CN114150075A

CN114150075A - Application of molecular marker based on TYRP1 gene in giant salamander body color breeding

Info

Publication number: CN114150075A
Application number: CN202210050754.2A
Authority: CN
Inventors: 邓捷; 姜维; 张红星; 王启军; 赵虎; 孔飞; 张晗; 马红英
Original assignee: SHAANXI INSTITUTE OF ZOOLOGY
Current assignee: SHAANXI INSTITUTE OF ZOOLOGY
Priority date: 2022-01-17
Filing date: 2022-01-17
Publication date: 2022-03-08

Abstract

The invention discloses a method based onTYRP1Application of molecular marker of gene in giant salamander body color breeding for first cloning giant salamanderTYRP1The nucleotide sequence of the gene coding region has the full length of 1584bp, and codes 527 amino acid residues which comprise a tyrosinase (177-411 amino acids) functional structural domain; detection by real-time fluorescent quantitative PCR technologyTYRP1The expression spectrum difference of the gene in different tissues of the body color and skin tissues of different body colors of the wild giant salamander; contrast different body colorsTYRP1The CDS region of the gene is complete in sequence, and individuals with yellow body color are foundTYRP1The gene has 2 nucleotide insertion sites, which causes the change of a decoding frame and the interruption of an amino acid sequence. The invention relates to the directional selection of giant salamander body colorThe method provides effective molecular markers, provides a method for researching molecular genetic basis and cell metabolic mechanism formed by body color diversity, is beneficial to breeding new giant salamander strains, and solves the problem of germplasm degeneration of the giant salamander.

Description

Application of molecular marker based on TYRP1 gene in giant salamander body color breeding

Technical Field

The invention belongs to the technical field of molecular breeding, and particularly relates to application of a molecular marker based on a TYRP1 gene in giant salamander body color breeding.

Background

The abundant and diverse body color characteristics of species have been the hot problem of biological evolution and epigenetic research. Studies have suggested that animal body color is generally caused by the different pigmented cells contained in the skin on its surface and their different number distributions. Unlike mammals which contain only one melanocyte, the color of amphibian is related to three types of pigment cells in the dermis layer. For the unique body color types of the amphibians, previous researches mainly illustrate and analyze body color formation patterns of the amphibians from physiology and behavior, but reports about potential molecular genetic characteristics under body color traits of the amphibians are few. In the last decade, with the development of molecular marker technology, molecular biology methods are utilized to mark different body color traits for breeding auxiliary selection, so that breeding efficiency can be effectively improved.

Giant salamanders (Andrias davidianus) as a unique rare species in China have important research and application values. In the process of long evolution and artificial domestication, the giant salamander forms a plurality of different body color phenotypes, so that the giant salamander becomes an excellent material for researching the body color polymorphism and the molecular genetic mechanism of the amphibious animal. However, the current research on the body color of the giant salamander is very limited, and the method still remains blank in the aspects of chromosome set operation technology, selective breeding, functional genes and the like. Meanwhile, the giant salamander population has a certain germplasm degradation problem and lacks of high-performance new breed or new strain for cultivation. Considering that the giant salamander has important theoretical research and social and economic values, the molecular marker technology is imperative to culture new species or new strains of different body colors of the giant salamander.

The active protein coded by tyrosinase related protein-1 (TYRP1) gene is 5,6 dihydroxy indole 2-carboxylic acid oxidase, is an abundant intracellular glycoprotein expressed in melanosome of human pigmented melanocytes and melanoma, can catalyze substrate reaction, can be used as molecular chaperone of tyrosinase to stabilize its activity, and is a key gene in downstream pathway of melanin synthesis. The research shows that mutation of TYRP1 gene or inactivation of enzyme can affect the maturation of melanosome and the proliferation and apoptosis of melanocyte, and finally lead to abnormal expression of body tissues, so that dogs, horses, mice and humans can show the dissimilarity characteristics of lighter complexion or hair color, color spots and stripes (Miller, 1997; Rieder, 2001; Biossy, 2003; Cargjll, 2005). However, the molecular genetics related to the TYRP1 gene is less studied for this rare species of giant salamander.

Disclosure of Invention

Aiming at the defects in the prior art, the invention aims to provide the application of the molecular marker based on the TYRP1 gene in the giant salamander body color breeding.

In order to achieve the above purpose, the solution of the invention is as follows:

an application of a molecular marker based on a TYRP1 gene in giant salamander body color breeding.

Further, the nucleotide sequence of the TYRP1 gene is shown in SEQ ID NO. 1.

Further, the protein sequence coded by the TYRP1 gene is shown in SEQ ID NO. 2.

Further, the upstream and downstream sequences of TYRP1 gene cloning primers are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively.

The TYRP1 gene is expressed in different tissues of wild giant salamander by real-time fluorescent quantitative PCR technology.

Further, different tissues include muscle, skin, heart, liver, spleen, lung, stomach, pancreas, gonads, and intestinal tract.

The TYRP1 gene is applied to the expression of different body color skin tissues of the giant salamander by adopting a real-time fluorescent quantitative PCR technology.

Furthermore, the skin of the giant salamander with different body colors comprises yellow skin, yellow-bottom-inlaid black skin, black-bottom-inlaid yellow skin and gray skin or tiger spot-color skin.

Further, the upstream and downstream sequences of the real-time fluorescent quantitative PCR primer of the TYRP1 gene are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.

Due to the adoption of the scheme, the invention has the beneficial effects that:

(1) economic benefits

The invention utilizes SNP molecular marker technology to analyze genetic diversity of genes related to body color traits, performs correlation analysis of candidate gene SNP sites and body color traits, and provides effective molecular markers for targeted breeding of giant salamander body color. In practical application, the formation of different body color groups of the giant salamander into strains can be promoted, body color strains and new varieties with stable and inherited properties are further established, the problem of germplasm degradation of the giant salamander is solved, theoretical basis and guidance are provided, and the healthy and vigorous development of the giant salamander breeding industry is promoted; therefore, the invention not only has important theoretical and methodological significance, but also has important production and application values.

(2) Ecological benefit

The implementation of the invention can not only effectively relieve the survival pressure of the Chinese giant salamander which is a rare amphibian, but also provide precious germplasm resources and matched technical support for local aquaculture, thereby realizing the coordination and unification of natural resource protection and social and economic development.

(3) Social benefits

The invention takes giant salamanders with different body colors as research objects, refers to scientific research achievements obtained in the research field of animal body color diversity at home and abroad, selects reliable candidate genes by utilizing a scientific functional gene research method, and researches the genetic diversity of the candidate genes in giant salamander groups with different characteristics by adopting an accurate SNP molecular marker technology; cloning important candidate genes by using RACE technology, analyzing the DNA sequence characteristics of the genes by combining a bioinformatics method, and predicting the secondary structure and the tertiary structure of a protein sequence coded by a CDS region of the genes; and (3) combining qRT-PCR technology to perform candidate gene expression profile analysis. The molecular genetic basis formed by the body color diversity of the giant salamanders can be known, and meanwhile, effective molecular markers can be provided for the directional breeding of the body colors of the giant salamanders. The researches lay a foundation for further disclosing a genetic mechanism and a cell metabolic mechanism of the formation of the body color diversity of the giant salamander, and provide a scientific test method for providing reference for the research of genes related to the non-model biological economic traits.

Drawings

FIG. 1 shows giant salamanders with different body colors (A: yellow is the dominant color, yellow for short; B: yellow is the dominant color and black spots are distributed; C: black is the dominant color and yellow spots are distributed; D: black is the dominant color and yellow spots are distributed; E: wild type body color, gray or tiger spots are distributed).

FIG. 2 shows PCR amplification product M of TYRP1 gene of the present invention: DNA Marker (DL 2000); 1: clone map of TYRP1 gene.

FIG. 3 is a nucleotide sequence alignment chart of the CDS region of TYRP1 of 6 species according to the present invention.

FIG. 4 is a molecular structure characteristic prediction diagram of the Chinese giant salamander TYRP1 gene encoding protein of the invention.

FIG. 5 is a graph showing the relative expression amounts of the TYRP1 gene of the present invention in different tissues.

FIG. 6 is a graph showing the relative expression amounts of the TYRP1 gene of the invention in skin tissues of giant salamanders with different body colors.

FIG. 7 is the alignment chart of the TYRP1 gene sequence of different individual body colors.

FIG. 8 is a sequence alignment chart of the TYRP1 protein sequence of different body color skin tissues of the invention

FIG. 9 is a graph showing the real-time quantitative amplification of the TYRP1 gene of the present invention.

FIG. 10 is a graph showing the dissolution profile of the TYRP1 gene of the present invention.

Detailed Description

The invention provides application of a molecular marker based on a TYRP1 gene in giant salamander body color breeding.

The invention takes Chinese giant salamander skin tissues as materials, clones the TYRP1 gene in the Chinese giant salamander skin tissues, and analyzes the sequence characteristics of the CDS region nucleotide sequence of the gene and the protein sequence coded by the CDS region nucleotide sequence through various bioinformatics analysis software. The structural characteristics of the gene can be known from the molecular level, and a theoretical basis is provided for further research on the gene function. Meanwhile, the expression quantity of the TYRP1 gene in different body color phenotype skin tissues and the expression profile analysis of the TYRP1 gene in different tissues of the giant salamander are detected and analyzed by adopting a real-time fluorescent quantitative PCR technology, so that a test foundation is laid for further disclosing the biological function of the gene.

1. Principal materials and reagents

(1) Main apparatus and equipment

Sichuan gold phoenix in liquid nitrogen biological container

DYY-lll Voltage stabilizer Beijing six instrument factory

Ventilator cabinet poplar in the sky

Super clean bench Beijing great wall air purification equipment factory

Ultra-low temperature refrigerator Thermo

Automatic autoclave TOMY55-325

Adjustable micropipettes, Eppendorf

Desk type ultra-speed low-temperature centrifuge Eppendorf

Desk type overspeed normal temperature centrifuge Eppendorf

DDY-ZC horizontal electrophoresis apparatus Beijing six instrument factory

Gel imaging System Trans-illuminator2020D United Bio-Rad

Constant temperature Water bath Mount Guohua electric appliances Limited

Thermo of deionized water ultrapure water system

Thermo of constant temperature water bath circulation system

UV spectrophotometer Beckman, Germany

iCycler iQ5 TM real-time fluorescent quantitative PCR instrument, Bio-Rad, USA

PCR Instrument Bio-Rad Inc., USA

Electrotransformation apparatus, Bio-Rad Inc., USA

(2) Primary reagent

Trizol Reagent USA Invitrogen company

RNase-free Dna I Dalianbao Bio Inc

TaqDNA polymerase Fermentas, Canada

Ampicillin

X-Gal

IPTG

(3) Reagent kit

RevertAId cDNA Synthesis size Kit, Fermentas, Canada

SYBR Green qPCR Master Mix Germany Roche

PCR product purification kit Axygen Co

Plasmid extraction kit Baitach

(4) Vectors and strains:

vector System I Invert Inc. USA

Coli DH5 alpha this laboratory preservation

2. The material and the method are as follows:

test animals and sample Collection

(1) Selecting 3 adult giant salamanders (two male and one female) with wild body colors, slaughtering, immediately taking 10 tissue samples of muscle, skin, heart, liver, spleen, lung, stomach, intestine, pancreas, gonad (ovary/spermary) and the like, and freezing and storing at-80 ℃ for later use.

(2) The body color is selected to be yellow (yellow body surface area)>90%, see fig. 1 a), hereinafter referred to as YL; yellow is basic body color, and a small amount of black speckles (yellow body surface area 50-90%, see fig. 1B) are distributed on the surface of the body, hereinafter referred to as Y (B); black is basic body color, and more yellow plaques are distributed on the body surface (the surface area of the yellow body is 10-50%, shown as C in figure 1), hereinafter referred to as B (Y); black is the basic body color, and a small amount of yellow patches (yellow body surface area) are distributed on the body surface<10%, see D in fig. 1), hereinafter referred to as b (sy); the body color of the wild type (see E in FIG. 1), hereinafter abbreviated as GY. 15 giant salamanders with the above body color are divided intoCollecting the tail skin tissue about 0.5cm by other operation²On the left and right sides, after sampling, wound cleaning was performed and iodophor disinfectant (agilawood, shandong, china) was applied.

Example 1:

TYRP1 gene cloning and sequencing

1> RNA extraction

The RNeasy Mini kit is used for extracting the total RNA of the giant salamander skin tissue, and the whole process strictly complies with all the precautions of RNA operation. All steps are carried out at room temperature, except for special instructions.

2> first Strand Synthesis of cDNA

Total RNA was reverse transcribed using the RevertAid cDNA Synthesis Kit. The following steps were all carried out on ice, unless otherwise specified.

(1) Mu.g (2-4. mu.L) of total RNA, 1. mu.L of oligo DT (18) primer, and 12. mu.L of DEPC-treated water were added to an RNase-Free 0.5. mu.L centrifuge tube.

(2) Incubation at 65 ℃ for 5min, cooling on ice and flash centrifugation.

(3) The following components were added: 5 XBuffer 2 uL, RNase inhibitor 1 uL, 10mM dNTP mix 1 uL, reverse transcriptase 1 uL.

Performing instantaneous centrifugation, and performing PCR reaction by the following reaction procedures: 42 ℃, 60min, 70 ℃, 2 min. The reverse transcription product was stored at-20 ℃ until use.

3> primer design and Synthesis

PCR and qRT-PCR primers were designed using PrimeQuest (http:// sg. idtdna. com/Primequest/Home/IndexPrimer) software with reference to the related sequences of the Chinese giant salamander TYRP1 gene, and the related information is shown in Table 1. Primers were synthesized by Nanjing Kinshire Biotech.

TABLE 1 TYRP1 Gene cloning primer and its real-time fluorescent quantitative primer with reference gene

Note: p 1: TYRP1 gene cloning primer; p 2: real-time fluorescent quantitative PCR primers of TYRP1 gene; p 3: GAPDH gene real-time fluorescent quantitative PCR primer.

4> PCR amplification of target Gene

The PCR reaction system was 25. mu.L: 2.5 μ L10 × Taqbuffer, 2.5mM MgCI₂2.5mM dNTP, 1U TaqDNA polymerase (Fermentas, Canada), 10. mu.M upstream and downstream primers. PCR reaction program for TYRP1 gene: pre-denaturation at 94 ℃ for 4min, 35 cycles (94 ℃, 30s, 65 ℃, 60s, 72 ℃, 120s, 72 ℃ extension for 10 min).

5> purification of PCR product of target gene

The PCR product was purified by gel recovery kit.

(1) Adding PCR-A with 3 times volume to the PCR amplification product, adding the mixture to 100 mu L, and mixing the mixture evenly by vortex.

(2) The adsorption column was placed in a 2mL centrifuge tube, and the above reaction solution was added to the column and centrifuged at 12000rpm for 1 min.

(3) The effluent was discarded, 700. mu.L of buffer W2 (kit from) was added to the column, and centrifuged at 12000rpm for 1 min.

(4) The effluent was discarded, and 400. mu.L of buffer W2 (kit from) was added to the column and centrifuged at 12000rpm for 1 min.

(5) Placing the adsorption column into a new 1.5mL centrifuge tube, adding 25-30mL eluent EB (preheated at 65 ℃) into the center of the adsorption membrane, standing at room temperature for 1min, centrifuging at 12000rpm for 1min, collecting the effluent, and storing at-20 ℃ for later use.

6> connection of PCR product and PEMG-Teasy vector

(1) The purified secondary PCR amplification product and vector were briefly centrifuged and vortexed 2 × quick ligation buffer.

(2) The following components were added:

the mixture was pipetted and mixed and ligated overnight at 16 ℃.

Preparation of 7> E.coli (DH 5. alpha.) competent cells

(1) A single colony of plated E.coli (DH 5. alpha.) was inoculated into 5mL of liquid LB medium and cultured overnight at 37 ℃ with shaking at 220 rpm.

(2) Taking a proper amount of bacterial liquid in a ratio of 1:50, placing the bacterial liquid in a conical flask filled with LB culture medium, and carrying out shaking amplification culture at 37 ℃ and 220 rpm.

(3) When the bacterial liquid OD600 reaches 0.5-0.6 (about 2-3h), the bacterial liquid is placed on ice and slowly shaken to be fully cooled.

(4) And subpackaging the cooled bacterial liquid into a precooled 50mL centrifuge tube, centrifuging at 4 ℃ and 5000rpm for 10min, and collecting the bacterial cells at the bottom of the tube, wherein bacterial liquid can be repeatedly collected when more bacterial liquid exists.

(5) The supernatant was discarded, 30mL of pre-cooled sterile deionized water was added, the inoculum was gently blown to suspend, and centrifuged at 5000rpm for 10min at 4 ℃.

(6) Repeating the operation in the step (5) once.

(7) The supernatant was discarded, 30mL of pre-cooled 10% glycerol was added, the cell suspension was gently blown and centrifuged at 5000rpm for 10min at 4 ℃.

(8) And (5) repeating the operation in the step (7) once.

(9) Discarding the supernatant, adding a proper amount of 10% glycerol, gently blowing and beating, and suspending the bacterial liquid. Subpackaging into 1.5mL centrifuge tubes, and storing at-70 ℃ for later use.

8> transformation of ligation product (electrotransformation)

The ligation product was transformed using the electrical transformation method. All steps were carried out on ice, except where otherwise specified.

(1) Competent cells were removed from the-70 ℃ freezer and thawed on ice.

(2) 4.5. mu.L of the ligation product was slowly added to the competent cells, pipetted and mixed well.

(3) Taking out the pre-cooled electric conversion cup, and sucking the mixture obtained in the step (2) into the electric conversion cup to enable the mixture to be positioned between the electrodes.

(4) Carefully wipe the two sides and the bottom of the electrode cup quickly, and put into an electric converter. An appropriate shock program (2500 v) is selected or set for shock conversion.

(5) About 200. mu.L of LB liquid medium was added to an electric transformation cuvette, pipetting was conducted several times, the medium and the transformation product were aspirated by a pipette, and the aspirated medium and the transformation product were added to a 1.5mL centrifuge tube containing LB liquid medium, and cultured at 37 ℃ for 1 hour with shaking at 150rpm, to resuscitate cells.

Screening for 9> Positive clones

Preparing a Solid (SB) culture medium according to a formula, adding ampicillin after autoclaving, inverting the plate (the thickness is about 3mm), after the ampicillin is solidified, uniformly coating X-Gal (40 mu L) and IPTG (7 mu L) on the surface, and standing for 1h for later use.

(1) And (5) electrically shocking the transformed bacterium liquid to 200 mu L, and coating the plate.

(2) The coated plate was placed face up and incubated at 37 ℃ for about 1 hour and then inverted overnight.

(3) Placing the culture dish in a refrigerator at 4 ℃, and picking out positive clones after complete color development.

(4) White single colonies with good growth were randomly selected and cultured in a 1.5mL centrifuge tube containing LB medium at 37 ℃ under shaking at 220 rpm. About 3000 positive clones are selected.

10> plasmid extraction

Plasmids were extracted using a plasmid extraction kit.

(1) 1.5mL of the bacterial solution was centrifuged at 10000rpm for 1min, and the supernatant was discarded. And repeating the steps once.

(2) Add 250. mu.L of solution I (kit from tape) and blow-float the pellet until no visible cells are present.

(3) Adding 250 μ L of solution II (carried by kit), mixing well until the reaction solution is clear, and standing for 2 min.

(4) Add 350. mu.L of solution III (kit from kit) and invert the tube until a white precipitate appears.

(5) Centrifuge at 13000rpm for 10 min.

(6) The supernatant was transferred to a spin column and centrifuged at 10000rpm at room temperature for 1 min.

(7) The effluent was discarded, 500. mu.L of HB buffer was added, and centrifugation was carried out at 10000rpm for 1min to remove residual protein.

(8) Discarding the effluent, adding 700 μ L of elution buffer, centrifuging at 10000rpm for 1min, and discarding the effluent.

(9) Repeating the step (8) once.

(10) Centrifuge at 13000rpm for 2 min.

(11) The column was placed in a new centrifuge tube, 40. mu.L of lysis buffer was added, left to stand for 2min, centrifuged at 13000rpm for 1min, and the plasmid was precipitated to the bottom of the tube.

11> enzyme digestion identification

The plasmid extract was identified using EcoRI enzyme digestion.

12> sequencing

The plasmid with correct restriction enzyme identification is selected and sent to Nanjing King Shirui Biotech company for sequencing.

Bioinformatics analysis of CDS region of 13> TYRP1 Gene

TABLE 2 bioinformatics software and its functionality

Example 2:

real-time quantitative fluorescent PCR analysis of expression of TYRP1 gene in different tissues of giant salamander

1> Total RNA extraction and reverse transcription

Total RNA of muscle, skin, heart, liver, spleen, lung, stomach, pancreas, kidney, gonad (ovary/testis) and intestinal tract tissue of giant salamander is extracted by a Tizol one-step method and is reversely transcribed into cDNA, and the specific experimental steps are the same as example 1.

2> primer design and Synthesis

The CDS region sequence of the Chinese giant salamander TYRP1 gene obtained by sequencing is used, and PrimeQuest (http:// sg. idtdna. com/Primerqest/Home/IndexPrimer) online software is used for designing real-time fluorescence quantitative primers, and related information is shown in Table 1. Primers were synthesized by Nanjing Kinshire Biotech.

3> reaction System and conditions

The reaction system is as follows: mu.L of cDNA, 1 mu.L of 10 nm/. mu.L dNTP, 0.75 mu.L of target gene upstream primer and target gene downstream primer respectively are added into each PCR reaction tube,

SYBR Green qPCR Master Mix (Roche, Germany) 14.5. mu.L. The PCR reaction program is: reading the plate at 85 ℃ for 40 cycles (94 ℃, 1 min; 94 ℃, 18 s; 62 ℃, 18 s; 72 ℃, 20s). GAPDH was used as the reference gene and one reaction without template was used as a blank, with three replicates for each reaction.

4> analysis of test data

And analyzing the test data by using Excel software, subtracting the Ct value of the corresponding GAPDH from the Ct value of each target gene to obtain the delta Ct of the target gene, and calculating the relative expression quantity of the target gene by using a Power (2, -delta Ct) formula. The experimental data were analyzed using SPSS17.0 software. The test results are expressed as "mean ± sem".

Example 3:

real-time quantitative fluorescence PCR analysis of expression of TYRP1 gene in tail skin tissues of giant salamanders with different body colors

1> Total RNA extraction and reverse transcription

Total RNA of the skin tissue of the tail of the giant salamander with the body colors of YL, Y (B), B (Y), B (SY) and GY is extracted by a Tizol one-step method and is reversely transcribed into cDNA, and the specific experimental steps are the same as example 1.

2> primer design and Synthesis

The same as in example 1.

3> reaction System and conditions

The same as in example 1.

4> analysis of test data

The same as in example 1.

Example 4:

single Nucleotide Polymorphism (SNP) analysis of TYRP1 gene

Total RNA extraction and reverse transcription were as in example 1.

Primer design and synthesis were the same as in example 1.

The PCR amplification of the target gene was performed as in example 1.

The PCR product of the desired gene was purified as in example 1.

Ligation of the PCR product to the PEMG-Teasy vector was performed as in example 1.

Coli (DH 5. alpha.) competent cells were prepared as in example 1.

The ligation product was transformed (electrotransformation) as in example 1.

Positive clones were selected as in example 1.

Plasmid extraction was as in example 1.

The enzyme cleavage identity was the same as in example 1.

Sequencing was as in example 1.

The sequence alignment was the same as in example 1.

And (3) carrying out homology comparison on the sequence obtained by sequencing by using BioEdit software, finding out the SNP locus of the gene, combining the body color type corresponding to the sequence, and analyzing the corresponding relation between the SNP locus and the body color.

Results and analysis:

the extraction and detection of total RNA of giant salamander skin tissue are the same as in example 1.

PCR amplification, cloning and sequencing of TYRP1 gene:

touchdown PCR was performed using the designed TYRP1 gene primer using skin tissue cDNA as a template (fig. 2). The results showed that the PCR product was consistent with the expected fragment. Sequencing the amplified product of the TYRP1 gene.

TYRP1 gene sequence and bioinformatics analysis thereof:

1> sequence characteristics of TYRP1 Gene

The sequence structure of the TYRP1 gene of the giant salamander in China is analyzed by using ORF finder, and the CDS sequence of the gene is 1584bp in length. The nucleotide sequence (SEQ ID NO.1) of the CDS region of the TYRP1 gene is as follows.

CDS region nucleotide sequence (length: 1584bp) of TYRP1 gene:

ATGCTGCTTCCTTGGCTGACGCTGCTGCTTCTGGCACCAATGGCGCGGACTCAGTTCCCGCGGCAGTGCGTGACCGCAGAGGAGCTGCGCAGCGGCCAGTGCTGCCCTGGCCTTTTCCCAGCGCTGACCCCGGACCCGTCGGACCGCTGCGGGGCCTCGGTGGGACGCGGCCTCTGCGCACAGGTGCAGGCCGACTCCCGGCCTCACGGGCCCCAGTACCCGCACGATGGGCTCGACGACCGCGAGCTCTGGCCCCGCCGCTTCTTCAACCGCTCCTGCCTCTGCGCCCGCAACTTCTATGGCTACAACTGCGGCTCCTGCCGGTCCGGCTGGACCGGGGCCAACTGCGACCAAAGGGTGGTGGCGGTCAGGAGGAACGTTTTGGAACTAAGCATTCAGGAAAGGCGCCACTTTATCAATGCTTTGGATATGGCTAAGAGAACTGTACATCCTCATTATGTAATCGCTTCACGGAGATATGCAGAGATAATGGGACCAGATGGCAACACCACCCGGTTTGAGAATGTATCCATTTACAACTACTTTGTCTGGACTCACTATTATTCTGTCAGCAAGACCTTCCTCGGTCAAGGACAAGAGAGCTTTGGGGGAATAGACTTCTCTCACGAAGGGCCAGCATTTCTCACTTGGCACAGGTACCACCTGCTGCATCTGGAAAGGGATATGCAGGAAATGCTTCAGGATCCCACCTTTGCTCTTCCATATTGGAATTTTGCCATTGGTGGCAATAACTGTGACATTTGCACAGATGACTTCATGGGGGCTCGGAGCAACTTTGACTCTACTCTGTTAAGTTCCAACTCTGTATTTTCTGAATGGCAAATTATTTGTGAAAGCATAGAAGAATATGATTCCTTGGGAACAATTTGTAACAGTACAGAGGGTGGGCCAATTCGAAGGAACCCTGCTGGGAATGTAGCCAGGCCTATGGTGCAGCGTCTACCTGAACCACAAGATGTTGCTCTCTGCTTGGAAGTTGGTTTATTTGACACACCTCCTTATTATTCTAATTCTTCAGAAAGCTTTCGTAATACAGTTGAAGGGTACAGTGATCCTTCTGGAAAATATGATCCTTCAGTTCGAAGCCTTCATAACTTGGCTCACCTGTTTCTGAATGGAACTGGAGGACAAACTCACGTGTCTCCGAATGATCCTATTTTTGTTCTTCTACACACATTTACCGATGCTGTGTTTGATGAATGGCTGAGAAGACACAGTGCTGATGTTACACTTTACCCACTTGAGAATGCCCCTATTGGACATAACAGGCAGTACAACATGGTACCATTCTGGCCTCCTGTTACCAATAATGAGATGTTTGTTACTGCACCAGAGAACCTGGGATATGCATATGAAGTCCAGTGGCCAAGCCGTGCTCTGAATGCCACTGAAATCATAACTATCACCATTGTGGCCGCTCTTGTCGCGGTTGCTGTTATCTTTGCTGCTGCTTCTTGTGGTGTTCATTGCAGGAAAAAAGATGATCTTCACCAGCCTCTTCTTGGTGAGAAATATCCCCGGTACTCTGACGAATATGAAGAGGATGCAAATCAATCTGTATGA。

2> homology analysis of CDS region sequence of TYRP1 gene:

the results of the homologous alignment of the sequences of the Chinese giant salamander TYRP1 using the Blastn program (http:// blast.ncbi. nlm. nih. gov/Blast) in NCBI database showed that the nucleotide sequence homology of the Chinese giant salamander TYRP1 with American West mouth mud eel (GenBank accession No.: AF064803.1), West brocade turtle (GenBank accession No.: XM _005295200.2), sea turtle (GenBank accession No.: XM _007053423.1), white-collar giant salamander (GenBank accession No.: XM _005061644.1) and cattle (GenBank accession No.: AF400250.1) were 82%, 78%, 76% and 78%, respectively. The homology with the amino acid sequence of Meixi blunt port mud eel (GeneBank accession number: P55027.2), green sea turtle (GeneBank accession number: XP _007053485.1), West brocade turtle (GeneBank accession number: XP _005295256.1), Chinese soft-shelled turtle (GeneBank accession number: XP _006117908.1), Xenopus laevis (GeneBank accession number: NP _001080492.1) and American alligator (GeneBank accession number: XP _006258332.1) is 86%, 77%, 78%, 76% and 76%, respectively.

The nucleotide sequence of the CDS region of the TYRP1 gene of Chinese giant salamander was subjected to multiple sequence alignment using the Blustal W program with the nucleotide sequences of Meixi blunt-cut mud eel (GenBank accession No.: AF064803.1), West brocade turtle (GenBank accession No.: XM-005295200.2), green sea turtle (GenBank accession No.: XM-007053423.1), Baiyihua Ji (GenBank accession No.: XM-005061644.1) and cattle (GenBank accession No.: AF400250.1) (see FIG. 3).

Prediction of amino acid sequence functional structural domain of 3 TYRP1 gene coding protein

The protein domain is predicted by SMART (http:// SMART. embl-heidelberg. de /), and the result shows that 527 amino acid residues coded by the CDS partial sequence of the Chinese giant salamander TYRP1 gene comprise conserved functional domains such as tyrosinase (177-411 amino acids) (see figure 4).

The TYRP1 gene encodes a protein sequence (SEQ ID No.2) (527 amino acids):

MLLPWLTLLLLAPMARTQFPRQCVTAEELRSGQCCPGLFPALTPDPSDRCGASVGRGLCAQVQADSRPHGPQYPHDGLDDRELWPRRFFNRSCLCARNFYGYNCGSCRSGWTGANCDQRVVAVRRNVLELSIQERRHFINALDMAKRTVHPHYVIASRRYAEIMGPDGNTTRFENVSIYNYFVWTHYYSVSKTFLGQGQESFGGIDFSHEGPAFLTWHRYHLLHLERDMQEMLQDPTFALPYWNFAIGGNNCDICTDDFMGARSNFDSTLLSSNSVFSEWQIICESIEEYDSLGTICNSTEGGPIRRNPAGNVARPMVQRLPEPQDVALCLEVGLFDTPPYYSNSSESFRNTVEGYSDPSGKYDPSVRSLHNLAHLFLNGTGGQTHVSPNDPIFVLLHTFTDAVFDEWLRRHSADVTLYPLENAPIGHNRQYNMVPFWPPVTNNEMFVTAPENLGYAYEVQWPSRALNATEIITITIVAALVAVAVIFAAASCGVHCRKKDDLHQPLLGEKYPRYSDEYEEDANQSV。

TABLE 3 nucleic acid coding table

4> TYRP1 Gene expression profiling

The real-time quantitative result shows (see figure 5), the expression level of mRNA in skin tissue of TYRP1 gene is highest (0.007967 +/-0.001328), the expression level in gonad, pancreas, heart, stomach, spleen, intestine, lung, liver and muscle tissue is sequentially decreased to 0.002893 +/-0.000482, 0.000124 +/-2.06E-05, 4.81E-05 +/-8.02E-06, 1.85E-06 +/-3.09E-07, 1.18E-06 +/-1.97E-07, 9.47E-07 +/-1.58E-07, 4.75E-07 +/-7.91E-08, 2.25E-07 +/-3.75E-08, 3.45E-08 +/-5.75E-09, and the difference with the expression level in skin tissue is very significant (P < 0.01). The real-time quantitative amplification curve and the related raw data of the TYRP1 gene are shown in FIG. 9, and the dissolution curve and the related raw data are shown in FIG. 10.

5> analysis of the expression quantity of TYRP1 gene mRNA in skin tissues with different body colors

The real-time quantitative result shows (see fig. 6), the expression amount of mRNA of TYRP1 gene in the skin tissue of giant salamander with B (Y) type body color is the highest (0.014285 +/-0.003571), the expression amount of mRNA of TYRP1 gene is (0.009822 +/-0.001637), the expression amounts of mRNA of TYRP1 gene in the skin tissue with Y (B) type and GY type body color are 0.003877 +/-0.000646, 0.003447 +/-0.000431, respectively, and the expression amount of TYRP1 gene in the skin tissue with YL type body color is the lowest and is 0.003192 +/-0.000532. The results of the significance test of the differences between the data are shown in fig. 6. The real-time quantitative amplification curve and the related raw data of the TYRP1 gene are shown in FIG. 9, and the dissolution curve and the related raw data are shown in FIG. 10.

6> TYRP1 gene mononucleotide polymorphism analysis

The invention amplifies the nucleotide sequences of 1811bp (including 1584bp in a CDS region) of TYRP1 genes in the skin tissues of giant salamanders with gray skin and yellow skin, yellow skin and yellow individual, and utilizes Blustical W program to carry out multiple sequence comparison on the obtained sequences, and the result is shown in figure 7. The results show that the nucleotide sequences of the TYRP1 of the giant salamanders with different body colors are basically consistent, 2 nucleotide insertion sites exist in the TYRP1 of the giant salamander with yellow body color, and the amino acid sequence is interrupted (see figure 8).

Finally, it should be noted that: although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art will understand that various changes, modifications and substitutions can be made without departing from the spirit and scope of the invention as defined by the appended claims. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> research institute for animals in Shaanxi province

<120> application of molecular marker based on TYRP1 gene in giant salamander body color breeding

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1584

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 1

atgctgcttc cttggctgac gctgctgctt ctggcaccaa tggcgcggac tcagttcccg 60

cggcagtgcg tgaccgcaga ggagctgcgc agcggccagt gctgccctgg ccttttccca 120

gcgctgaccc cggacccgtc ggaccgctgc ggggcctcgg tgggacgcgg cctctgcgca 180

caggtgcagg ccgactcccg gcctcacggg ccccagtacc cgcacgatgg gctcgacgac 240

cgcgagctct ggccccgccg cttcttcaac cgctcctgcc tctgcgcccg caacttctat 300

ggctacaact gcggctcctg ccggtccggc tggaccgggg ccaactgcga ccaaagggtg 360

gtggcggtca ggaggaacgt tttggaacta agcattcagg aaaggcgcca ctttatcaat 420

gctttggata tggctaagag aactgtacat cctcattatg taatcgcttc acggagatat 480

gcagagataa tgggaccaga tggcaacacc acccggtttg agaatgtatc catttacaac 540

tactttgtct ggactcacta ttattctgtc agcaagacct tcctcggtca aggacaagag 600

agctttgggg gaatagactt ctctcacgaa gggccagcat ttctcacttg gcacaggtac 660

cacctgctgc atctggaaag ggatatgcag gaaatgcttc aggatcccac ctttgctctt 720

ccatattgga attttgccat tggtggcaat aactgtgaca tttgcacaga tgacttcatg 780

ggggctcgga gcaactttga ctctactctg ttaagttcca actctgtatt ttctgaatgg 840

caaattattt gtgaaagcat agaagaatat gattccttgg gaacaatttg taacagtaca 900

gagggtgggc caattcgaag gaaccctgct gggaatgtag ccaggcctat ggtgcagcgt 960

ctacctgaac cacaagatgt tgctctctgc ttggaagttg gtttatttga cacacctcct 1020

tattattcta attcttcaga aagctttcgt aatacagttg aagggtacag tgatccttct 1080

ggaaaatatg atccttcagt tcgaagcctt cataacttgg ctcacctgtt tctgaatgga 1140

actggaggac aaactcacgt gtctccgaat gatcctattt ttgttcttct acacacattt 1200

accgatgctg tgtttgatga atggctgaga agacacagtg ctgatgttac actttaccca 1260

cttgagaatg cccctattgg acataacagg cagtacaaca tggtaccatt ctggcctcct 1320

gttaccaata atgagatgtt tgttactgca ccagagaacc tgggatatgc atatgaagtc 1380

cagtggccaa gccgtgctct gaatgccact gaaatcataa ctatcaccat tgtggccgct 1440

cttgtcgcgg ttgctgttat ctttgctgct gcttcttgtg gtgttcattg caggaaaaaa 1500

gatgatcttc accagcctct tcttggtgag aaatatcccc ggtactctga cgaatatgaa 1560

gaggatgcaa atcaatctgt atga 1584

<210> 2

<211> 527

<212> PRT

<213> Artificial Sequence (Artficial Sequence)

<400> 2

Met Leu Leu Pro Trp Leu Thr Leu Leu Leu Leu Ala Pro Met Ala Arg

1 5 10 15

Thr Gln Phe Pro Arg Gln Cys Val Thr Ala Glu Glu Leu Arg Ser Gly

20 25 30

Gln Cys Cys Pro Gly Leu Phe Pro Ala Leu Thr Pro Asp Pro Ser Asp

35 40 45

Arg Cys Gly Ala Ser Val Gly Arg Gly Leu Cys Ala Gln Val Gln Ala

50 55 60

Asp Ser Arg Pro His Gly Pro Gln Tyr Pro His Asp Gly Leu Asp Asp

65 70 75 80

Arg Glu Leu Trp Pro Arg Arg Phe Phe Asn Arg Ser Cys Leu Cys Ala

85 90 95

Arg Asn Phe Tyr Gly Tyr Asn Cys Gly Ser Cys Arg Ser Gly Trp Thr

100 105 110

Gly Ala Asn Cys Asp Gln Arg Val Val Ala Val Arg Arg Asn Val Leu

115 120 125

Glu Leu Ser Ile Gln Glu Arg Arg His Phe Ile Asn Ala Leu Asp Met

130 135 140

Ala Lys Arg Thr Val His Pro His Tyr Val Ile Ala Ser Arg Arg Tyr

145 150 155 160

Ala Glu Ile Met Gly Pro Asp Gly Asn Thr Thr Arg Phe Glu Asn Val

165 170 175

Ser Ile Tyr Asn Tyr Phe Val Trp Thr His Tyr Tyr Ser Val Ser Lys

180 185 190

Thr Phe Leu Gly Gln Gly Gln Glu Ser Phe Gly Gly Ile Asp Phe Ser

195 200 205

His Glu Gly Pro Ala Phe Leu Thr Trp His Arg Tyr His Leu Leu His

210 215 220

Leu Glu Arg Asp Met Gln Glu Met Leu Gln Asp Pro Thr Phe Ala Leu

225 230 235 240

Pro Tyr Trp Asn Phe Ala Ile Gly Gly Asn Asn Cys Asp Ile Cys Thr

245 250 255

Asp Asp Phe Met Gly Ala Arg Ser Asn Phe Asp Ser Thr Leu Leu Ser

260 265 270

Ser Asn Ser Val Phe Ser Glu Trp Gln Ile Ile Cys Glu Ser Ile Glu

275 280 285

Glu Tyr Asp Ser Leu Gly Thr Ile Cys Asn Ser Thr Glu Gly Gly Pro

290 295 300

Ile Arg Arg Asn Pro Ala Gly Asn Val Ala Arg Pro Met Val Gln Arg

305 310 315 320

Leu Pro Glu Pro Gln Asp Val Ala Leu Cys Leu Glu Val Gly Leu Phe

325 330 335

Asp Thr Pro Pro Tyr Tyr Ser Asn Ser Ser Glu Ser Phe Arg Asn Thr

340 345 350

Val Glu Gly Tyr Ser Asp Pro Ser Gly Lys Tyr Asp Pro Ser Val Arg

355 360 365

Ser Leu His Asn Leu Ala His Leu Phe Leu Asn Gly Thr Gly Gly Gln

370 375 380

Thr His Val Ser Pro Asn Asp Pro Ile Phe Val Leu Leu His Thr Phe

385 390 395 400

Thr Asp Ala Val Phe Asp Glu Trp Leu Arg Arg His Ser Ala Asp Val

405 410 415

Thr Leu Tyr Pro Leu Glu Asn Ala Pro Ile Gly His Asn Arg Gln Tyr

420 425 430

Asn Met Val Pro Phe Trp Pro Pro Val Thr Asn Asn Glu Met Phe Val

435 440 445

Thr Ala Pro Glu Asn Leu Gly Tyr Ala Tyr Glu Val Gln Trp Pro Ser

450 455 460

Arg Ala Leu Asn Ala Thr Glu Ile Ile Thr Ile Thr Ile Val Ala Ala

465 470 475 480

Leu Val Ala Val Ala Val Ile Phe Ala Ala Ala Ser Cys Gly Val His

485 490 495

Cys Arg Lys Lys Asp Asp Leu His Gln Pro Leu Leu Gly Glu Lys Tyr

500 505 510

Pro Arg Tyr Ser Asp Glu Tyr Glu Glu Asp Ala Asn Gln Ser Val

515 520 525

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 3

gctctgctct gctgggtta 19

<210> 4

<211> 20

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 4

cctttatttt ggaagcagct 20

<210> 5

<211> 23

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 5

cgtgtctccg aatgatccta ttt 23

<210> 6

<211> 21

<212> DNA

<213> Artificial Sequence (Artficial Sequence)

<400> 6

actgtgtctt ctcagccatt c 21

Claims

1. Based onTYRP1The application of the molecular marker of the gene in the giant salamander body color breeding.

2. Use according to claim 1, characterized in that: the above-mentionedTYRP1The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

3. Use according to claim 1, characterized in that: the above-mentionedTYRP1The protein sequence of the gene code is shown in SEQ ID NO. 2.

4. Use according to claim 1, characterized in that: the above-mentionedTYRP1The upstream and downstream sequences of the gene cloning primer are respectively shown as SEQ ID NO.3 and SEQ ID NO. 4.

5.TYRP1The gene is expressed in different tissues of wild giant salamanders by adopting a real-time fluorescent quantitative PCR (qRT-PCR) technology.

6. Use according to claim 5, characterized in that: the different tissues include muscle, skin, heart, liver, spleen, lung, stomach, pancreas, gonads, and intestine.

7.TYRP1The gene is applied to the expression of different body color skin tissues of the giant salamander by adopting a real-time fluorescent quantitative PCR technology.

8. Use according to claim 7, characterized in that: the skin of the giant salamander with different body colors comprises yellow skin, yellow-bottom-inlaid black skin, black-bottom-inlaid yellow skin and gray skin or tiger spot-color skin.

9. Use according to claim 5 or 7, characterized in that: the above-mentionedTYRP1The upstream and downstream sequences of the real-time fluorescent quantitative PCR primer of the gene are respectively shown as SEQ ID NO.5 and SEQ ID NO. 6.