CN114181839B - Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof - Google Patents
Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof Download PDFInfo
- Publication number
- CN114181839B CN114181839B CN202111491037.5A CN202111491037A CN114181839B CN 114181839 B CN114181839 B CN 114181839B CN 202111491037 A CN202111491037 A CN 202111491037A CN 114181839 B CN114181839 B CN 114181839B
- Authority
- CN
- China
- Prior art keywords
- strain
- spodoptera frugiperda
- nomuraea rileyi
- rileyi
- nomuraea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
Abstract
The invention discloses a Nomuraea rileyi NrSfaduli 202104 strain and a preparation method and application thereof, the Nomuraea rileyi NrSfaduli 202104 strain is Nomura rileyi, which is a Nomuraea rileyi strain and is deposited as Nomura rileyi; is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation address is No. 3 of Xilu No.1 of Beijing, Chaoyang district; the preservation date is as follows: 21/6/2021; the preservation number is as follows: CGMCC No. 22480. The Nomuraea rileyi NrSfadult202104 provided by the invention is a biocontrol fungus which can be used for preventing and controlling agricultural pests, namely spodoptera frugiperda, has the characteristics of strong pathogenicity to imagoes of spodoptera frugiperda, safety to the environment and difficulty in causing the pests to generate drug resistance, and can be used for biologically preventing and controlling the spodoptera frugiperda.
Description
Technical Field
The invention relates to the technical field of microorganisms, and particularly relates to a Nomuraea rileyi NrSfadult202104 strain and a preparation method and application thereof.
Background
Spodoptera frugiperda (j.e. smith), also known as fall armyworm, is a lepidoptera Spodoptera frugiperda pest, native to the tropical and subtropical regions of america, is a food impurity, and particularly prefers to eat and harm corn, and is especially harmful to corn. Since the corn field is found in Jiangcheng county of Puer City in Yunnan province in 2019 for the first time, the corn field has spread to 22 provinces and cities in China, seriously harms crops such as corn and the like, and becomes an important factor seriously influencing the development of the corn industry in China. In the 'regulation for preventing and controlling crop diseases and insect pests' issued in 2020 of China, the insect is listed as the first ten pests in China.
Nomuraea rileyi (also called Metarrhizium limacinum) belongs to Clavicipitaceae fungus of Ascomycota, is a entomogenous fungus with good biocontrol potential for Lepidoptera larvae, and can cause epidemic of pests in pest population under suitable environmental conditions, thereby effectively preventing and controlling the pests. The bacterium is reported to have strong infectivity on larvae of lepidopteran pests such as prodenia litura and cotton bollworm. However, Nonomuria lachnsonii which has strong pathogenicity to spodoptera frugiperda and can be used for biological control of spodoptera frugiperda is not seen at present.
In the prior art, the control of spodoptera frugiperda mainly depends on the control of chemical pesticides, however, the use of a large amount of chemical pesticides causes the spodoptera frugiperda to have strong resistance to a plurality of pesticides, and therefore, a new challenge is brought to the control of the pests. In addition, the adoption of chemical pesticides for prevention and treatment can bring about the risks of pesticide residues, potential safety hazards of people and livestock and ecological environment influence. Therefore, the search for green, safe, efficient and continuous measures for preventing and controlling Spodoptera frugiperda is imperative.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides a Nomuraea rileyi NrSfadult202104 strain and a preparation method and application thereof.
In order to solve the problems of the prior art, the invention provides the following technical scheme: the invention relates to a Nomuraea rileyi NrSfadult202104 strain, which is characterized in that: the strain is Nomuraea rileyi with the preservation name of Nomuraea rileyi; is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation address is No. 3 of Xilu No.1 of Beijing, Chaoyang district; the preservation date is as follows: 21/6/2021; the preservation number is: CGMCC No. 22480.
Further, the ITS gene sequence of the Nomuraea rileyi NrSfadult202104 strain is the nucleotide sequence of SEQ ID No. 1.
Further, when the bacterial strain is cultured on an SDAY culture medium at 25 ℃ to 15d, the diameter of a bacterial colony is 12.26-12.34 mm, the front side of the bacterial colony is white and villous, the middle part of the bacterial colony is slightly raised, the color of the back side of the bacterial colony is changed from light brown to dark brown from the edge to the center, and the color of the back side of the bacterial colony is changed into black brown from yellow brown to 1/2 in the center; the hypha of the fungus is smooth and has separation, and the diameter of the hypha is 2-3 mu m; the conidiophores are upright and take the shape of grape spikes; the growth spore is oblong, has smooth surface, one sharp end and one blunt end, and has a size of 4.63 μm × 2.12 μm.
The Nomuraea rileyi NrSfaduli 202104 strain microbial inoculum prepared from Nomuraea rileyi NrSfaduli 202104 strain Spodoptera frugiperda imago Nomura 202104 is provided.
Further, the active ingredient is at least one of the following (a), (b) and (c):
(a) a primary extract of a fermentation broth of a culture of said Nomuraea rileyi NrSfadult202104 strain;
(b) ultrasonic cracking supernatant of the obtained Nomuraea rileyi NrSfadult202104 strain cells;
(c) ultrasonic lysis of the cells of the obtained Nomuraea rileyi NrSfadult202104 strain.
The invention relates to a preparation method of a Nomuraea rileyi NrSfadult202104 microbial inoculum, which is characterized by comprising the following steps:
(1) separating wild Nomuraea rileyi strain from collected adult spodoptera frugiperda, culturing in Saccharomy medium, transferring conidium to newly prepared SDAY medium, and purifying;
(2) then carrying out single spore separation to obtain purified Nomuraea rileyi NrSfadult 202104;
(3) placing Spodoptera frugiperda imago at a concentration of 1.0 × 10 8 Spraying and inoculating the spore suspension of Nomuraea rileyi NrSfadult202104 per mL, and spraying 2-3mL spore suspension to each adult to obtain the Nomuraea rileyi NrSfadult202104 microbial inoculum.
The Nomuraea rileyi NrSfadult202104 microbial inoculum is applied to the prevention and control of Spodoptera frugiperda (J.E.Smith).
Has the advantages that: the Nomuraea rileyi NrSfadult202104 provided by the invention is a biocontrol fungus which can be used for preventing and controlling agricultural pests, namely spodoptera frugiperda, has the characteristics of strong pathogenicity to imagoes of spodoptera frugiperda, safety to the environment and difficulty in causing the pests to generate drug resistance, and can be used for biologically preventing and controlling the spodoptera frugiperda.
Compared with the prior art, the invention has the following advantages: (1) the isolated Nomuraea rileyi NrSfadult202104 strain is a fungus strain with strong pathogenicity to Spodoptera frugiperda.
(2) The Nomuraea rileyi NrSfadult202104 strain is simple in culture, rapid in growth, large in spore yield, high in spore germination rate and easy to culture and propagate in a large scale indoors.
(3) The Nomuraea rileyi NrSfadult202104 provided by the invention is a biocontrol fungus which can be used for green control of Spodoptera frugiperda imagoes, has the characteristics of strong pathogenicity to the Spodoptera frugiperda imagoes, no environmental pollution and difficult generation of drug resistance of pests, and can be widely used for biological control of Spodoptera frugiperda.
Drawings
FIG. 1 is a diagram of a Nomuraea rileyi NrSfadult202104, an adult Spodoptera frugiperda of the present invention; a to c: symptoms of adult Spodoptera frugiperda infection; d-h spodoptera frugiperda larva infection symptom.
FIG. 2 is a morphological diagram of the colony of Metarrhizium lepigone NrSfadult202104 of the present invention.
FIG. 3 is a morphological diagram of conidia of Metarrhizium flexuosum NrSfadult202104 of the present invention.
Detailed Description
The following embodiments are described in detail with reference to the accompanying drawings, so that how to implement the technical features of the present invention to solve the technical problems and achieve the technical effects can be fully understood and implemented.
Entomopathogenic fungi are a class of fungi that infect insects through the insect's body surface and multiply on and in the body, resulting in the death of the insect. Because of being environment-friendly, has continuous control capability on pests and is not easy to generate drug resistance, the pesticide is considered to be the next generation of novel biological pesticide most likely to replace chemical pesticide.
Example 1
The Nomuraea rileyi NrSfadult202104 strain is Nomuraea rileyi, which is deposited under the name Nomuraea rileyi; is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation address is No. 3 of Xilu No.1 of Beijing, Chaoyang district; the preservation date is as follows: 21/6/2021; the preservation number is: CGMCC No. 22480.
The ITS gene sequence of the Nomuraea rileyi NrSfadult202104 strain is a nucleotide sequence shown in SEQ ID No.1 (as follows).
>NrSfadult202104
GGGGTTTGGGTACTCCAACCCCATGTGACTTATACCCTTTTCCTGTTGCCTCGGCGGGTCATTTGCCCCGGACCGGGCTCGTCCAGAGCCCGCCCGGAAACAGGCGCCCGCCGCGGGACCGAAACTCTGTATCTCTTAGCCTTTGGCACGTCTGAGTGGAATCATACAAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGCGGTTTGGTGTTGGGGGCCGGCAATTGTCAGCTGGGCCGCTCATGCGGTTCCCTGCGGCGCCGCCCCCGAAATGAATTGGCGGCCCCGTCGCGAACTCCTCTGCGTATTAGCACAACCTCGCAACAGGAGCTCGGCGCGGCCACTGCCGTAAAACGCACAAACTTCTCCAAGAGTTGACCTCTAATCATGTATGAATACCCGCTGAACTTAAGCATATCTATAAGCGGAGGCACCACATCA
The Nomuraea rileyi NrSfadul 202104 strain microbial inoculum prepared by the Nomuraea rileyi NrSfadul 202104 strain is provided.
The active component is at least one of the following components (a), (b) and (c):
(a) a primary extract of a fermentation broth of a culture of said Nomuraea rileyi NrSfadult202104 strain;
(b) ultrasonic cracking supernatant of the obtained Nomuraea rileyi NrSfadult202104 strain cells;
(c) ultrasonic lysis of the cells of the obtained Nomuraea rileyi NrSfadult202104 strain.
The preparation method of the Nomuraea rileyi NrSfadult202104 microbial inoculum is characterized by comprising the following steps:
separating wild Nomuraea rileyi strain from collected adult spodoptera frugiperda, culturing in Sachs culture medium, transferring conidium to newly prepared SDAY culture medium, purifying, and performing single spore separation to obtain purified Nomuraea rileyi NrSfadult 202104. Placing the spodoptera frugiperda imagoes into a spore suspension of the Nomuraea rileyi NrSfadult202104 with the concentration of 1.0 multiplied by 108 spores/mL for spray inoculation, and spraying 2-3mL spore suspension to each imagoes to prepare the Nomuraea rileyi NrSfadult202104 microbial inoculum.
The Nomuraea rileyi NrSfadult202104 microbial inoculum is applied to the prevention and control of Spodoptera frugiperda (J.E.Smith).
Test example 1
Isolation and characterization of Nomuraea rileyi NrSfadult202104
The inventor collects Nomuraea rileyi NrSfadult202104 strain from adult Spodoptera frugiperda in Hongyu disease-bearing grassland in Midu county, university City, Yunnan province at 10/4 in 2021. After the imago bodies of spodoptera frugiperda which is naturally suffered from diseases in the field are investigated and collected, separation, purification, virulence determination and screening are carried out, the bacteria are found to have strong pathogenicity to the imago bodies of spodoptera frugiperda, and the infection pathogenicity of the Nomuraea rileyi NrSfadul 202104 strain to the imago bodies of spodoptera frugiperda is higher than that of the Metarrhizium leprae MRJCBT190808 strain found by the group.
The following provides a test example of the metarhizium reinhardtii NrSfadult202104 provided by the invention and application thereof in control of spodoptera frugiperda.
1.1 materials
1.1.1 test strains
The strain is collected from adult Spodoptera frugiperda in Hongyuan county of Midu city, university of Yunnan province 12 months and 11 days in 2020.
1.1.2 isolation and culture of the Strain
Collected spodoptera frugiperda bodies suffering from diseases are placed in a 5mL sterile EP tube and brought back to a laboratory, and cultured on an SDAY culture medium (40 g of glucose, 10g of peptone, 10g of yeast extract powder, 20g of agar, 1000mL of natural pH) by a streaking method in an illumination incubator with the temperature of (25 +/-1) ° C, the relative humidity of (75% +/-1%) and the L// D of 14h//10 h. After culturing for 7 days, the conidia are transferred to a new culture medium for purification. The purified strain was stored in a 4 ℃ freezer using SDAY slant medium.
1.1.3 colony morphology Observation
The separated and purified fungi are respectively inoculated on SDAY culture medium (40 g of glucose, 10g of peptone, 10g of yeast extract powder, 20g of agar, 1000mL, natural pH), placed in a light incubator with the temperature of 25 +/-1 ℃ and the L/D of 16 h/8 h for culture, and the colony diameter is respectively measured and the colony morphology characteristics are observed at 3 days, 7 days and 14 days.
1.2 results
After obtaining the pure culture metarhizium reinhardtii NrSfadult202104 strain, the morphological characteristics of the strain are identified. As a result, when the bacterium was cultured on SDAY medium at 25 ℃ to 15d, the diameter of the colony was 12.26 to 12.34mm, the front surface of the colony was white and fluffy, the middle part was slightly convex, the color of the back surface was changed from light brown to dark brown from the edge to the center, and the color was changed from tan to dark brown at 1/2 (FIG. 2). The hypha of the fungus is smooth and has separation, and the diameter of the hypha is 2-3 mu m; conidiophores are upright and shaped like grape spikes (figure 3); the spore has elliptic shape, smooth surface, one tip and one blunt end, and has size of 4.63 μm × 2.12 μm.
Test example 2
Determination of pathogenicity of Nomuraea rileyi NrSfadult202104 to Spodoptera frugiperda
1 Material
1.1.1 test insects
Spodoptera frugiperda was collected from Hongyuan corn field in Midu county, Dali, Yunnan province and continuously raised indoors for 3 generations, and the test was conducted in an intelligent artificial incubator (RG-300) under the conditions of a temperature of 25 + -1 deg.C, a Relative Humidity (RH) of 60 + -5%, and a light period L: D of 16: 8. Feeding Spodoptera frugiperda larvae with fresh corn leaves, allowing the larvae to develop into pupae after molting for 5 times, and feeding the pupae in an intelligent artificial incubator (RG-300) under the conditions of temperature of 25 +/-1 ℃, Relative Humidity (RH) of 60 +/-5% and photoperiod L: D of 16: 8 for 5 days to form imagoes. For use in bioassays.
1.1 spore suspension preparation
Inoculating the separated strain into SDAY culture medium, scraping conidia on the surface of the culture medium with sterile scalpel after the strain produces a large amount of conidia (about 20 days), placing in 0.02% sterile Tween-80, and making into 1.0 × 10 4 –1.0×10 8 spores/mL of spore suspension.
1.1.2 impregnation method
And (3) selecting healthy spodoptera frugiperda female and male adults with the same eclosion size on the same day, inoculating by adopting a spraying method, and selecting male and female adults with eclosion of spodoptera frugiperda 2 days for testing. The adult is inoculated by a spraying method, and each adult is sprayed with 2-3mL spore suspension. After inoculation, the male and female adults are respectively placed in self-made preservative film insect cages (20cm multiplied by 20cm), and honey water is added every day at regular time. Each set of experiments was set up with 3 replicates each adult treatment with 10 replicates. And regularly observing the death situations and infection situations of adults and larvae every day after inoculation, when dead insect bodies are found, timely placing the dead insect bodies in a sterilization culture dish with the bottom padded with sterilization filter paper and the diameter of 9cm, covering a dish cover, placing the dish cover in an illumination incubator with the temperature of (25 +/-1) ° C, the relative humidity of (80% +/-1%) and the L// D of 16h//8h for culture, regularly observing the growth situations of hyphae or conidia on the surface of the insect bodies every day, performing microscopic examination on the conidia and the hyphae forms, and determining the death reasons of the insects according to whether the insect bodies grow target bacteria.
1.1.3 data analysis
Excel 2010 is adopted for data arrangement, and the accumulated death rate is calculated by DPS data processing system 14.0 software.
2. Results
2.1 cumulative mortality of Spodoptera frugiperda adults
As can be seen from Table 1, the ratio was 1.0X 10 8 The cumulative mortality rate of the Spodoptera frugiperda male and female imagoes infected by the Metarrhizium laevis NrSfadult202104 on day 8 at the spore concentration of each mL is 61.10% and 55.30% respectively.In that1.0×10 8 At spore concentrations of one/mL, the mortality rates of Spodoptera frugiperda males and females were 13.33%, 29.60%, 86.68% and 96.67%, respectively, and 6.67%, 25.90%, 76.67% and 93.33%, respectively, at days 3, 5, 7 and 9 after inoculation. By the 10 th day, the mortality rate of male and female spodoptera frugiperda adults can reach 100.00%. Therefore, the Metarrhizium lepigone NrSfadult202104 has better pathogenicity on spodoptera frugiperda. The metarhizium Lai MRJCBT190808 strain found in Yiyi county of Qujing city, Yunnan province in 2019 in the subject group had strong pathogenicity to spodoptera frugiperda larvae of 3 years. Thus, the metarhizium reinhardtii strain NrSfadult202104 is the currently found metarhizium reinhardtii strain having the highest pathogenicity to spodoptera frugiperda. Cumulative mortality of metarhizium rilizi NrSfadult202104 to spodoptera frugiperda males and females (%) cumulative mortality of spodoptera frugiperda females (%) are shown in table 1:
TABLE 1
2.2 lethal dose Effect of Metarrhizium Laevigatum NrSfadult202104 on Spodoptera frugiperda
The pathogenicity determination result of 3-instar larvae shows that the pathogenicity of the strain to spodoptera frugiperda meets a time-dose mortality model, LT 50 The concentration of spore suspension is reduced with increase of concentration, and when the concentration is 1.0 × 10 7 Cumulative corrected mortality of larvae at individual spores/mL was 51.7%, LT 50 8.839 days; the concentration is 1.0 × 10 8 Cumulative corrected mortality of larvae at individual spores/mL was 76.7%, LT 50 The drop was 5.482 days (Table 2). The mortality rate of the other three concentrations is less than 50%, LT 50 It cannot be calculated.
At the initial stage of infection of 3 rd larva, the activity, feeding and morphological characteristics of the larva are the same as those of the larva in a control group. After the susceptible insect body dies, the body color changes from normal body color to reddish, and the insect body becomes rigid; performing moisture preservation culture on the polypide, and growing a trace amount of hyphae on the spiracles and internodes of the larvae on the 2 nd day; the abdominal node part of the polypide is basically covered by hypha on the 4 th day; after the culture for 6 days, white hyphae grow on the chest and abdomen of the polypide except the head; light green spores started to develop on day 8; until day 10, the whole polypide is full of spores and dark green. The virulence of Metarhizium rilizium Laevir strain XL-595 for spodoptera frugiperda 3-instar larvae at different spore concentrations (10d) is shown in Table 2:
TABLE 2
Note: where y is the probability value and x is the logarithm of time. (ii) a "-" indicates that the ultimate mortality rate for Spodoptera frugiperda 3-instar larvae was less than 50.0%, and LT could not be estimated 50 。
According to the infection pathogenic effect of the spore suspension of the Nomuraea rileyi NrSfadul 202104 strain on male and female imagoes of Spodoptera frugiperda, LC of the Nomuraea rileyi NrSfadul 202104 strain on male and female imagoes of Spodoptera frugiperda is calculated and obtained 50 Are respectively 1.36 multiplied by 10 5 seed/mL and 1.78X 10 5 one/mL. Therefore, the Nomuraea rileyi NrSfadult202104 has a good lethal effect on Spodoptera frugiperda imagoes.
In conclusion, the Nomuraea rileyi NrSfadult202104 provided by the invention is a biocontrol fungus which can be used for green control of Spodoptera frugiperda imagoes, has the characteristics of strong pathogenicity to the Spodoptera frugiperda imagoes, no environmental pollution and difficult generation of drug resistance of pests, and can be widely used for biological control of Spodoptera frugiperda.
While the foregoing description shows and describes several preferred embodiments of this invention, it is to be understood, as noted above, that this invention is not limited to the forms disclosed herein, but is not intended to be exhaustive or to exclude other embodiments and may be used in various other combinations, modifications, and variations within the scope of the inventive concept, as may be realized by the teachings set forth above or as may be learned by the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
Sequence listing
<110> Yunnan university of agriculture
<120> Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof
<130> 2021
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 595
<212> DNA
<213> Artificial sequence (ITS Gene sequence of Nomuraea rileyi NrSfadult202104 Strain)
<400> 1
ggggtttggg tactccaacc ccatgtgact tatacccttt tcctgttgcc tcggcgggtc 60
atttgccccg gaccgggctc gtccagagcc cgcccggaaa caggcgcccg ccgcgggacc 120
gaaactctgt atctcttagc ctttggcacg tctgagtgga atcatacaaa aatgaatcaa 180
aactttcaac aacggatctc ttggttctgg catcgatgaa gaacgcagcg aaatgcgata 240
agtaatgtga attgcagaat tcagtgaatc atcgaatctt tgaacgcaca ttgcgcccgc 300
cagtattctg gcgggcatgc ctgttcgagc gtcatttcaa ccctcaagcc cccgcggttt 360
ggtgttgggg gccggcaatt gtcagctggg ccgctcatgc ggttccctgc ggcgccgccc 420
ccgaaatgaa ttggcggccc cgtcgcgaac tcctctgcgt attagcacaa cctcgcaaca 480
ggagctcggc gcggccactg ccgtaaaacg cacaaacttc tccaagagtt gacctctaat 540
catgtatgaa tacccgctga acttaagcat atctataagc ggaggcacca catca 595
Claims (3)
1. A Nomuraea rileyi (Nomuraea rileyi) NrSfadult202104 strain, characterized by: the strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, and the preservation address is No. 3 of Xilu No.1 of Beijing, Chaoyang, North Chen; the preservation date is as follows: 21/6/2021; the preservation number is: CGMCC No. 22480; the ITS gene sequence of the Nomuraea rileyi NrSfadult202104 strain is a nucleotide sequence shown in SEQ ID No. 1.
2. Use of the Nomuraea rileyi NrSfadul 202104 strain according to claim 1 for preparing a Nomuraea rileyi NrSfadul 202104 strain microbial inoculum.
3. Use of the Nomuraea rileyi NrSfadult202104 strain according to claim 1 or the microbial agent according to claim 2 for the control of Spodoptera frugiperda (Spodoptera frugiperda).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111491037.5A CN114181839B (en) | 2021-12-08 | 2021-12-08 | Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111491037.5A CN114181839B (en) | 2021-12-08 | 2021-12-08 | Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114181839A CN114181839A (en) | 2022-03-15 |
| CN114181839B true CN114181839B (en) | 2022-08-26 |
Family
ID=80542734
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111491037.5A Active CN114181839B (en) | 2021-12-08 | 2021-12-08 | Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114181839B (en) |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016001125A1 (en) * | 2014-07-01 | 2016-01-07 | Bayer Cropscience Aktiengesellschaft | Active compound combinations and methods to protect the propagation material of plants |
| CN110669676B (en) * | 2019-10-25 | 2021-07-06 | 云南农业大学 | Metarrhizium leydii MRJCBT190808 and application thereof in control of spodoptera frugiperda |
| CN111662828B (en) * | 2020-06-30 | 2022-04-12 | 福建省农业科学院植物保护研究所 | Metarhizium leylanicum and application thereof |
| CN112812976B (en) * | 2021-02-02 | 2023-03-31 | 广西壮族自治区农业科学院植物保护研究所 | Metarhizium laevigatum CDTLJ1 and application thereof |
| CN113025505B (en) * | 2021-05-11 | 2022-05-03 | 福建省农业科学院植物保护研究所 | Metarhizium lepigone and biological control method and application thereof in pupal stage of Spodoptera frugiperda |
-
2021
- 2021-12-08 CN CN202111491037.5A patent/CN114181839B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN114181839A (en) | 2022-03-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110669676B (en) | Metarrhizium leydii MRJCBT190808 and application thereof in control of spodoptera frugiperda | |
| CN114317289B (en) | Beauveria bassiana Bbsfa202007 strain and application thereof | |
| CN111662828B (en) | Metarhizium leylanicum and application thereof | |
| CN101481668A (en) | Bacillus thuringiensis suspending agent for killing cotton spider mites, preparation and use | |
| CN108018242A (en) | A kind of serratia marcescens and its separation method and application | |
| CN111925963A (en) | Application of Siamese bacillus B11 in prevention and/or treatment of cotton bamboo blast tip disease | |
| CN112812976B (en) | Metarhizium laevigatum CDTLJ1 and application thereof | |
| CN114317293A (en) | Spaceflight entomogenous fungus strain SCAUHT18 with high pathogenicity and high ultraviolet resistance to common thrips and application thereof | |
| CN112553086B (en) | Violet purpurea bacterial strain and application thereof in preventing and treating phyllotreta striolata | |
| CN110669675B (en) | Metarhizium anisopliae MANGS71814 and application thereof in control of potato tuber moth | |
| CN111004724B (en) | Beauveria bassiana strain with high pathogenicity to larvae of phaea cinnabarina and application thereof | |
| CN110894469B (en) | Metarhizium anisopliae strain with high pathogenicity on orange belt mythimna separata larvae and application thereof | |
| CN114181839B (en) | Nomuraea rileyi NrSfadult202104 strain and preparation method and application thereof | |
| CN113025505B (en) | Metarhizium lepigone and biological control method and application thereof in pupal stage of Spodoptera frugiperda | |
| CN111549004B (en) | Composite biocontrol bacteria agent of Dendrolimus punctatus cytoplasmic polyhedrosis virus DpCPV and beauveria bassiana and application thereof | |
| Doolotkeldieva et al. | Isolation, identification, and characterization of the nematophagous fungus Arthrobotrys oligospora from Kyrgyzstan | |
| CN114317294A (en) | Spaceflight entomogenous fungus strain SCAUHT56 with high pathogenicity and high ultraviolet resistance to common thrips and application thereof | |
| CN109055236B (en) | Isaria pinicola WSWM1171 and application thereof in prevention and control of potato corm moth pupae | |
| CN114806898B (en) | Beauveria bassiana BbKMND202111 strain and application thereof | |
| CN114480138B (en) | Beauveria bassiana LZ2-1a and application thereof | |
| CN114540200B (en) | Space breeding beauveria bassiana strain SCAUHT30 with high pathogenicity to common thrips and application thereof | |
| CN114606140B (en) | Isaria fumosorosea and application thereof in controlling diaphorina citri | |
| CN109652321B (en) | Beauveria bassiana, application thereof and insecticide containing same | |
| CN117925420A (en) | Metarhizium anisopliae Mryscm strain 2308 and culture method and application thereof | |
| CN101544952B (en) | Oxytropis ehrig cinerea FEL4-OOc and separation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |