CN107058475B

CN107058475B - Kit for diagnosing acute mountain sickness by combining miR-676, miR-181b and miR-193b

Info

Publication number: CN107058475B
Application number: CN201611002912.8A
Authority: CN
Inventors: 陈建; 刘宝; 孙滨达; 黄河; 高钰琪
Original assignee: Army Medical University
Current assignee: Army Medical University
Priority date: 2016-11-03
Filing date: 2016-11-03
Publication date: 2020-10-27
Anticipated expiration: 2036-11-03
Also published as: CN107058475A

Abstract

The invention relates to a microRNA marker for detecting acute mountain sickness and application thereof in preparation of an acute mountain sickness detection kit. The content of microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p in blood of a tested person is detected by a quantitative PCR method and the like, and the acute mountain sickness is diagnosed by comparing with the normal microRNA level.

Description

Kit for diagnosing acute mountain sickness by combining miR-676, miR-181b and miR-193b

Technical Field

The invention relates to the technical field of medical molecular biology, in particular to a method for diagnosing acute mountain sickness by using microRNA in blood plasma as a biomarker.

Background

Acute Mountain Sickness (AMS), also known as acute mild altitude sickness, is a physical reaction of a person to headache, anorexia, nausea, vertigo and fatigue caused by an unadapted natural environment of the altitude. Is the most common plateau special disease in the population who rapidly enters the plateau. The incidence of AMS is 16-100% (MacInnis M J et al (2013) A prospectogenic ecological study of ingredient in recent years to High availability (4380M), < PLoS One >, 8(10), < e75644 >, McDegit M et al (2014) Risk inhibitors of ingredient in recent hilla, < a 24-yellow-up > < Wilderness > < M > 25 < 2 > < 152-9 >, 9 > tissue in tissue and < a 5 > ingredient in tissue and for < a 5 > random study of ingredient in this group, 3 </a > ingredient and < a 5 > random study of ingredient in this group, and < a > random study of ingredient-5 > < A > 3-yellow-up < M > and 2 5 > 3 and 3 >, the median incidence of AMS is 60% (Waeber B et al (2015) Impact of Study Design on Reported inclusion of acid Mountain bench seal: A Systematic Review, High Alt Med Biol, 16(3), 204-15.), which is a major obstacle affecting the life and work of people who are in the urge to go into the plateau. AMS, if not effectively controlled in a timely manner, may progress to High altitude cerebral edema with High lethality and thus life threatening (Basnyat B and Murdoch D R (2003) High-altitude illiness, Lancet, 361(9373), 1967-74.).

Despite the extensive research on the diagnosis of AMS in recent years, AMS is diagnosed at present at home and abroad by scoring mainly according to the severity of relevant clinical symptoms exhibited by patients, and the existing symptom scoring diagnostic systems include an environmental symptom questionnaire scoring diagnostic system proposed in 1980, a national military standard GJB1098-91 of the people's republic in 1991, an international diagnostic standard of Louis lake in Canada in 1993, and an acute mild altitude disease symptom scoring and scoring system established by the Chinese medical society on the basis of the national military standard in 1995. Because symptom scores have larger subjectivity, finding more reliable objective diagnosis indexes becomes a further research hotspot for AMS diagnosis.

MicroRNA is a kind of endogenous small molecular non-coding RNA widely existing in eukaryote, and the length of the MicroRNA is 18-24 nucleotides. MicroRNA inhibits the expression of target genes horizontally after transcription, regulates and controls the vital activities of cell differentiation, proliferation, apoptosis and the like, and plays an important role in various physiological and pathological processes such as embryonic development, body metabolism, disease occurrence and development and the like. In recent years, researchers have proposed the concept of circulating microRNA by detecting microRNA in various body fluids such as blood, saliva, and urine. In addition, the expression level of the microRNA is highly related to the difference of the genetic genes of the microRNA, and a large number of researches show that the circulating microRNA has good specificity and sensitivity on the advanced diagnosis and disease prediction of tumors, hypertension, stroke and a series of diseases. In addition, body fluid samples such as blood and the like are easy to obtain, the clinical operability is strong, the wound is small, the stability of the circulating microRNA is good, and the detection is convenient, so that the circulating microRNA has the potential of serving as an AMS noninvasive biomarker.

However, no report has been made on the correlation between circulating microRNA and AMS pathogenesis.

No report for detecting the expression levels of microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p in plasma to diagnose the AMS pathogenesis is found. Similarly, no 3 combined diagnoses have been reported.

Disclosure of Invention

The invention aims to solve the technical problem of providing a microRNA marker for detecting AMS (human immunodeficiency Virus), which is used for diagnosing AMS (human immunodeficiency Virus) by detecting the contents of microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p in serum or plasma of a detected person and respectively comparing the contents with the levels of microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p in normal human serum or plasma, wherein the microRNA has high sensitivity and accuracy

The technical scheme for solving the technical problems is as follows: a microRNA marker for diagnosing AMS, which is characterized by comprising the following sequences:

microRNA-676-3p：CUGUCCUAAGGUUGUUGAGUU

microRNA-181b-5p：AACAUUCAUUGCUGUCGGUGGGU

microRNA-193b-5p：CGGGGUUUUGAGGGCGAGAUGA

the invention has the beneficial effects that: the screened microRNA marker is used for detecting AMS, and the accuracy and the sensitivity are high.

Furthermore, on the basis of the technical scheme, the invention can be further improved as follows.

The invention also comprises the application of the microRNA marker for diagnosing AMS in preparing an AMS diagnostic reagent.

Drawings

FIG. 1. expression levels of microRNAs of interest (microRNA-676-3p, microRNA-181b-5p, microRNA-193b-5p) in plasma of AMS-sick persons and healthy controls (i.e., normalized levels of microRNAs of interest compared to cel-miR-39).

Wherein AMS is the patient with AMS and non-AMS is the healthy control. *: p < 0.05, i.e. there was a significant statistical difference, x: p < 0.01, i.e. there were very significant statistical differences, x: p is less than 0.001, namely, the statistical difference is very significant.

FIG. 2 is a ROC curve showing the characteristic curve of AMS patient plasma 3 objective microRNA alone for diagnosis, wherein the curve shows the ROC curve, area under the curve (AUC), sensitivity (sensitivity), and specificity (specificity), wherein AUC reflects the diagnostic efficacy (AUC is 0.5, no diagnostic efficacy; AUC < 0.5, very small diagnostic value; AUC < 0.7 < 0.9, very accurate diagnostic value; 0.9 < AUC < 1, very accurate diagnostic value).

FIG. 3 is a working characteristic curve (ROC curve for short) of AMS patient plasma 3 target microRNAs (microRNA-676-3p, microRNA-181b-5p, microRNA-193b-5p) combined diagnosis, which well shows the ROC curve, area under the curve (AUC), sensitivity and specificity of AMS patients.

Detailed Description

The present invention will now be described with reference to the accompanying drawings, which illustrate examples only for the purpose of illustrating the present invention and do not limit the scope of the present invention.

Example 1 correlation study of AMS onset and expression of microRNA (microRNA-676-3p, microRNA-181b-5p, and microRNA-193b-5p) of plasma specimens.

Description of Material and specimen Collection

AMS patient plasma specimens were collected from AMS patients in the population of the eager-to-altitude, totaling 37. Plasma specimens of normal population were collected from normal healthy population in the fast-advancing plateau population for a total of 31 cases. Diagnosis of AMS was confirmed by the International Universal diagnostic Standard-Louis lake score. AMS patients did not take any medications prior to blood draw. Each sample was pooled into 2ml of blood using an EDTA-Na anticoagulation tube.

Second, sample treatment and RNA extraction

After centrifugation at 3000 Xg for 10 minutes at 25 ℃ within 10min after venous blood collection, the supernatant plasma was taken with RNAse-free and bacteria-free tips and stored at-80 ℃ in RNAse-free and bacteria-free EP tubes for later use. RNA in Plasma was extracted and purified by a Plasma microRNA column extraction Kit (miRNeasy Serum/Plasma Kit, cat # 217184) from Qiagen technologies, Germany, according to the procedure described in the specification.

Three, real-time fluorescent quantitative PCR (SYBR dye method)

Using pharmaceutical technology of Shanghai Jima, ChinaA microRNA real-time fluorescent quantitative PCR Kit (Hairpin-itTMmiRNAs RT-PCR quantification Kit, the product number is E01008) is used for amplifying target microRNA and external reference cel-miR-39; ct values (cycle threshold) were obtained, respectively, by the formula: expression quantity 2^Ct(cel ^{-miR-39) -Ct (microRNA of interest)}The expression level of the target microRNA of each sample is calculated, and the specific operation process is shown in the specification. Three replicates per sample were performed. The sequences of the target microRNA and cel-miR-39 primers are shown in Table 3.

And fourthly, a statistical analysis method.

Statistics were performed using statistical software SPSS 19.0. The Shapiro-Wilk method is adopted in the normality Test, and the Mann-Whitney Test (Mann-Whitney Test), a working characteristic curve (ROC curve for short) and an area under a line (AUC) are used for evaluating the diagnostic efficiency of the target microRNA. Statistical differences were considered when p < 0.05.

And establishing a correlation equation of the target microRNA by using binary logistic regression to obtain a prediction probability P, carrying out ROC curve analysis by using the prediction probability P as a test variable, and further evaluating the diagnosis efficiency of the target microRNA joint application. Statistical differences were considered when p < 0.05.

Fifth, result analysis

Expression of microRNA-3591-3p in AMS and normal population

As shown in FIG. 1, the normalized levels of plasma microRNAs of interest (microRNA-676-3P, microRNA-181b-5P, microRNA-193b-5P) compared to the level of exogenous cel-miR-39 were significantly different between AMS-affected group and normal group (P < 0.001).

The level of target microRNA (microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p) in AMS can be used as a diagnostic value of a biomarker, and the combined diagnostic efficacy is better than that of single use.

The diagnostic efficacy of the plasma target microRNAs (microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p) of the AMS patient as the biomarkers alone can be known by an ROC curve (figure 2). The diagnosis of AMS patient plasma microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p which are individually used as biomarkers is good, and the AUC is respectively: 0.713 (95% CI, 0.588-0.838), 0.735 (95% CI, 0.614-0.855), 0.650 (95% CI, 0.519-0.780).

The combined use of the microRNA-676-3p, the microRNA-181b-5p and the microRNA-193b-5p has better diagnostic efficiency than the single use, and the AUC of the diagnostic efficiency used as the biomarker is 0.804 (95% CI, 0.703-0.905) according to the ROC curve (figure 3).

Sixth, conclusion

The levels of microRNA-676-3p, microRNA-181b-5p and microRNA-193b-5p in blood can be used as biomarkers to screen and diagnose AMS, and the combined use of the diagnostic efficacy is better than that of single use.

TABLE 1 expression levels of plasma microRNAs of interest in AMS-affected and healthy controls

AMS disease group VS healthy control group: p is less than 0.01, and the data is shown by median (25% -75% quantile)

TABLE 2 basic MicroRNA information

TABLE 3 destination and cel-miR-39 primer information

Claims

1. The application of the primers for detecting the expression levels of the microRNA-676-3p, the microRNA-181b-5p and the microRNA-193b-5p in the preparation of the diagnostic kit for the acute mountain sickness susceptible is characterized in that the sequence of the microRNA-676-3p is shown as SEQ ID NO. 1, the sequence of the microRNA-181b-5p is shown as SEQ ID NO. 2, and the sequence of the microRNA-193b-5p is shown as SEQ ID NO. 3.