CN109576276B - Molecular cloning and application of pork quality trait related gene Prox1 - Google Patents

Abstract

The invention belongs to the field of livestock molecular biology technology and genetic breeding, and discloses a pork quality trait related geneProx1The molecular cloning and application of the compound, and the determination of pigs by using the double-fluorescent enzyme activity analysis technologyProx1The active region of the gene promoter region, and positive regulatory elements which influence the promoter activity exist in the-1182/-1957 bp region; and negative regulatory elements affecting the promoter activity are present in the-1182/-682 bp region, -682/-192bp region, and-192 to +122bp region. The invention is applied to pigsProx118 genetic variation sites are identified in a gene promoter sequence, and three completely linked genetic variation sites are proved to be obviously related to the pork pH character and can be used as important molecular markers for pig production character auxiliary breeding.

Description

Molecular cloning and application of pork quality trait related gene Prox1

Technical Field

The invention belongs to the field of livestock molecular biology technology and genetic breeding, and relates to a porcine Prox1 gene full-length cDNA sequence clone containing SEQ ID NO. 4, a porcine Prox1 gene near-end promoter sequence clone containing SEQ ID NO. 5 and promoter activity analysis; in addition, the invention also relates to the analysis of the expression pattern of the Prox1 gene of the pig and the research, development and application of the molecular marker influencing the meat quality traits of the pig.

Background

Pork is a main source of animal protein in human life, and with the increase of consumption level, the requirements of people on pork quality are correspondingly increased, so that more and more attention is paid to the improvement of meat quality. The quality of meat (meat quality for short) can be evaluated by a plurality of technical indexes, such as meat color, pH value, water retention capacity, intramuscular fat content, tenderness and the like. The meat quality traits are mostly quantitative traits, the heritability is moderate and low, and the meat quality traits are controlled by a micro-effective polygene. The meat color is an important meat quality index, which not only influences the sensory judgment of consumers, but also has a vital influence on the internal quality and market price of pork, and is an important economic index for measuring the quality of pork. The quality of the meat color directly affects the purchasing desire of consumers, so the meat color is an important meat quality index for both producers and consumers.

In the past decades, the conventional breeding technology system has made great progress on genetic improvement of high heritability characters, such as growth speed, feed conversion efficiency, carcass lean meat percentage, and the like, but when the conventional breeding technology system is used for genetic breeding of low heritability characters, such as meat quality, reproduction, and the like, the cost is high, and the obtained genetic progress is very slow. With the rapid development of the fields of genomics, molecular biology and the like, molecular breeding technology systems, such as gene editing technology, transgenic technology, molecular marker technology and the like, can provide a new effective way for genetic improvement of low heritability traits of pigs. It is worth noting that the application of molecular breeding technology firstly needs to define which genes are functional genes affecting economic traits, and the key target genes affecting target traits are defined before further development of related molecular breeding work is possible. Therefore, the identification of the key functional genes influencing the quality of the pork muscle has very important significance for the genetic improvement of the pork quality traits by utilizing the molecular breeding technology.

Prospero-related homeobox protein 1(Prox1) is an important nuclear transcription factor involved in development. Studies have shown that Prox1 plays an important regulatory role in skeletal muscle development, regeneration, and conversion of muscle fiber types. The inventor finds that Prox1 is a gene with extremely obvious difference in skeletal muscle tissues of different muscle fiber types in the early stage of pork color-like whole genome transcriptome sequencing research, and the difference of the muscle fiber types is an important factor influencing the pork quality. Thus, Prox1 is a potential key candidate gene affecting other meat quality traits in pigs.

Disclosure of Invention

The invention clones the full-length cDNA and the near-end promoter sequence of the porcine Prox1 gene for the first time, and determines the promoter active region of the gene through the in vitro promoter activity analysis, thereby laying a foundation for the related molecular breeding work by utilizing the Prox1 gene; in addition, the invention defines the expression modes of Prox1 in different tissues of pigs and skeletal muscle tissues of different muscle fiber types, and establishes a corresponding gene expression quantitative detection method; in addition, the genetic variation locus detection is carried out on the proximal promoter region of the Prox1 by the target region targeted sequencing technology, a PCR-RFLP genotyping method of three key SNPs of the Prox1 promoter is established, and the remarkable correlation of the three genetic variation locus polymorphisms and the pork quality traits is determined by group trait association analysis. Any one of the markers can be independently used or combined with other two markers to be used for pig molecular marker-assisted breeding.

The invention is realized by the following technical scheme:

a gene Prox1 related to pig production traits, the full length of the cDNA sequence of the gene is shown in SEQ ID NO:4, respectively.

A promoter sequence for regulating and controlling the expression of a Prox1 gene has a nucleotide sequence shown in a sequence table SEQ ID NO:5, respectively.

The application of the gene Prox1 related to the pig production traits in genetic improvement of the pig production traits.

The promoter sequence is applied to genetic improvement of pig production traits.

An SNP marker associated with a swine production trait, wherein the SNP marker is at least one of (1) to (3):

(1) is located in the sequence table SEQ ID NO:5, leading to TaqI-RFLP polymorphism due to 1C/A mutation at-1421 bp of the sequence shown in the specification;

(2) is located in the sequence table SEQ ID NO:5 at-930 bp of the sequence shown in the sequence, resulting in BseNI-RFLP polymorphism;

(3) is located in the sequence table SEQ ID NO:5 at-1573 bp, resulting in HpaII-RFLP polymorphism.

The application of the SNP marker related to the pig production traits in genetic improvement of the pig production traits.

The invention first downloads PREDICTED Sus scrofa Prox1, mRNA sequence (NM-001128490.1) as seed sequence SEQ ID NO: 1. respectively designing amplification primers of 5 'end and 3' end of the Prox1 gene of the amplified pig and 5 '-RACE and 3' -RACE amplification primers according to the downloaded nucleotide sequence, and utilizing

RACE 5 '/3' Kit clones the full-length Prox1cDNA of pig. Determining the transcription initiation site of the gene according to the test result of 5' -RACE, designing and amplifying promoter regions of different fragment lengths of the porcine Prox1, constructing a corresponding promoter activity analysis pGL3 vector, and determining the promoter activity region by using a dual-luciferase report system. The expression pattern of the porcine Prox1 gene in different tissues and skeletal muscle tissues of different muscle fiber types is determined by utilizing the qRT-PCR technology. The genetic variation site detection is carried out on the proximal promoter region of the porcine Prox1 by using a target region targeted sequencing method. A PCR-RFLP genotyping method of three key SNPs of a Prox1 promoter is established, and the three SNPs are proved to be important molecular markers for the auxiliary breeding of pig production traits through group trait association analysis.

Sequence listing SEQ ID NO: 1 is the partial mRNA sequence of the porcine Prox1 gene predicted in NCBI database.

Sequence listing SEQ ID NO:2 is the nucleotide sequence information of 5' UTR of the cloned porcine Prox1 gene.

Sequence listing SEQ ID NO: 3 is the nucleotide sequence information of 3' UTR of the cloned pig Prox1 gene.

Sequence listing SEQ ID NO:4 is the nucleotide sequence information of the cloned full-length cDNA of the porcine Prox1 gene.

Sequence listing SEQ ID NO:5 is 1957bp near-end promoter sequence information before transcription initiation site of pig Prox1 gene cloned by the present invention.

The invention has the beneficial effects that: the invention clones the full-length cDNA and the near-end promoter sequence of the porcine Prox1 gene for the first time, and determines the promoter active region of the gene through the in vitro promoter activity analysis, thereby laying a foundation for the related molecular breeding work by utilizing the Prox1 gene; the invention carries out genetic variation locus detection on the proximal promoter region of Prox1 by a target region targeted sequencing technology, establishes a PCR-RFLP genotyping method of three key SNPs of the Prox1 promoter, and confirms that the three genetic variation locus polymorphisms are obviously related to the pork quality traits by group trait association analysis. Any one of the markers can be independently used or combined with other two markers to be used for pig molecular marker-assisted breeding.

Drawings

FIG. 1: is agarose electrophoresis picture of 5' RACE amplified fragment of porcine Prox1 gene. In the figure: m: DNA molecular weight standard (DL5000 ladder).

FIG. 2: is agarose electrophoresis picture of 3' RACE amplified fragment of the porcine Prox1 gene. In the figure: m: DNA molecular weight standard (DL5000 ladder).

FIG. 3: the invention relates to the detection result of dual luciferase activity of promoter fragments with different lengths of the porcine Prox1 gene.

FIG. 4: is the expression pattern of the porcine Prox1 gene in different tissues.

FIG. 5 is a schematic view of: is the expression pattern of the pork chromatism phenotypic-different marker genes Myoglobin, MyHC-I, MyHC-IIB, MyHC-IIX and Prox1 gene.

FIG. 6: the invention relates to a porcine Prox1 gene SEQ ID NO: 5C/A variation PCR-TaqI-RFLP three gene type electrophoretograms at a position of-930 bp of a proximal promoter sequence. In the figure: m: DNA molecular weight standards (DL2000:2000, 1000, 750, 500, 200 and 100 bp); lane 1: an AA genotype; lane 2: the CA genotype; lane 3: the CC genotype.

FIG. 7: the invention relates to a porcine Prox1 gene SEQ ID NO:5 near-end promoter sequence-1421 bp A/G variant PCR-BseNI-RFLP three genotype electrophoretograms. In the figure: m: DNA molecular weight standards (DL2000:2000, 1000, 750, 500, 200 and 100 bp); lane 1: an AA genotype; lane 2: a GG genotype; lane 3: the AG genotype.

FIG. 8: the invention relates to a porcine Prox1 gene SEQ ID NO:5 near-end promoter sequence-1573 bp G/C variation PCR-HpaII-RFLP three genotype electrophoresis maps. In the figure: m: DNA molecular weight standards (DL2000:2000, 1000, 750, 500, 200 and 100 bp); lane 1: a CC genotype; lane 2: a GC genotype; lane 3: GG genotype.

Detailed Description

Example 1: cloning of full-length cDNA nucleotide sequence of porcine Prox1 gene

1.1 primer design

The mRNA sequence of the porcine Prox1 gene (NM-001128490.1) predicted in the NCBI database (https:// www.ncbi.nlm.nih.gov /) was used as the seed sequence SEQ ID NO: 1 as template design amplification primers, wherein 5' -RACE specific primers (GSPs) should satisfy 23-28 nt in length and 50-70% in GC content, and Universal Primer Mix (G-PCR)

The universal primers designed by the RACE 5 '/3' Kit comprise two Long Primer and Short Primer) which are not complementary at the 3 'ends, two primers meeting the conditions are designed, namely GSP1 and NGSP1, and GATTACGCCAAGCTT is added at the 5' end of the universal primers to facilitate the connection and sequencing of a carrier in a subsequent test. The design of the Prox1 gene 3 ' -RACE specific primer is similar to that of the 5 ' -RACE specific primer, the designed primers are respectively named as GSP2 and NGSP2, and GATTACGCCAAGCTT is added at the 5 ' end of the primer. The specific primer sequences are shown in Table 1.

TABLE 1 primer information for amplification of the porcine Prox1 gene

Note: the lower case letter sequence is the sequence of the RACE subsequent fragment vector ligation and the sequencing-added linker.

1.2 Generation of RACE-Ready cDNA

Is strictly according to

The steps and requirements of the RACE 5 '/3' Kit are to prepare cDNA reaction solutions of 5 '-RACE and 3' -RACE respectively, mix them in sequence at room temperature, incubate them in a hot-cover thermal cycler at 42 ℃ for 90min and 70 ℃ for 10 min. After completion of the reaction, the first strand cDNA synthesis reaction 5 '/3' -RACE-Ready cDNA was diluted with 90. mu.l of dilution Tricine-EDTA Buffer.

1.3, 5 '-RACE and 3' -RACE amplification

5' -RACE amplification: first round of amplification was performed using diluted 5 'RACE-Ready cDNA as template and Long primer and GSP1 as upstream and downstream primers according to PCR reaction system of 5' -RACE-Ready cDNA 2.5. mu.L, Long primer 5. mu.L, GSP 11. mu.L, Master Mix (premixed, including 15.5. mu.L ddH2O, 25.0. mu.L 2 XSeqAmp Buffer, 1.0. mu.L SeqAmp DNA Polymerase): 30s at 94 ℃ and 3min at 72 ℃ for 5 cycles; 30s at 94 ℃, 30s at 70 ℃ and 30min at 72 ℃ for 5 cycles in total; 30s at 94 ℃, 30s at 68 ℃ and 3min at 72 ℃ for 20 cycles in total; finally, the mixture is stored at 4 ℃. And (3) finding that the target fragment is not obvious by electrophoresis, diluting the first round amplification product by 50 times, and performing nested PCR by using the product as a template, wherein a PCR reaction system comprises: DNA template 2. mu.L, Short primer 0.5. mu.L, NGSP 10.5. mu.L, ddH2O 7. mu.L, I-5 ^TM 2 × 10 μ L of High-Fidelity Master Mix (Scentillaceae). PCR reaction procedure: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 15s, and extension at 72 ℃ for 30s for 30 cycles; after 72 ℃ the extension was carried out for 7min and the cells were stored at 4 ℃. After electrophoresis of the amplified product, the band is obvious (figure 1), the target fragment is cut and recovered, the purified PCR product is connected with pClone007 Vector Kit (engine organism) Vector, and the positive clone is sequenced after transformation, so that the 484bp target sequence SEQ ID NO. 2 is obtained.

3' -RACE amplification: using the diluted first strand cDNA as a template and Long primer and GSP2 as upstream and downstream primers, Master Mix (premixed, containing 15.5. mu.L ddH2O, 25.0. mu.L 2 XSeqAmp Buffer, 1.0. mu.L SeqAmp DNA Polymerase) was prepared in the same manner as 3' -RACE-Ready cDNA 2.5. mu.L, Long primer 5. mu.L, GSP 21. mu.LThe first round of amplification is performed, and the PCR reaction procedure (touchdown PCR): 30s at 94 ℃ and 3min at 72 ℃ for 5 cycles; 30s at 94 ℃, 30s at 70 ℃ and 30min at 72 ℃ for 5 cycles in total; 30s at 94 ℃, 30s at 68 ℃ and 3min at 72 ℃, and 20 cycles are counted; finally, storing at 4 ℃. And (3) finding that the target fragment is not obvious by electrophoresis, diluting the first round amplification product by 50 times, and performing nested amplification by using the product as a template, wherein a PCR reaction system comprises: DNA template 2. mu.L, Short primer 0.5. mu.L, NGSP 20.5. mu.L, ddH2O 7. mu.L, I-5 ^TM 2 × 10 μ L of High-Fidelity Master Mix (Scirpus organism). PCR reaction procedure: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 15s, and extension at 72 ℃ for 30s for 30 cycles; after 72 ℃ the extension was carried out for 7min and the cells were stored at 4 ℃. After electrophoresis of the amplified product, the band is obvious (fig. 2), the target fragment is cut and recovered, the purified PCR product is connected with pClone007 Vector Kit (Optimus sp. Okagi) Vector, the positive clone is sequenced after transformation, and the 948bp target sequence SEQ ID NO: 3.

1.4, amplifying CDS of porcine Prox1 gene and obtaining porcine cDNA sequence

According to the 5 ' -UTR and 3 ' -UTR sequences obtained by amplification and the predicted porcine Prox1 gene mRNA Sequence in NCBI database (https:// www.ncbi.nlm.nih.gov /), 3 pairs of primers are designed to amplify the porcine Prox1 gene Coding Sequence (Coding Sequence, CDS), the primers should meet the conditions that the 3 ' end of the primers avoids hairpin structures as much as possible, the Tm value of the primers is generally controlled to be between 55 ℃ and 65 ℃, the GC content of the primers is controlled to be between 40% and 60%, the Tm values and the GC contents of forward primers and reverse primers are as consistent as possible, and the specific primer sequences are shown in Table 1. The first strand cDNA diluted at step 1.2 was used as a template in accordance with

25 μ L of Master Mix (Nanjing Novozan), 2 μ L of each of the upstream and downstream primers, 2 μ L of diluted cDNA template, ddH ₂ O19. mu.L of PCR reaction system. PCR reaction procedure: pre-denaturation at 98 ℃ for 5min, denaturation at 98 ℃ for 30s, annealing at 58 ℃ for 30s, and extension at 72 ℃ for 45s for 35 cycles; after 72 ℃ the extension was 7min and the cells were stored at 4 ℃. The target fragment is cut and recovered, and the purified PCR product and pMD are obtained ^TM Ligation of 19-T Vector (product of Takara Co., Ltd.), transferAfter the transformation, the positive clone is sequenced to obtain three target sequences of 1073bp, 1076bp and 822bp respectively. Finally, the amplified three CDS sequences are compared and spliced with 5 'UTR and 3' UTR sequences, and finally the content of the porcine Prox1 gene clone is completed. The specific sequence is shown in SEQ ID NO. 4.

Example 2: cloning and activity identification of proximal promoter region of porcine Prox1 gene

2.1 cloning of proximal promoter region of porcine Prox1 Gene and construction of deletion expression vector

(1) The genomic Sequence comprising the porcine Prox1 gene (NCBI Reference Sequence: NC-010451.3) was retrieved from the NCBI database (https:// www.ncbi.nlm.nih.gov /) Sscofa 10.2 version, and the DNA fragment 1957bp before the transcription start site T was used as a potential promoter region of the Prox1 gene in combination with the Prox 15 'UTR Sequence obtained from 5' RACE.

(2) 5 pairs of promoter primers with different amplification lengths are designed by taking sequences downloaded from a database as a template, and 5' deletion fragments share the same downstream primer and are named as PR. The upstream primers were named P1F, P2F, P3F, P4F and P5F, respectively, and 5 pairs of primers were designed as shown in Table 2, and the PCR reaction system: about 200ng of DNA as a template, 0.5. mu.L of upstream and downstream primers, ddH2O 7. mu.L, I-5 ^TM 2 × 10 μ L of High-Fidelity Master Mix DNA polymerase. PCR reaction procedure: pre-denaturation at 98 ℃ for 2min, denaturation at 98 ℃ for 10s, annealing at 58 ℃ for 15s, and extension at 72 ℃ for 30s for 30 cycles; after 72 ℃ the extension was carried out for 7min and the cells were stored at 4 ℃. Respectively amplifying 2275bp, 1500bp, 1000bp, 510bp and 215bp of fragments, and carrying out sequencing confirmation.

TABLE 2 primer information for amplification of different fragments of the promoter of the porcine Prox1 gene

Note: the small letter sequences are linker protection sequences, the underlined sections indicate SacI and HindIII cleavage sites.

(3) Restriction enzymes SacI and HindIII (Thermo Scientific Co.) linearized pGL3-Basic plasmid at 1. mu.L, 10 XF, respectively for SacI and HindIII2 μ L of ast digest Buffer, 5 μ L of pGL3-Basic plasmid, ddH ₂ O11. mu.L. The enzyme was cleaved at 37 ℃ for 1 h.

(4) The previously amplified DNA fragment and the linearized plasmid pGL3-Basic were subjected to agarose gel electrophoresis and, after purification, their mass and concentration were determined using a NanoDrop 2000 Spectrophotometer (NanoDrop, USA). The OD260/OD280 of the sample was 1.8-2.0 before it was used in the subsequent tests.

(5) Using Trelief ^TM The Sosoo Cloning Kit (Otsugae organisms) was used for ligation, and the reaction system was as follows: linearized plasmid pGL3-Basic 2. mu.L, target DNA fragment 10. mu.L, 2 XSoso Mix 5. mu.L, ddH2O 3. mu.L, reacted at 50 ℃ for 15 min. The ligation reaction was completed.

(6) 100 μ L of the competent cells thawed in ice bath were added to the ligation product, mixed gently and allowed to stand on ice for 25 min. Performing water bath heat shock at 42 ℃ for 30-45s, quickly transferring to an ice bath, standing for 2min, adding 500 mu L of sterile LB culture medium without antibiotics into a centrifuge tube, and recovering for 1h by a constant temperature shaking table at 37 ℃ at 200 rpm. The suspension was evenly spread on solid LB plates containing ampicillin overnight, after which single colonies were picked off and maintained in a 2ml centrifuge tube at 37 ℃ with 200rpm shaking for 4h, and transferred to a 50ml centrifuge tube for further amplification for 12 h. After the culture medium is turbid, the non-endotoxin plasmid is extracted.

(7) The Omega E.Z.N.A was used. ^TM The Endo Fee Plasmid Mini Kit II is used for Plasmid extraction according to the following steps: centrifuging 50ml of the centrifugal tube bacterial liquid for 10min at 5000 Xg, pouring out the culture medium, adding 500 mu L of Solution I/RNaseA mixed Solution into the settled colonies, carrying out vortex oscillation to completely suspend the cells, transferring the cells into a 2ml centrifugal tube, adding 500 mu L of Solution II, slightly reversing and mixing for 7-10 times, adding 250 mu L of ice bath Buffer N3, and gently reversing and mixing until white flocculent precipitates are formed, and centrifuging for 10min at room temperature which is more than or equal to 12000 Xg.

(8) Transferring the supernatant to a new 1.5ml centrifuge tube, adding 0.1 time volume of ETR solution, mixing, ice-cooling for 10min, water-bathing for 5min at 42 ℃, centrifuging for 3min at room temperature of 12000 Xg or more, transferring the supernatant to a new 1.5ml centrifuge tube, adding 0.5 time volume of absolute ethyl alcohol, mixing, and standing for 1-2 min. Transferring the mixed solution into a HiBind column sleeved with a collecting pipe, centrifuging at 10000 Xg for 1min, then discarding the filtrate, and filtering all the mixed solution.

(9) The column was replaced into the collection tube. Add 500. mu.L HB Buffer and centrifuge at room temperature 10000 Xg for 1 min.

(10) Discard the filtrate, replace the column to the collection tube again with 700. mu.L of DNA Wash Buffer, centrifuge at room temperature 10000 Xg for 1min and discard the filtrate. And repeating the steps once. The column was centrifuged at 10000 Xg for 2min to spin dry the column matrix.

(11) The column was placed in a clean 1.5ml centrifuge tube and 80. mu.L of endo-free experiment Buffer was added to the column matrix, allowed to stand at room temperature for 2min, then centrifuged at room temperature not less than 10000 Xg for 2min to elute DNA, labeled and stored at-20 ℃.

Up to this point, eukaryotic expression vectors containing promoter regions of different lengths of the Prox1 gene were constructed in total of 5, the transcription initiation site was marked with +1, and the constructed promoter activity analysis vectors were named pGL3-2275(-1957/+318), pGL3-1500(-1182/+318), pGL3-1000(-682/+318), pGL3-510(-192/+318), and pGL3-215(+122/+318), respectively.

2.2 identification of promoter activity of porcine Prox1 gene

(1) Cell culture and inoculation

Cell culture conventional cell culture was performed using 10% fetal bovine serum (Gibco) medium, cells were digested prior to transfection and diluted to 1-4X 10 cell density using growth medium ⁵ One/ml, and 500. mu.l of cell suspension was inoculated into 24-well culture plates, and at least 3 replicates per sample were run. The applicants have analyzed promoter activity in the 293T cell line.

(2) Cell transfection

a. Preparation of transfection plasmid, diluting the target plasmid with different fragment sizes and pGL3-Basic and pGL3-control plasmids to 0.2. mu.g/. mu.l, diluting the internal reference plasmid (TK) to 0.02. mu.g/. mu.l, mixing 1. mu.g of the target plasmid with 0.05. mu.g of the internal reference plasmid (ratio of 20: 1), and gently blowing and beating uniformly. At the same time, 1. mu.g of pGL3-Basic and pGL3-Control were mixed with 0.05. mu.g of internal reference plasmid and used as negative and positive controls, respectively.

b. The plasmid mixed in (a) was diluted with 50. mu.l of Opti-MEM serum-free medium (Gibco), mixed gently, and left at room temperature for 5 min.

c. Taking appropriate amount of Lipofectamine ^TM 3000 Lipofectin transfection reagent (Invitrogen) was diluted with 50. mu.l of Opti-MEM serum-free medium, gently mixed, and left at room temperature for 5 min. The amount of transfection reagent is determined by the amount of plasmid taken, and the transfection reagent of the present invention: the ratio of plasmids was 2.5: 1.

d. mixing the mixed plasmid diluted in (b) and the lipofectin diluted in (c), gently mixing, and standing at room temperature for 20 min.

e. At the time of standing the transfection complex, the cell culture medium inoculated into the 24-well plate at the night before was removed and replaced with fresh Opti-MEM serum-free medium.

f. 100. mu.l of the transfection complex prepared in (d) was gently added to the 24-well plate, and the plate was gently shaken to uniformly distribute the transfection complex in the cell culture solution.

g. Place the cell culture plate in 5% CO ₂ Culturing at 37 deg.C in incubator, changing to fresh culture medium containing serum after 4-6 hr, and collecting cells after 24 hr.

(3) Promoter Activity assay and statistical analysis

Cell lysis and sample pretreatment were performed using a Dual-luciferase reporter Assay System (Promega corporation), with specific procedures referenced to kit instructions. Sample dual luciferase activity assays were performed on a Glomax 20/20 luminometer platform (Promega corporation) and the relative promoter activities are expressed as: firefly luciferase activity (firefly luciferase activity)/Renilla luciferase activity (Renilla luciferase activity). The significance test is carried out by using an One-way ANOVA program in Graphpad prism 6.01 software, the promoter activity difference is considered to reach a significant level when P <0.05, and the promoter activity difference is considered to reach a very significant level when P < 0.01. The detection result of the promoter activity shows that each promoter deletion fragment has the capability of independently promoting gene expression, the fragment with the lowest promoter activity is pGL3-1500(-1182/+318bp), and positive regulatory elements influencing the promoter activity exist in the region of-1182/-1957 bp; while negative regulatory elements affecting promoter activity were present in the-1182/-682 bp region, -682/-192bp region, and-192 to +122bp region (FIG. 3).

Preparation example 3: analysis of pig Prox1 Gene expression Pattern

To determine the potential relationship of Prox1 expression patterns to skeletal muscle fiber types, we randomly selected 3 Durock × Meishan pigs as a binary hybrid and collected heart, liver, spleen, kidney, fat, and skeletal muscle tissues biceps femoris (white muscle) and soleus muscle (red muscle) of two different muscle fiber types. Total RNA extraction was performed using TRIzol reagent (Invitrogen Co.), and Prime Script was used ^TM The first strand cDNA was synthesized using the reagent (TaKaRa), and then the expression level of Prxo1 gene was measured by Real-time PCR. The cloned porcine Prox1 gene full-length cDNA nucleotide sequence SEQ ID NO. 4 is used as a reference to design a Real-time PCR primer, and the quantitative upstream and downstream primer sequences are Prox 1-F: CCGTTTCAGAGTCCGTTAGGT, respectively; prox 1-R: TGGTGGGATGACATCTTGGTC, all PCR reactions were performed in 3 replicates and the relative gene expression levels were calculated using the delta Ct method with the HPRT gene as the reference gene for gene relative expression level correction. Charting was performed using GraphPad Prism 6.01 and significance test performed<0.05 indicated significant differences in gene expression,. about.P<0.01 indicates that the gene expression difference is extremely significant. The detection result of the gene expression pattern indicates that the porcine Prox1 is mainly expressed in high abundance in heart, liver and skeletal muscle, and the expression level in the soleus muscle of the red muscle is very obviously higher than that in the biceps femoris (P)<0.01) (fig. 4), suggesting that the porcine Prox1 gene may be closely related to the fiber type of skeletal muscle.

In addition, the longissimus tissue of the back of a 279 scalp multiplied by Du multiplied by big quaternary commercial pig is collected, 30 individuals are randomly picked, and the expression levels of skeletal muscle type differential marker genes Myoglobin, MyHC-I, MyHC-IIB, MyHC-IIX and Prox1 gene are detected by using Real-time PCR technology. The results of dividing the tested individuals into 2 groups based on the ratio of MyHC-IIB to MyHC-I gene expression, with the ratio of 2.0 as the cut-off value, showed that the porcine Prox1 has a consistent expression pattern with both Myoglobin and MyHC-I genes, as opposed to MyHC-IIB (FIG. 5). The expression pattern result suggests that the porcine Prox1 is an important candidate gene affecting the type of porcine muscle fiber or the color of pork or other related meat quality traits.

Example 4: pig Prox1 gene genetic variation site detection and molecular marker research and development

1. Test pigs and phenotypic assays

The test pigs related to the invention are 133 individuals in total from 7 different pig species including large white, long white, Duroc, Erhualian, Meishan, Mi pigs and Suhuai pigs. In addition, a 279 scalp × du × length × large quaternary commercial swinery was included for molecular marker effect analysis. The measured phenotypic data include carcass weight, backfat thickness, pH _45min 、pH _24h 、L* _45min 、a* _45min 、b* _45min 、L* _24h 、a* _24h 、b* _24h And water drop loss _24h And water drop loss _48h Glycogen content, glucose-6-phosphate content, lactic acid content, glycolytic potential. Finally, the thickness of the back fat of the rib is measured by an electronic vernier caliper, the pH value is measured by a portable pH meter (model: HI 9125 portable pH, Australia), the flesh color L, a, b are measured by a portable colorimeter (model: CR-10, Japan), the drip loss is measured by a hanging method, the intramuscular fat content is measured by a Soxhlet extraction method, the lactic acid content, the glycogen content and the glucose content are measured by a Nanjing build kit (build, Nanjing), the glucose-6 phosphoric acid content is measured by a Sigma kit (product number: MAK), and the phenotype measurement data and the variation coefficient of the test pig herd are shown in Table 3.

TABLE 3 phenotypic assay data for test herds

Note: CW is carcass weight; BF is backfat thickness; IMF intramuscular fat; l: brightness; a is as follows: the red degree; b: yellowness; DL _24h : water drip loss 24 hours after slaughter; DL _48h : dripping water for 48 hours after slaughtering; CL: loss of cooking; SF is shearing force; MG: muscle glycogen; g: muscle glucose(ii) a G6P: glucose-6-phosphate; LA: lactic acid; GP: glycolytic potential.

2. Identification of genetic variation sites of Prox1 gene of pig

The invention adopts the sequencing technology of the Shanghai sky Hao FastTarget target region to perform target region targeted sequencing on the cloned Prox1 near-end-2 kb promoter sequence (the transcription start site is marked as +1), the sequencing platform is an Illumina Miseq sequencer, and the bidirectional sequencing is realized on the target fragment by adopting a 2 x 150bp sequencing mode. The method is used for sequencing 7 different pig breeds, total 133 pure pig individuals and 66 scalp X Du X long X commercial pig Prox1 gene proximal-2 kb promoter sequences. Sequencing results show that 18 genetic variation sites coexist in the porcine Prox1 proximal-2 kb promoter sequence, the positions of the 18 genetic variation sites in the porcine Prox1 gene proximal promoter, and the positions on the Sscofa 10.2 reference genome version can be seen in Table 4. The detailed results of the genotypes and allele frequencies of the 18 genetic variation sites in different pig species are shown in Table 5.

TABLE 4 genetic variation site types and positions in the proximal promoter region of the porcine Prox1 gene

Note: ¹ sscofa 10.2 reference genome

TABLE 5 analysis of genotype frequency and allele frequency of genetic variation site of proximal promoter sequence of porcine Prox1 gene

3. Target region targeted sequencing typing result verification

On the basis, in order to further verify the reliability of the sequencing result, 3 sites with larger variation selected from 18 genetic variation sites SNV11(g. -930bp), SNV14(g. -1421bp) and SNV18(g. -1573bp) are subjected to genotyping verification on 279 scalp × Du × Long × big quaternary commercial swinery by adopting a PCR-RFLP strategy. Firstly, corresponding amplification primers are designed according to the positions of 3 genetic variation sites in a promoter near Prox1, SNV11 genetic variation sites are amplified by F1 and R1, SNV14 genetic variation sites are amplified by F2 and R2, SNV18 genetic variation sites are amplified by F3 and R3, and the information of the amplification primers is shown in Table 6. PCR products amplified from SNV11 genetic variation sites are cut by TaqI enzyme to generate three genotypes, when the sites are A, the sites cannot be cut by the TaqI enzyme, and only one fragment is obtained after the enzyme cutting, and the length is 576bp (A allele); when the site is C, TaqI enzyme can cut the PCR product into two fragments with the lengths of 418bp and 162bp (C allele). The TaqI-RFLP enzyme cutting and typing result of the pig Prox1 gene is shown in figure 6. The AA genotype only has one 576bp band; the CC genotype has two bands of 418bp and 162bp, and the CA genotype has three bands of 576bp, 418bp and 162 bp. The genotype was clearly discriminated by 2% agarose gel electrophoresis (FIG. 6). PCR products amplified from SNV14 genetic variation sites are cut by BseNI to generate three genotypes, when the sites are A, the sites can not be cut by BseNI, only one fragment is obtained after the enzyme cutting, and the length is 485bp (A allele); when the site is G, BseNI enzyme can cut the PCR product into two fragments with the lengths of 362bp and 125bp (G allele). The results of BseNI-RFLP enzyme-cleavage typing of the porcine Prox1 gene are shown in FIG. 7. The AA genotype only has a 485bp band; the GG genotype has two bands of 362bp and 125bp, and the CA genotype has three bands of 485bp, 362bp and 125 bp. The genotype was clearly discriminated by 2% agarose gel electrophoresis (FIG. 7). The PCR product amplified by SNV18 genetic variation site is cut by HpaII enzyme to generate three genotypes, when the site is G, the site can not be cut by HpaII enzyme, only one fragment is obtained after the enzyme cutting, and the length is 373bp (G allele); when the site is C, the HpaII enzyme can cut the PCR product into two fragments with the lengths of 315bp and 60bp (C allele). The result of HpaII-RFLP enzyme cutting and typing of the porcine Prox1 gene is shown in FIG. 8. The GG genotype only has a 373bp band; the CC genotype has two bands of 315bp and 60bp, and the GC genotype has three bands of 373bp, 315bp and 60 bp. The genotype was clearly discriminated by electrophoresis on a 1.5% agarose gel (FIG. 8). And comparing the PCR-RFLP genotyping results of the 3 genetic variation sites with the target region targeted sequencing genotyping result, wherein the results show that the genetic variation sites identified by the target region targeted sequencing are completely consistent.

TABLE 6 porcine Prox1 gene promoter three variation site polymorphism amplification primers

4. Trait association analysis

Based on completing 279 scalp × Du × Long × big quaternary commercial pig genotyping by PCR-RFLP, the applicant adopts SAS statistical software (SAS Institute Inc, Version 8.0) MLM program to perform association analysis on genetic variation site polymorphism and characters. The statistical model is as follows:

Y _ijk ＝μ+Genotype _i +Sex _j +Batch _k +b _ijk Z _ijk +e _ijk

Y _ijk is a trait phenotype value; μ is the population mean; genotype _i For genotype effects, Sex _j 、Batch _k Sex, slaughter batch effect respectively; b _ijklm Is a trunkRegression coefficient of body weight to meat quality trait, X _ijk For carcass weight, e _ijk Is the residual effect.

The correlation analysis results are shown in Table 7, and the analysis results show that C/A variation site polymorphism at g. -930bp (SNV11) in the proximal promoter of porcine Prox1 and pH _24h In significant correlation, the pH value of CA type individuals is significantly lower than that of CC type individuals (P ═ 0.0244), and the correlation with 24h drip loss is close to a significant level (P ═ 0.0650), and the 24h drip loss of CA type individuals is higher than that of CC type individuals, which suggests that the site can be used as an auxiliary marker for the genetic improvement of pork quality traits. After the pig is slaughtered, the pH value of skeletal muscle gradually decreases, and the pork quality is influenced by the pH value which decreases too fast or too low. With the reduction of the pH value, the structure of the muscle can be changed in various types due to the reduction of the pH value, and the difference of the change of the structure of the muscle can directly influence the difference of the water loss of pork, namely the difference of the drip loss. The research result shows that the pH value of the muscle of a CA type individual after slaughtering is obviously lower than that of a CC type individual, and on the contrary, the 24-hour drip loss is higher than that of the CC type individual, which suggests that the CC type individual is more favorable for the water conservation of pork. In fact, the drip loss for type CA individuals at 48h was also higher than for type CC individuals, although statistically not reaching significant levels. It is noteworthy that the two marker sites SNV14(g. -1421) and SNV18(g. -1573) detected in the present application are fully linked to SNV11(g. -930), and thus all three markers are linked to pH _24h And the method has correlation with drip loss, wherein any one marker can be independently used or combined with other two markers for molecular marker assisted breeding.

TABLE 7 correlation analysis results of polymorphism and characters of three variation sites of porcine Prox1 gene promoter

Note: the letters in the numerical superscript are identical indicating that the difference is not significant, and the lower case letters indicate that the difference is significant (P <0.05) when the letters are different.

The invention discloses molecular cloning and application of a pig meat quality character related gene Prox1, wherein a pig Prox1 gene full-length cDNA sequence is cloned by utilizing RACE technology, the full length of the sequence is 3683bp, and the sequence characteristics are shown as SEQ ID NO. 4. The active region of the promoter region of the porcine Prox1 gene is determined by using a double-luciferase activity analysis technology, and a positive regulatory element influencing the promoter activity exists in the-1182/-1957 bp region; and negative regulatory elements affecting the promoter activity are present in the-1182/-682 bp region, -682/-192bp region, and-192 to +122bp region. The expression pattern result shows that the porcine Prox1 gene is expressed in high abundance in heart, liver and skeletal muscle, and the expression level in the soleus muscle of the red muscle is extremely higher than that of the biceps femoris muscle of the white muscle. In addition, the expression pattern of the population sample shows that the porcine Prox1 gene is a gene which is obviously related to the meat color and can be used as a marker gene for grading the meat color. In addition, 18 genetic variation sites are identified in the promoter sequence of the Prox1 gene of the pig, and three completely linked genetic variation sites are proved to be obviously related to the pH character of pork, so that the molecular marker can be used as an important molecular marker for auxiliary breeding of the production character of the pig.

Although the invention has been described in detail, it will be appreciated by those skilled in the art that modifications will be apparent within the spirit and scope of the invention. For example, many modifications may be made to adapt a particular situation, material, composition of matter, or process step to the objective, spirit and scope of the present application. All such modifications are intended to be included within the scope of the claims of the present invention. Moreover, the technical content disclosed in the above description may be modified or changed equally to the equivalent embodiments, and all of the modifications and changes fall within the technical scope of the present invention.

Sequence listing

<110> Nanjing university of agriculture

<120> molecular cloning and application of pork quality trait related gene Prox1

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2214

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

atgcctgacc atgacagcac agccctctta agccggcaaa ccaagaggag aagagttgac 60

attggagtga aaaggacggt agggacagca tctgcatttt ttgctaaggc aagagcaacg 120

ttttttagtg ccatgaatcc ccaaggttcc gagcaggatg ttgagtattc agtggtgcag 180

catgcagatg gggaaaagtc aaatgtactc cgcaagctgc tgaagagggc gaactcgtat 240

gaagatgcca tgatgccttt tccaggagca accataattt cccagctgtt gaaaaataac 300

atgaacaaaa atggtggcac ggagcccagt ttccaagcca gcggtctctc tagtacaggc 360

tccgaagtac atcaggagga tatatgcagc aactcttcaa gagacagccc ccctgagtgt 420

ctttcccctt ttggcaggcc tactatgagc cagtttgata tggatcgctt gtgtgacgag 480

cacctgagag caaagcgcgc ccgggttgag aatataatcc gaggtatgag ccattccccc 540

agcgtggcat taaggggcaa tgaaaatgaa agagagatgg ccccgcagtc tgtgagtccc 600

cgagaaagtt accgagaaaa caaacgcaag cagaagctgc cccagcagca gcaacagagt 660

ttccagcagc tggtttcagc ccgcaaagaa cagaagcgag aggagcgccg acagctgaaa 720

cagcagctgg aggacatgca gaaacagctg cgccagctgc aggaaaagtt ctaccaaatc 780

tatgacagca ctgattctga aaatgatgaa gatggtaacc tgtctgaaga cagcatgcgc 840

ccggagatgc tggatgccag ggcccaggac tccgtgggga ggtcagataa tgagatgtgc 900

gagctggacc cagggcagtt catcgaccgc gcccgggccc tgatcaggga gcaggagatg 960

gcagaaaaca agccgaagcg ggaaggcagc aacaaagaaa gagaccacgg gccaaactcc 1020

ttacaacccg aaggcaaaca tttggccgag accttgaaac aggaactgaa cactgccatg 1080

tcgcaagttg tggacactgt ggtcaaagtc ttctcggcca agccctcccg ccaggttcct 1140

caggtcttcc ccccgctcca gatcccccag gccagattcg cagtcaacgg ggacaaccac 1200

aatttccaca ccgccaacca gcgcctgcag tgctttggcg acgtcatcat tccgaacccc 1260

ctggacacct tcggcaacgt gcagatgccc agctccaccg accagacgga agcgctgccc 1320

ctggtggtcc gcaaaaactc ctctgaccag tcggcctccg gcccccccgc cggcggccac 1380

caccagcccc tgcaccagtc gcctctgtcg gccaccgcgg gcttcaccac gtccaccttc 1440

cgccacccct tccccctccc cctgatggcc tacccgtttc agagtccgtt aggtgctccc 1500

tccggctcct tctcgggaaa agacagagcc tctcctgaat ccctagactt aaccagggag 1560

accacgagtc tgaggaccaa gatgtcatcc caccacctga gccaccaccc ttgttcacca 1620

gcacatccac ccagcgccgc agaagggctc tccttgtcgc tcatcaaatc cgagtgtgga 1680

gagcttcaag acatgtccga aatctcacct tactcgggaa gtgcaatgca ggaaggattg 1740

tcacccaatc acttgaaaaa agcaaagctc atgttctttt atacccgtta tcccagctcc 1800

aatatgctga agacctactt ctctgatgtg aagttcaaca gatgcattac ctctcagctc 1860

atcaagtggt ttagcaattt ccgtgagttt tactacattc agatggagaa atacgcgcgt 1920

caagccatca acgatggagt caccagtact gaagagctgt ctataaccag agactgtgag 1980

ctgtacaggg ctctgaacat gcactacaat aaagcaaatg actttgaggt tccagagaga 2040

ttcctggaag ttgcgcagat cacattacgg gagtttttca atgccattat cgcaggcaaa 2100

gatgttgatc cttcctggaa gaaggccata tacaaggtca tctgcaagct ggatagtgaa 2160

gtccctgaga ttttcaaatc cccaaactgc ctacaagagc tgcttcatga gtag 2214

<210> 2

<211> 484

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

tggagcggag ccctcagctg agggagcgct cggaaataat acaccattgc agccggggag 60

agcagagcga cgcaaaagag ctctcgccgg gtccgcccgc tccctctccg cttcgctcct 120

ctcctctcct cctcctccct ctcctcctct ctccgatcct cggcggtcct cctctcgcct 180

cttctcttcc cctctcctcg ctgccctcct cgccccctct cctctccctg gccatcctgc 240

tctggctgtc ccatctccct ctccccctcg gcccgctcgc gcgctcccgc acggacccac 300

cgtccctggt ccaattatca tattcatcac ccgcaagatc tcaccgtgtg tgtgcgcgcg 360

tgtgttttcc tctctccgcc tgcaaaaaag gctcggtccc actgctctct gcaccgcggt 420

cccgggattc ttgagctgtg cccagctgac gagcttttga agatggcaca ataactgtcc 480

agtg 484

<210> 3

<211> 948

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaatttcaac aactctttcg gaatgtacga gtagtcgcag tcccctttgg atgtccaagt 60

tacacgtgtc tagattttga gttcatgtat atgtgtatgg gaggcatgga tatgttctga 120

aatcggctgg taattcctcc tcatcatctt cctctcactt tcttccgttt tccattgcaa 180

ggggatggtt cttttccttc cgcctttagt ttacttttgc ccaaggccct taacatgtgg 240

agacgtaaaa tagggttaag tttcagggaa aaaaaggatg ttggcgtgtg taacgtcggt 300

gttcgcaagg gagggcattt gttaaagatg cttttgcttg attgatggtt tattgcaact 360

ggcggttggt tggcggaggg agacccgtga cacagcaagc agctctgtct tcagtgatgt 420

gtcttttatt ttcacggcta aggagatagg aaaatgcaat gaaaccacgt gataaactga 480

aatgtttggt ttgaactcag taagtagctt tttatcgtat gtttaaaaat aatgccagtg 540

gcagatgaat agttcacttt tcaaaagtag cccaaaaggc cagatttgaa aaagaaacat 600

catcactaac tgtcaaaaag cctttcctaa gagaaatggc caacacccca aactaggatt 660

ggtatcttat ggaggcaaag caattcggta caaaactgac tctttcaaga tgagactaga 720

acctcgcgtg atttctagtc gcctctcgaa attctgcaac aggctcttct tgctaataag 780

tgagtggata tcattcttca tagagaaaaa cccctataac gtgttatttt ctatttatct 840

tgcttcagat atgaaaaggc acataagttt caaatttatt ctttgctcca ctctgtttat 900

atgctttaaa agagcaatta tttgttgaat atttaacact tttttttt 948

<210> 4

<211> 3683

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tggagcggag ccctcagctg agggagcgct cggaaataat acaccattgc agccggggag 60

agcagagcga cgcaaaagag ctctcgccgg gtccgcccgc tccctctccg cttcgctcct 120

ctcctctcct cctcctccct ctcctcctct ctccgatcct cggcggtcct cctctcgcct 180

cttctcttcc cctctcctcg ctgccctcct cgccccctct cctctccctg gccatcctgc 240

tctggctgtc ccatctccct ctccccctcg gcccgctcgc gcgctcccgc acggacccac 300

cgtccctggt ccaattatca tattcatcac ccgcaagatc tcaccgtgtg tgtgcgcgcg 360

tgtgttttcc tctctccgcc tgcaaaaaag gctcggtccc actgctctct gcaccgcggt 420

cccgggattc ttgagctgtg cccagctgac gagcttttga agatggcaca ataactgtcc 480

agtgatgcct gaccatgaca gcacagccct cttaagccgg caaaccaaga ggagaagagt 540

tgacattgga gtgaaaagga cggtagggac agcatctgca ttttttgcta aggcaagagc 600

aacgtttttt agtgccatga atccccaagg ttccgagcag gatgttgagt attcagtggt 660

gcagcatgca gatggggaaa agtcaaatgt actccgcaag ctgctgaaga gggcgaactc 720

gtatgaagat gccatgatgc cttttccagg agcaaccata atttcccagc tgttgaaaaa 780

taacatgaac aaaaatggtg gcacggagcc cagtttccaa gccagcggtc tctctagtac 840

aggctccgaa gtacatcagg aggatatatg cagcaactct tcaagagaca gcccccctga 900

gtgtctttcc ccttttggca ggcctactat gagccagttt gatatggatc gcttgtgtga 960

cgagcacctg agagcaaagc gcgcccgggt tgagaatata atccgaggta tgagccattc 1020

ccccagcgtg gcattaaggg gcaatgaaaa tgaaagagag atggccccgc agtctgtgag 1080

tccccgagaa agttaccgag aaaacaaacg caagcagaag ctgccccagc agcagcaaca 1140

gagtttccag cagctggttt cagcccgcaa agaacagaag cgagaggagc gccgacagct 1200

gaaacagcag ctggaggaca tgcagaaaca gctgcgccag ctgcaggaaa agttctacca 1260

aatctatgac agcactgatt ctgaaaatga tgaagatggt aacctgtctg aagacagcat 1320

gcgcccggag atgctggatg ccagggccca ggactccgtg gggaggtcag ataatgagat 1380

gtgcgagctg gacccagggc agttcatcga ccgcgcccgg gccctgatca gggagcagga 1440

gatggcagaa aacaagccga agcgggaagg cagcaacaaa gaaagagacc acgggccaaa 1500

ctccttacaa cccgaaggca aacatttggc cgagaccttg aaacaggaac tgaacactgc 1560

catgtcgcaa gttgtggaca ctgtggtcaa agtcttctcg gccaagccct cccgccaggt 1620

tcctcaggtc ttccccccgc tccagatccc ccaggccaga ttcgcagtca acggggacaa 1680

ccacaatttc cacaccgcca accagcgcct gcagtgcttt ggcgacgtca tcattccgaa 1740

ccccctggac accttcggca acgtgcagat gcccagctcc accgaccaga cggaagcgct 1800

gcccctggtg gtccgcaaaa actcctctga ccagtcggcc tccggccccc ccgccggcgg 1860

ccaccaccag cccctgcacc agtcgcctct gtcggccacc gcgggcttca ccacgtccac 1920

cttccgccac cccttccccc tccccctgat ggcctacccg tttcagagtc cgttaggtgc 1980

tccctccggc tccttctcgg gaaaagacag agcctctcct gaatccctag acttaaccag 2040

ggagaccacg agtctgagga ccaagatgtc atcccaccac ctgagccacc acccttgttc 2100

accagcacat ccacccagcg ccgcagaagg gctctccttg tcgctcatca aatccgagtg 2160

tggagagctt caagacatgt ccgaaatctc accttactcg ggaagtgcaa tgcaggaagg 2220

attgtcaccc aatcacttga aaaaagcaaa gctcatgttc ttttataccc gttatcccag 2280

ctccaatatg ctgaagacct acttctctga tgtgaagttc aacagatgca ttacctctca 2340

gctcatcaag tggtttagca atttccgtga gttttactac attcagatgg agaaatacgc 2400

gcgtcaagcc atcaacgatg gagtcaccag tactgaagag ctgtctataa ccagagactg 2460

tgagctgtac agggctctga acatgcacta caataaagca aatgactttg aggttccaga 2520

gagattcctg gaagttgcgc agatcacatt acgggagttt ttcaatgcca ttatcgcagg 2580

caaagatgtt gatccttcct ggaagaaggc catatacaag gtcatctgca agctggatag 2640

tgaagtccct gagattttca aatccccaaa ctgcctacaa gagctgcttc atgagtagaa 2700

atttcaacaa ctctttcgga atgtacgagt agtcgcagtc ccctttggat gtccaagtta 2760

cacgtgtcta gattttgagt tcatgtatat gtgtatggga ggcatggata tgttctgaaa 2820

tcggctggta attcctcctc atcatcttcc tctcactttc ttccgttttc cattgcaagg 2880

ggatggttct tttccttccg cctttagttt acttttgccc aaggccctta acatgtggag 2940

acgtaaaata gggttaagtt tcagggaaaa aaaggatgtt ggcgtgtgta acgtcggtgt 3000

tcgcaaggga gggcatttgt taaagatgct tttgcttgat tgatggttta ttgcaactgg 3060

cggttggttg gcggagggag acccgtgaca cagcaagcag ctctgtcttc agtgatgtgt 3120

cttttatttt cacggctaag gagataggaa aatgcaatga aaccacgtga taaactgaaa 3180

tgtttggttt gaactcagta agtagctttt tatcgtatgt ttaaaaataa tgccagtggc 3240

agatgaatag ttcacttttc aaaagtagcc caaaaggcca gatttgaaaa agaaacatca 3300

tcactaactg tcaaaaagcc tttcctaaga gaaatggcca acaccccaaa ctaggattgg 3360

tatcttatgg aggcaaagca attcggtaca aaactgactc tttcaagatg agactagaac 3420

ctcgcgtgat ttctagtcgc ctctcgaaat tctgcaacag gctcttcttg ctaataagtg 3480

agtggatatc attcttcata gagaaaaacc cctataacgt gttattttct atttatcttg 3540

cttcagatat gaaaaggcac ataagtttca aatttattct ttgctccact ctgtttatat 3600

gctttaaaag agcaattatt tgttgaatat ttaacacttt ttttttttgg ccaaaaaaaa 3660

aaaaaaaaaa aaaaaaaaaa aaa 3683

<210> 5

<211> 1957

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tgatacattt cgcagaaccc aaatttctcc cctcagtaca cccgcttacc tcgaaaagga 60

cccaaccaat agagacatta ttccattctg tatctaatgg gcacgttgct agattatttc 120

tgtccccagc ctaaattgtc acatcccgat tagaacactt gatacaatag tcgattattg 180

gaagtatggg tggtgtgttt gccagcgtct ctgtggtttc cctaatgggg tggagggagt 240

gtttggaggc ggtgaaaggg gagaaacgaa ggctgggggt gttcaagcga gtcttttttt 300

cttatccgca acacctaacc aggccggcct gactttgttt tttctttttc tcaatggttg 360

aatcccgtgc caaaagttcc ctacggggta aggactcgaa ctaatgtatt agcatcactg 420

ttcttattca aaattagact tcttcacagt ttgatgaatt tgggactgaa attgtaaatg 480

tcctagaaaa agtgtgtgtg tgtgtgtgtg ttgcagaaga tggtggtcgt ggtcggtcag 540

tgtacttgta acacacttca taaacatcct gtcgtcacag gcgcaacatg attcaacctt 600

tgatctaatt aaattcgagg gacacacgaa acacacttgt ctccatccta ccaaaaaaag 660

gagtgtctaa ttgactaggt atgaatgttt ctgcttcgca gcccttgcaa gtcctagctt 720

ttataggatc tttaggtcat aaacgcggtg gctttattaa aagccgttta ctgttcccgg 780

ggaaagagac attctcgctg ccgctggaag cttgcgcttt agcgatagca acttgcaaat 840

cccaagaagt tctttaagag ccaccttatc tgaagaaatc gtgcgggctc tttttcgtcc 900

aagaaatgtc aaaccaaagt gagttttcta tggcttgact tagaagcccg aaatttaagc 960

gtttgaaatt tcttacccag gaaactttaa agtttgctac ctaggcgtca aaactgtgta 1020

aatcctcgat gaaacccctc tctttgatca ttctggggtg agtgagttac tgagcggtaa 1080

tcgtgtggta atgtttgcaa catttttttt ttccataaag gctgctgtac ctacaatcca 1140

aacaacgctg tcagaggtaa ccaaggacaa atcttcttct gcctaacagt tttgaccgga 1200

gattgactag gattcagcca aaactggtct tctaatatca gatgcaataa agccggcgtg 1260

aaacctctag cacctattgt tttcatccca aacctacctg tattttattg tccacctccc 1320

ctttcaaagg aagggaggat gacacgtatt cttgatacta gctatgatcg tttaaaaagt 1380

ggaaggattt gaggagcccc actcccttct ctgatgccat ccccacccct caaaccccca 1440

cttattctcc agtaacactt ttccgtgcct tcctgcaccc ctgtccgagg agcgctcact 1500

cgctcggcgg ctcggccaac ttgatcagcg gtatctggga aatgaaggga aaagaaaaaa 1560

aaaaaaaaag gacctgcgtc ctggaagagc gatcgtgagc cgagcggcgc tggcgcggtc 1620

gcccgcccgc tttgcacagt gcccgcagat ggctcgctcc ggccccggcg cggcgatccc 1680

ggcgccccga agcagcggct gggcgagggt gagggtgggg gccgggcatg gaggcggggg 1740

aggggagcgc ggggcccctc tcccctcctc tcctcccagc ccctcacccc cacccctttt 1800

atatattttt tttttcctcc caagttctct tgcctcgcta tccccccttg aatccgaagg 1860

cgcctcgcga ttgggtgctg gggccgggta cgtcagtcag actgtgacgt gcagtcttcc 1920

tgtttccttc agctgtgtct taaagtaaat cttgttg 1957

Claims (1)

1. The application of the reagent for SNP detection in the genetic improvement of the pork quality traits is characterized in that the SNP is at least one of (1) - (3):

(1) (ii) a sequence located in the sequence listing SEQ ID NO:5 has 1C/A mutation at 1027bp position, resulting inTaqI-RFLP polymorphism;

(2) is located in the sequence table SEQ ID NO:5 has 1A/G mutation at 536bp position, resulting inBseNI-RFLP polymorphism;

(3) is located in the sequence table SEQ ID NO:5 has 1C/G mutation at 384bp position, resulting inHpaII-RFLP polymorphisms.

Images