which P was < 0.001 in the expression level of hsa-miR-134-3P in saliva supernatant. Wherein AMS is an AMS susceptible subject and health is a Healthy control. When P is less than 0.05, the statistical difference is significant, when P is less than 0.01, the statistical difference is very significant, and when P is less than 0.001, the statistical difference is very significant.

2. FIG. 2 is a graph showing the working characteristics of hsa-miR-134-3p in the saliva supernatant of AMS-susceptible individuals. As shown in FIG. 2, the screening efficiency of hsa-miR-134-3p in saliva supernatant on AMS susceptible persons and healthy controls is shown by an ROC curve, and the screening efficiency of hsa-miR-134-3p in saliva on AMS susceptible persons and healthy controls is very good, wherein AUC is 0.767 (95% CI, 0.683-0.838). The ROC curve, area under the curve (AUC), sensitivity, specificity (specificity) of AMS susceptibilities are well shown in this figure, where AUC reflects the screening efficacy. It is generally accepted that the highest AUC tested, the better the diagnostic value. Fully indicates that the hsa-miR-1183 in the plasma has certain accuracy and feasibility when being used as a biomarker for screening AMS susceptible persons independently. Table 4 shows the working characteristic curve data of each microRNA (hsa-miR-134-3p, hsa-miR-15b-5p) in saliva and saliva supernatant of healthy people and AMS susceptible people. Table 5 is the correlation of each microRNA expression level in saliva and saliva supernatants with the clinical severity of AMS disease.

Table 4 operating characteristic curve data

Table 5 correlation of salivary microRNA expression levels with clinical severity of AMS disease (n 124).

Wherein LLS: (ii) a lewis lake score; S-miR-134-3 p: miR-134-3p (miR-134-3p in saliva supernatant) in saliva supernatant; S-miR-15b-5 p: miR-15b-5p (miR-15b-5p in saliva supernatant) in saliva supernatant; W-miR-134-3 p: miR-134-3p (miR-134-3p in saliva supernatant) in whole saliva; W-miR-15b-5 p: the attached figure of miR-15b-5p (miR-15b-5p in saliva supernatant) in the whole saliva is consistent with the mark in the specification. From table 2, it can be seen that saliva supernatant microRNA has a higher correlation with AMS severity (louisis lake score, LLS), and is more suitable for saliva detection. The whole saliva possibly contains food residues, oral exfoliative cells, saliva protein and the like, so that the expression quantity of MicroRNA in the saliva is interfered, the microRNA in saliva supernatant obtained by all data in a comprehensive mode can reflect the human condition better, the saliva microRNA detection sample is more suitable for being used as a saliva microRNA detection sample, and the result is more accurate.

3. FIG. 3 is a comparison of the levels of hsa-miR-15b-5p expression in saliva supernatants of AMS-susceptible and healthy controls; as shown in FIG. 3, there was a statistically significant difference between AMS-susceptible subjects and healthy controls in which P was < 0.001 compared to the expression level of hsa-miR-15b-5P in plasma.

4. FIG. 4 is a graph of the working characteristics of hsa-miR-15b-5p in saliva supernatant from AMS-susceptible individuals. As shown in FIG. 4, the screening efficiency of plasma hsa-miR-15b-5p on AMS susceptible persons and healthy controls can be known from an ROC curve that hsa-miR-3654 has good screening efficiency on AMS susceptible persons and healthy controls, wherein AUC is 0.703 (95% CI, 0.614-0.782).

5. FIG. 5 is a combined working characteristic curve of hsa-miR-134-3p and hsa-miR-15b-5p in saliva supernatant. The screening efficiency of two microRNA molecules on AMS susceptible persons and healthy controls is better, and the AUC is respectively as follows: 0.767 (95% CI,0.683-0.838), 0.703 (95% CI, 0.614-0.782). From the ROC curve of screening efficiency between AMS susceptible persons and healthy controls of the combination of the two microRNAs in FIG. 5, it can be known that the screening efficiency between AMS susceptible persons and healthy controls of the combination of the two microRNAs in saliva is better than that of the combination of the two microRNAs in saliva, which is better than that of the combination of the two microRNAs in single use, and the AUC is 0.811

(95％CI,0.731-0.876)。

6. FIG. 6 is a comparison of the expression levels of hsa-miR-134-3p in whole saliva for AMS-susceptible and healthy controls; as shown in FIG. 6, there was a statistically significant difference between AMS-susceptible and healthy controls in P < 0.001, compared to the expression of hsa-miR-134-3P in whole saliva.

7. FIG. 7 is a graph of the working characteristics of hsa-miR-134-3p in whole saliva of AMS-susceptible individuals. As shown in FIG. 7, the ROC curve shows that the screening efficiency of hsa-miR-134-3p in whole saliva on AMS susceptible persons and healthy controls is very good, wherein the AUC is 0.747 (95% CI, 0.662-0.821).

8. FIG. 8 is a comparison of the expression levels of hsa-miR-15b-5p in whole saliva for AMS-susceptible and healthy controls; as shown in fig. 8, P ═ 0.042 compared with the expression level of miR-15b-5P in whole saliva between AMS-susceptible and healthy controls, was statistically significantly different.

9. FIG. 9 is a graph of the working characteristics of hsa-miR-15b-5p in whole saliva of AMS-susceptible individuals. As shown in FIG. 9, the ROC curve shows that the screening efficiency of hsa-miR-134-3p in whole saliva for AMS-susceptible patients and healthy controls is very good, wherein the AUC is 0.601 (95% CI, 0.51-0.688).

The inventor firstly carries out comparative analysis on microRNA expression profiles in saliva of 20 AMS patients and 15 healthy controls, screens microRNA related to AMS susceptibility, further analyzes the expression quantity of each microRNA in plasma samples of 75 AMS susceptible persons and saliva samples of 49 normal persons through a large amount of creative work, finds that in the saliva, particularly hsa-miR-134-3p and hsa-miR-15b-5p in saliva supernatant have good screening efficiency on AMS susceptible persons and healthy controls, and jointly determines the morbidity risk of more accurate screening of the two microRNAs of hsa-miR-134-3p and hsa-miR-15b-5 p.

Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, although the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.

Sequence listing

<110> China people liberation army, military and medical university

<120> microRNA molecular marker for screening saliva of acute altitude stress susceptible person and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ccugugggcc accuagucac caa 23

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

uagcagcaca ucaugguuua ca 22

<210> 3

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactt ggtga 55

<210> 4

<211> 55

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gtcgtatcca gtgcgtgtcg tggagtcggc aattgcactg gatacgactg taaac 55

<210> 5

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

cctgtgggcc acctagtc 18

<210> 6

<211> 17

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

tagcagcaca tcatggt 17

<210> 7

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

cagtgcgtgt cgtggagt 18

<210> 8

<211> 18

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

cagtgcgtgt cgtggagt 18

Claims (8)

1. A microRNA molecular marker for screening saliva of a person susceptible to acute altitude stress is characterized in that the microRNA molecular marker is hsa-miR-134-3p and hsa-miR-15b-5 p.

2. The microRNA molecular marker for screening saliva of a susceptible person with acute altitude stress of claim 1, wherein the sequence of the hsa-miR-134-3p is shown as SEQ ID NO: 1, the sequence of the hsa-miR-15b-5p is shown as SEQ ID NO: 2, respectively.

3. The microRNA molecular marker for screening saliva of a susceptible to acute altitude stress as set forth in claim 1 or 2, wherein the expression of the microRNA in saliva is down-regulated compared with the expression in a control.

4. The microRNA molecular marker for screening saliva of a susceptible to acute altitude stress as claimed in claim 3, wherein the saliva is saliva supernatant.

5. Use of the microRNA molecular marker of any one of claims 1 to 4 in preparation of a reagent or a kit for screening a susceptible person of acute altitude reaction.

6. The kit for screening the susceptible to acute altitude reaction prepared from the microRNA molecular marker according to any one of claims 1 to 4, wherein the kit comprises primers capable of specifically binding with the reverse transcription products of hsa-miR-134-3p and hsa-miR-15b-5p and performing PCR amplification.

7. The kit of claim 6, further comprising a miRNA RT reaction comprising, per 10 μ L: reverse transcription primer 1. mu.L, 5 × reverse transcription Buffer 2. mu.L, RTase Mix 2. mu.L, RNase-free H₂O3. mu.L, and the remaining 2. mu.L are sample RNA.

8. The kit of claim 6, further comprising a miRNA qPCR reaction comprising, per 20 μ L: SYBR Green Mix 10. mu.L, miRNA forward primer 0.8. mu.L, miRNA reverse primer 0.8. mu.L, ddH₂O6.4. mu.L, the remainder being 2. mu.L of RT reaction product.

Images