CN110684787A

CN110684787A - Penaeus monodon glycogen synthase kinase GSK3 beta gene and application thereof

Info

Publication number: CN110684787A
Application number: CN201910862867.0A
Authority: CN
Inventors: 周发林; 李运东; 江世贵; 丁阳阳; 杨其彬; 姜松; 杨丽诗; 黄建华
Original assignee: Nanhai Institute Of Fisheries Chinese Academy Of Fisheries Sciences
Current assignee: Nanhai Institute Of Fisheries Chinese Academy Of Fisheries Sciences
Priority date: 2019-09-12
Filing date: 2019-09-12
Publication date: 2020-01-14
Anticipated expiration: 2039-09-12
Also published as: CN110684787B

Abstract

The invention discloses a penaeus monodon glycogen synthase kinase GSK3 beta gene, the base sequence of which is shown as SEQ ID NO: 1 is shown. The invention also discloses a coding protein of the glycogen synthase kinase GSK3 beta gene of the penaeus monodon, and the amino acid sequence of the coding protein is shown as SEQ ID NO: 2, respectively. The invention further discloses application of the gene or the coding protein in improving ammonia nitrogen tolerance of the penaeus monodon. And an SNP locus related to ammonia nitrogen resistance of the penaeus monodon, wherein the SNP locus is SEQ ID NO: 1, wherein the base is mutated from C to G at position 940 of the base sequence shown in 1. The 940 site of the glycogen synthase kinase GSK3 beta gene of the penaeus monodon screened and identified by the invention is an SNP site related to ammonia nitrogen resistance of the penaeus monodon, and provides an important reference marker for molecular breeding of new ammonia nitrogen resistant varieties of the penaeus monodon.

Description

Penaeus monodon glycogen synthase kinase GSK3 beta gene and application thereof

Technical Field

The invention belongs to the technical field of molecular biology, and particularly relates to a penaeus monodon glycogen synthase kinase GSK3 beta gene and application thereof.

Background

Glycogen synthase kinase GSK3(Glycogen synthase kinase-3) is a multifunctional serine/threonine protein kinase with two highly conserved subtypes, GSK3 α and GSK3 β. At the end of the 70's of the 20 th century, GSK was discovered and characterized, and its function was initially thought to be to phosphorylate liver glycogen synthase to regulate the activity of this enzyme in catalyzing glycolysis. GSK3 has the characteristic of an unconventional, constitutively active kinase, in that the substrate usually needs to be pre-phosphorylated by another kinase, and GSK3 is inhibited rather than activated in response to stimulation on two known major pathways affecting it (the insulin and Wnt pathways), a major feature of GSK3 that distinguishes it from other kinases [71 ]. Subsequent studies have shown that GSK3 β is a key regulator in many signaling pathways, including insulin, Wnt/β -catenin, NF- κ B, Hedgehog, Notch, and PI3K/AKT, and plays an important role in regulating cell proliferation, differentiation, metabolism, apoptosis, and immune responses.

In 1992, studies by Hanger et al showed that GSK3 can cause abnormal phosphorylation of microtubule-binding protein tau, which has been thought to be the leading cause of neurofibrillary tangles in Alzheimer's disease, and thus GSK3 was the subject of research on therapeutic targets for Alzheimer's disease. Glycogen synthase kinase 3 β (GSK3 β) has subsequently been a strongly studied anti-alzheimer drug target in the CNS. GSK3 β inhibitors are used as potential therapeutic agents for alzheimer's disease, and TDZD-8 inhibitor shows protective effects when treating OKA acid exposed zebrafish. GSK3 β is abundant in the brain and has a key role in neural development. GSK3 β regulates different processes in neuronal polarity, axon growth, migration, apoptosis, neurotransmission, synaptic development and plasticity. In addition, GSK3 β has a key role in neural stem cell self-renewal and differentiation, and is involved in neurogenesis in adults.

In innate immunity, GSK3 β can modulate clonal expansion and specificity of immune cells by directly modulating the survival and differentiation of immune cells or indirectly affecting cytokine secretion profiles. Previous studies have shown that antigen-specific stimulation of CD8+ T cells can inactivate GSK3 β, leading to an enhancement of cytotoxic effects. And GSK3 β may regulate the differentiation of CD4+ T cells into Th17 cells. Recently, GSK3 β has also been established as a key regulator of the innate immune system. In host antiviral response, GSK3 β not only promotes the production of various cytokines (IFN-. gamma., IL-1. beta., TNF, IL-12, etc.) by activating transcription factors such as STAT3, NF-. kappa.B, AP-1, etc., but also restricts viral proliferation by binding to various viral proteins such as NS5A, LANA and HBX. In addition, studies have shown that GSK3 β is also closely associated with viral infection. For example, coxsackie virus B3(CVB3) may reduce the expression of β -catenin by activating the GSK3 β -dependent mechanism, thereby promoting apoptosis and release of viral particles. Thus, GSK3 β may play multiple functions in host viral interactions and may play an important role in environmental factor stress responses. However, in crustaceans, the report of the study on the GSK3 β gene is still lacking.

Disclosure of Invention

The invention aims to provide a penaeus monodon glycogen synthase kinase GSK3 beta gene and a coding protein thereof.

The invention also aims to provide application of the gene or the encoded protein in improving ammonia nitrogen tolerance of the penaeus monodon.

The last purpose of the invention is to provide an SNP locus related to ammonia nitrogen resistance of the penaeus monodon.

The first object of the present invention is achieved by the following technical solutions: a glycogen synthase kinase GSK3 beta gene of penaeus monodon, the base sequence of the gene is shown as SEQ ID NO: 1 is shown.

The amino acid sequence of the encoded protein of the penaeus monodon glycogen synthase kinase GSK3 beta gene is shown as SEQ ID NO: 2, respectively.

The second object of the present invention is achieved by the following technical solutions: the gene or the coding protein is applied to improving the ammonia nitrogen tolerance of the penaeus monodon.

The glycogen synthase kinase GSK3 beta gene of the penaeus monodon participates in immune response under ammonia nitrogen stress and microbial stimulation, and the verification of an ammonia nitrogen stress RNAi system shows that the silencing of GSK3 beta activates an apoptosis pathway, and the spreading of ammonia nitrogen toxicity is inhibited by the ammonia nitrogen stress damaged cell apoptosis, so that the ammonia nitrogen tolerance of the penaeus monodon is improved.

The last object of the present invention is achieved by the following technical solutions: an SNP locus related to ammonia nitrogen resistance of penaeus monodon, wherein the SNP locus is SEQ ID NO: 1, wherein the base is mutated from C to G at position 940 of the base sequence shown in 1.

The invention has the following advantages:

(1) the invention clones the prawn GSK3 beta gene of penaeus monodon for the first time by RACE technology, researches the expression level of the prawn GSK3 beta gene in each tissue, the expression mode of the prawn GSK3 beta gene in hepatopancreas and branchial tissues under acute ammonia nitrogen stress and the expression change analysis of the prawn GSK3 beta gene under different microbial stimulations, discusses the expression analysis of the prawn GSK3 beta gene under different microbial stimulations, and aims to research the regulation and control mechanism of the prawn GSK3 beta gene in the ammonia nitrogen stress response and immune reaction process and provide scientific basis for healthy culture of penaeus monodon.

(2) The 940 site of the glycogen synthase kinase GSK3 beta gene of the penaeus monodon screened and identified by the invention is an SNP site related to ammonia nitrogen resistance of the penaeus monodon, and provides an important reference marker for molecular breeding of new ammonia nitrogen resistant varieties of the penaeus monodon. The site has important theoretical value for excavating an important molecular mechanism of glycogen synthase kinase GSK3 beta in the resistance of prawns to environmental stimulation and immunoregulation, and has guiding significance for breeding practice work for improving the ammonia nitrogen tolerance of the penaeus monodon.

Drawings

FIG. 1 is a multiple sequence alignment of amino acids PmGSK3 β and GSK3 β of other species in example 1;

FIG. 2 is the NJ evolutionary tree of the PmGSK3 β gene of example 1;

FIG. 3 is the expression of PmGSK3 β in each tissue in example 1;

FIG. 4 is the relative expression of PmGSK3 β in Hepatopancreas (Hepatopancreas, a), Gill (Gill, b) after acute ammonia nitrogen stress in example 1;

FIG. 5 is the relative expression levels of PmGSK3 β in Hepatopancreas (Hepatopancreas, a), Gill (Gill, b) after stimulation by different microorganisms of example 1;

FIG. 6 is the expression of PmGSK3 β in the hepatopancreas after RNA interference in example 1;

FIG. 7 is a graph of the death curve of Penaeus monodon after double-stranded RNA injection in example 1;

FIG. 8 is a 1% gel electrophoresis of the amplified fragment of the GSK3 beta gene of Penaeus monodon of example 1;

FIG. 9 is a schematic diagram of SNP sites of PmGSK3 beta gene of Penaeus monodon in example 1;

FIG. 10 is a schematic diagram of the alignment analysis of SNP sites in the Sequencher software in example 1.

Detailed Description

The method of the present invention is further illustrated by the following examples. The following examples and drawings are illustrative only and are not to be construed as limiting the invention. Unless otherwise specified, the reagent raw materials used in the following examples are raw reagent raw materials which are conventionally commercially available or commercially available, and the laboratory instruments used are laboratory conventional instruments, and unless otherwise specified, the methods and apparatuses used in the following examples are those conventionally used in the art.

Example 1

1. Materials and methods

1.1 Experimental materials

The penaeus monodon used in the experiment is from Shenzhen base of the research institute of aquatic products in south China sea. The experimental shrimps are temporarily cultured in a circulating water pool for 3 days, the salinity is 30, and the water temperature is 25 +/-1 ℃. Selecting healthy three prawns of female and male, dissecting, and taking tissues of liver pancreas, branchia, intestine, muscle, stomach, lymph, ophthalmus, cranial nerve, thoracic nerve, ovary and the like as the cDNA templates of the tissues respectively. Selecting juvenile shrimps with the body length of 7-8 cm and the body mass of 6-7 g for acute ammonia nitrogen stress experiments. Selecting juvenile shrimps with the body length of 6-7 cm and the body mass of 5-6 g for bacterial infection experiments. The acute ammonia nitrogen stress experiment and the microbial stimulation experiment of the penaeus monodon are carried out in Shenzhen experimental base of the research institute of aquatic products in south China sea. RNAlater was purchased from Life, ammonium chloride (analytical grade) from Probo Bio Inc.; RNA extraction kits were purchased from magenta; reverse transcription Kit (PrimeScript II 1stStrand cDNA Synthesis Kit) and fluorescence quantification Kit (TB Green) were purchased from TAKARA.

The experimental equipment used in this study is recommended but not limited to the following table 1:

TABLE 1 recommended laboratory instruments and production companies used in this example

1.2 extraction of Total RNA and cDNA Synthesis

Total RNA of different tissues of the penaeus monodon is extracted according to the magenta instruction, the concentration and the purity of the RNA are detected by a NanoDrop2000 ultramicro spectrophotometer, and the integrity of an RNA band is detected by 1.2% agarose gel electrophoresis. Samples for RACE template first Strand cDNA was synthesized according to the PrimeScript II 1st Strand cDNA Synthesis Kit (TaKaRa). As a sample for fluorescent quantitative PCR, 1. mu.g of total RNA was collected from each tissue, and reverse transcription was performed according to the PrimeScript RTreagen Kit With gDNA Eraser Kit. The cDNA was detected with EF-1. alpha. primer (Table 2) and stored at-80 ℃ for further use.

1.3 cDNA clone of Penaeus monodon GSK3 beta gene

Primers and RACE primers (table 2) to verify the ORF of the PmGSK3 β gene were designed using primer5.0 software based on published partial sequences in the penaeus monodon transcriptome database (NCBI) to give the full length of the PmGSK3 β gene.

TABLE 2 primers and sequences used in the experiments

^aThe sequence of the T7 promoter is underlined.

1.4 Penaeus monodon GSK3 beta gene sequence analysis

The Pellino of Penaeus monodon is subjected to homology alignment with Pellino proteins of other species by using a BLAST tool of NCBI (https:// www.ncbi.nlm.nih.gov /), and a signal peptide of a Pellino family gene is predicted by using SignalP 4.1yi (http:// www.cbs.dtu.dk/services/SignalP); protein domains were analyzed by CD Search (https:// www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb. cgi); predicting the molecular weight and isoelectric point of the protein with a computer PI/Mw tool (http:// web. expay. org/computer _ PI); performing multiple sequence alignment by using Clustal X1.83, and mapping by using Texmarker; the phylogenetic tree was constructed using the Neighbor-Joining method (Neighbor-Joining, NJ) of MEGA 6.0.

1.5 expression of Penaeus monodon GSK3 beta gene in different tissues

The method comprises the steps of selecting healthy female and male penaeus monodon 3 tails, carrying out anatomical sampling, extracting total RNA of different tissues, designing fluorescent quantitative specific primers (table 2) by taking reverse transcription products of the total RNA as templates and taking the full length of a gene PmGSK3 beta as a basis, carrying out fluorescent quantitative PCR detection by taking EF-1 alpha as an internal reference gene and double distilled water as a negative control according to a TB GREEN specification, wherein the reaction system is 12.5 mu L and comprises dd H2O 4.25.25 mu L, GREEN Mix 6.25 mu L and upstream and downstream quantitative primers which are respectively 0.5 mu L, cDNA template 1.0 mu L (about 40 ng/mu L). The sample and internal controls were each set up in 3 replicates. The relative expression level of the PmGSK3 beta gene in each tissue of the Penaeus monodon was analyzed by the relative Δ CT method (2- Δ Δ CT method).

1.696h acute ammonia nitrogen stress experiment

And (3) obtaining the semilethal concentration LC50 and the safe concentration SC of the penaeus monodon under the acute ammonia nitrogen stress for 96 hours through a preliminary experiment. In the pre-test, 7 ammonia nitrogen concentration gradients are set, which are respectively 0, 20, 40, 60,80, 100 and 120 mg.L < -1 >. 30 shrimps with uniform mixed family size were randomly placed in 7 black buckets for each gradient. 200L of filtered seawater and two air heads are added into each black barrel. And (3) not feeding the feed during the pre-test period, recording the death situation at fixed time intervals until the test is finished within 96 hours, fishing out the dead shrimps, and replacing all seawater every day. The semilethal and safety concentrations were calculated by linear interpolation after the experiment was completed.

The official experiment was divided into 2 groups, low concentration stress group and high concentration stress group, and the 0 th hour sample was used as a control group, and filtered culture seawater was used. The stress concentration of the low concentration stress group is a safe concentration; the stress concentration of the high concentration stress group was 96-hour semilethal. Each group was set with 3 replicates of 30 shrimp each. The black barrel and penaeus monodon selection method used in the experiment is the same as that used in the preliminary experiment. Experiments were carried out by adding ammonium chloride (NH)₄Cl) to control the ammonia nitrogen concentration of each experimental group, recording the death condition every 2 hours, fishing out dead shrimps, and replacing all seawater every 24 hours. Sampling was performed at 0, 3, 6, 12, 24, 48, 72 and 96 hours post-stress. During sampling, 3 individuals with good activity are selected from each group, tissues such as liver, gill, intestine and the like are stored in RNAlater (Ambion), and samples are stored at the temperature of minus 80 ℃.

1.7 different microbial stimulation experiments

In order to research the activation effect of different microbial stimulations on the glycogen synthase gene of the penaeus monodon, healthy penaeus monodon is selected for microbial stimulation in an experiment. According to the laboratory about the 96h half-lethal concentrations of staphylococcus aureus, vibrio harveyi and vibrio anguillarum to the penaeus monodon, the concentrations are respectively as follows: 1.5X 10⁹CFU/mL、2.0×10⁸CFU/mL and 3.5X 10⁸CFU/mL. The experiment averagely divides 200 penaeus monodon into 4 groups: 1) staphylococcus aureus (gram positive bacteria) was injected; 2) injection of Vibrio harveyi (gram-negative bacteria); 3) injection of eel vibrio (leather)Gram-negative bacteria); 4) PBS was injected as a control group. The experimental groups were injected with 100. mu.L of each of the diluted solutions at 1X 10 concentrations⁸CFU/ml of the bacterial suspension, control group injected with 100 u L PBS. After stimulation, tissues of hepatopancreas, branchia and the like of prawns are taken at 0 th, 3 rd, 6 th, 9 th, 12 th, 24 th, 48 th and 72 th hours respectively, RNAlater samples are placed at the temperature of minus 80 ℃ for storage, and cDNA templates are synthesized after total RNA is extracted for qPCR experiments. EF-1 alpha is used as an internal reference gene.

1.8RNA interference

Primers for double-stranded RNA synthesis (see Table 2) were designed using Primer Primier 5 PmGSK 3. beta. and 5' ends of the forward and reverse primers were added with T7 promoter sequence TAATACGACTCACTATAGGGAGA, respectively, and the Primer sequences were sent to Beijing Rui Boxing Biotech Ltd for synthesis. And (3) obtaining a DNA fragment containing a T7 promoter sequence at two ends by amplification of a mixed cDNA template, purifying and recovering the product by using a magenta gel recovery kit, and storing the product with the concentration of more than 200 ng/mu L and the quality meeting the experimental requirements at-20 ℃ for later use. According to T7 RiboMAX^TMThe Express RNAi System specification carries out the synthesis of dsRNA, and agarose gel electrophoresis and NanoDrop2000 are used for detecting whether the quality of the dsRNA meets the experimental requirements. Using the pD7-GFP recombinant vector stored in this experiment, forward and reverse primers for the GFP gene were designed, and double-stranded RNA of GFP was prepared in the same manner as for the preparation of GSK double-stranded RNA.

Before injection experiment, the dsGSK3 beta and dsGFP are uniformly diluted to 1 mu g/mu L by using PBS solution, and the penaeus monodon is subjected to intramuscular injection according to 3 mu g/g. The experimental prawns used were 7 + -0.5 g in weight. The experimental groups used were three groups: 1) injecting a PBS group; 2) injection of dsGFP group; 3) the dsGSK3 β group was injected. Each group is provided with 3 parallels, and 70 healthy penaeus monodon are selected for injection respectively. Hepatopancreas and gill tissue samples were taken at 0 hours before and 24 hours after dsRNA injection and stored in RNALater, respectively. Acute ammonia nitrogen stress is carried out 24 hours after injection, the concentration of ammonia nitrogen is controlled by simultaneously adding ammonium chloride to three groups in the experiment, the concentration of the ammonia nitrogen used in the experiment is 50mg/L, after the ammonia nitrogen stress, the death number is counted every 3 hours, dead shrimps are fished out, and the experiment is finished 72 hours after the ammonia nitrogen stress. During the ammonia nitrogen stress period, liver pancreas and branchia tissue samples are taken and stored in RANLater at 0 hour, 6 hour, 12 hour, 24 hour and 48 hour respectively. RNAlater samples taken from the experiment were stored at-80 ℃.

1.9 statistical analysis

One-Way analysis of variance (One-Way ANOVA) was performed on the quantitative results using SPSS 23.0, and the results were expressed as "mean ± standard deviation (X ± SD)". When the difference significance (Turkey) is analyzed, the difference is significant when P <0.05 is analyzed, and the difference is extremely significant when P <0.01 is analyzed. If there is a difference between groups, a Turkey method is used for multiple comparison analysis.

2. Results

2.1 cDNA sequence characteristics of PmGSK3 beta

The cDNA full length of PmGSK3 beta (Penaeus monodon, Pm for short) gene is obtained by cloning through RACE technology. The cDNA total length of the PmGSK3 beta gene is 2380bp, including open reading frame ORF 1233bp, 5 'end non-coding area (UTR)289bp, 3' end non-coding area (UTR)858 bp. The ORF of the PmGSK3 beta gene is presumed to contain 410 amino acids, has a molecular weight of 46.0997KDa and a theoretical isoelectric point of 8.88. PmGSK3 beta contains no signal peptide, has Serine/Threonine Kinase catalytic domain (The catalytic domain of The Serine/Threonine Kinase) STKc (49-341 aa) of protein Kinase superfamily (PKc _ lipid), and includes ATP binding site, Axin binding site, polypeptide substrate binding site, dimer interface, active site, activation cycle (A cycle) and so on.

PmGSK3 beta cDNA sequence and its amino acid sequence

2.2 homology and phylogenetic Tree analysis

On NCBI, carrying out BLASTX comparison on the amino acid sequence of the Penaeus monodon GSK3 beta gene with other species, and carrying out multiple comparison analysis on the amino acid sequence by using Clustal X2.1 software (figure 1), wherein the result shows that the Penaeus monodon GSK3 beta has high homology with the amino acids of other species, wherein the similarity of the PmGSK3 beta and Litopenaeus vannamei (Penaeus vannamei, XP _027228608.1) is up to 100%; protein similarity to Procambarus clarkii (Procambarus clarkii, ASW35107.1) and Euphausia superba (Eucheuma superba, AUI80372.1) was 98.29% and 93.98%, respectively; similarity to Florida bow ants (Camplotus floridanus, XP-011268375.1), Phanerochaete Falcati (Monomorium pharaonis, XP-012525061.1) and Neuga domestica termite (Zooterus nevadensis, XP-021916214.1) was 84.14%, 84.10% and 83.54%, respectively; the similarity with the multi-embryo jumping wasp (copiosomafloridanum, XP _023246295.1), the potato beetle (leptinotara decemlineata, XP _023025239.1) and the sambucus emasculata (Athalia rosa rosae, XP _012256017.1) was 84.51%, 82.24% and 79.90%, respectively.

The result of constructing an NJ evolutionary tree (figure 2) of PmGSK3 beta and the protein of other species by MEGA6.0 shows that glycogen synthase kinase 3 beta of vertebrates and invertebrates is obviously distinguished and has a long evolutionary distance. Among invertebrates, the crustacean penaeus monodon, litopenaeus vannamei and Macrobrachium nipponensis (ALK 82316.1) gather as one branch, which is closer in evolutionary relationship, and procambarus clarkii and procambarus canadensis (homausserinus, AXF35711.1) gather as one branch, which together with other crustacean eriocheir sinensis (ANZ 22981.1), euphausia antarctica, Daphnia magna (EFX 72595.1) gather as one big branch; insecta animals gather as another large branch, including potato beetles, yellow wing wasps, Nevada archaebacteria, greenhouse Laterophilus tepidorum (Parasitoda tepidarium, XP-015912550.1), and Securidacae (Cryptotermes secidus, XP-023705265.1).

2.3 expression analysis of PmGSK3 beta in different tissues

The expression of PmGSK3 beta in each tissue was detected by qPCR using EF-1 alpha as internal reference. As can be seen from the results, the expression of PmGSK3 β in different tissues showed some differences (fig. 3).

PmGSK3 beta is expressed in different tissues, has higher expression level in lymph, heart and epidermis, has medium expression level in muscle, cranial nerve, intestine, gill and liver pancreas, and has lower expression level in spermary, spermatopod, abdominal nerve and eye handle nerve, wherein the expression level in lymph is 29 times of the expression level in spermary (P < 0.05).

2.4 expression change of PmGSK3 beta under acute stress of ammonia nitrogen with different concentrations

The expression change trend of PmGSK3 beta under the condition of different concentrations of ammonia nitrogen stress is shown in figure 4 through RT-qPCR detection.

The results in the a) graph in fig. 4 show that, in the hepatopancreas, the expression amount of PmGSK3 β was significantly increased (P <0.01) in both the low concentration group and the high concentration group compared to the 0h control group, and a periodic modulation pattern was exhibited in both groups. In the high concentration group, PmGSK3 β peaked at 12 hours and 72 hours, respectively, and the expression level at 96 hours was significantly higher than that of the 0h control group (P <0.01), and in the low concentration group, peaked at3 hours and 72 hours, respectively. In the process of 96h acute ammonia nitrogen stress, the expression level of PmGSK3 beta is higher than that of a 0h control group.

The results in the graph b) in fig. 4 show that ammonia nitrogen in gill tissue at high concentration shows a tendency of inhibiting the expression of PmGSK3 beta, while the expression level of PmGSK3 beta shows a tendency of being inhibited at 0-24h after ammonia nitrogen stress of the low concentration group, the expression level is gradually up-regulated at the later stage of the stress, and the level is significantly higher than that of a control group (P <0.05) at 48 hours and 72 hours after the stress, and has no significant difference with the control group at 96 hours.

Therefore, the gene function of the PmGSK3 beta is related to ammonia nitrogen stress and is a response gene.

2.5 expression Change of PmGSK3 beta Gene under microbial stimulation

The phosphate buffer PBS group is used as a control group, EF-1 alpha is used as an internal reference, the expression change of the Penaeus monodon GSK3 beta gene after the stimulation of three different microorganisms is detected by using a fluorescence quantitative technology, and the change trend results of the PmGSK3 beta gene are shown as a) diagram in figure 5 and b) diagram in figure 5. After the stimulation of the vibrio harveyi, the expression level of PmGSK3 beta in the hepatopancreatic tissues at 9 hours and 72 hours is obviously lower than that of a control group (P <0.05), and the other time points are not obviously different from the control group; in gill tissue, the expression level is higher than that of the control group at3 hours and 9 hours after stimulation, and the expression level is very different from that of the control group (P < 0.01).

After the vibrio anguillarum stimulation, the expression level of the PmGSK3 beta at the 12 th hour in the liver and pancreas tissues is obviously lower than that of the control group PBS, and the expression levels at other time points are not obviously different from that of the control group. In gill tissue, the expression level of PmGSK3 β was significantly higher at3 hours than that of the control group (P <0.01), and there was no significant difference from the control group at other time points.

After staphylococcus aureus stimulation, the expression levels of the PmGSK3 beta at the 3 rd hour, the 12 th hour, the 24 th hour and the 48 th hour in the hepatopancreatic tissue are all higher than those of the control group and are very different from the control group (P <0.01), and the expression level of the PmGSK3 beta at the 3 rd hour reaches the highest peak value which is 3.13 times that of the PBS control group. In gill tissues, the expression level of PmGSK3 beta at3 hours, 6 hours, 9 hours, 12 hours, 24 hours and 72 hours is higher than that of a control group, and is very different from that of a PBS control group (P <0.01), and the peak value is reached at 6 hours and is 31.34 times of that of the control group.

Therefore, the gene PmGSK3 beta obtained by cloning in the application is very important and is not only related to ammonia nitrogen but also related to immunity.

2.6RNA interference results

In order to explore the role of PmGSK3 β in the ammonia nitrogen stress process, the present application performed RNA interference experiments by injecting dsGSK3 β (synthesis of double stranded dsGSK3 β RNA was performed according to T7 RiboMAXTMExpress RNAi System kit instructions) and acute ammonia nitrogen stress 24 hours after PmGSK3 β silencing, and the relative expression amount of PmGSK3 β during the experiment varied as shown in fig. 6. The results show that the expression level of PmGSK3 beta at 24 hours after the interference is obviously lower than that of a control group (P <0.01) by taking phosphate buffer solution and dsGFP (the dsGFP synthesis is carried out by adopting a universal primer dsGFP-F/R and a pD7-GFP recombinant vector, and the method is the same as that of dsGSK3 beta) as a control, and the interference efficiency is better. In subsequent acute ammonia nitrogen stress experiments, the expression level of PmGSK3 beta at 30 hours, 36 hours, 48 hours and 72 hours is obviously lower than that of a control group (P <0.01) observed by using PBS as the control group. Taking the dsGFP group as a control group, except that the expression level of the PmGSK3 beta at 48 h is remarkably different from that of the control group (P <0.05), the expression level of the PmGSK3 beta at other time periods is remarkably different from that of the control group (P <0.01), and the expression level is lower than that of the control group.

3. Discussion of the related Art

3.1 Penaeus monodon glycogen synthase kinase cDNA cloning and sequence analysis

The glycogen synthase gene (PmGSK3 beta) of penaeus monodon is cloned for the first time, and the BLAST result shows that the protein is quite conservative, has a serine (Ser)/threonine (Thr) kinase catalytic domain of a typical protein kinase superfamily and is positioned at 49-341 aa.

Multiple sequence comparison analysis results show that the Penaeus monodon GSK3 beta gene has higher homology, and the protein similarity of Litopenaeus vannamei is 100%. The result shows that the gene is the prawn GSK3 beta gene and the sequence is highly conserved.

3.2 expression analysis of Penaeus monodon glycogen synthase Gene under different stresses

In order to reveal the possible function of the penaeus monodon glycogen synthase gene GSK3 beta in ammonia nitrogen stress response, the application analyzes the expression change trend of PmGSK3 beta after acute ammonia nitrogen stress at different concentrations. The result shows that in the hepatopancreas (a in figure 4), the expression level of the PmGSK3 beta is obviously increased in the ammonia nitrogen stress group with different concentrations (P <0.01) compared with the 0h control group, and the result shows a periodic regulation mode in the two groups, which is similar to the expression mode of the key gene GS on the ammonia nitrogen metabolic pathway of the penaeus monodon gene, and the ammonia nitrogen stress can be presumed to obviously activate the expression of the PmGSK3 beta. In gill tissues (b in fig. 4), the expression of PmGSK3 beta is remarkably inhibited by high-concentration ammonia nitrogen, after ammonia nitrogen stress of a low-concentration group, the expression level of PmGSK3 beta is remarkably inhibited within 0-24h, the expression level is gradually increased at the later stage of stress, and the expression levels at 48 h and 72 h are remarkably higher than those of a control group. The rule that the expression of PmGSK3 beta is inhibited is presumed to be caused by damage of high-concentration ammonia nitrogen to gill tissues, while low-concentration ammonia nitrogen has a certain inhibiting effect but the tissue damage is not serious, and the later-stage up-regulation of PmGSK3 beta is a response to the stress of the low-concentration ammonia nitrogen.

The cell signal transduction pathway plays an important role in the regulation and control of prawn immune response, and comprises the pathways of Wnt/beta-catenin, JAK-STAT, PI3K/Akt, NF-kB and the like. PmGSK3 β is a highly conserved multifunctional serine/threonine kinase that is widely involved in cellular functions, and plays an important role in regulating the innate immune response in particular. Most of the studies on GSK3 β mediated innate immunity have focused mainly on vertebrates, while studies on the immunomodulatory function of GSK3 β in invertebrates have been limited. In order to explore the role of the PmGSK3 beta in the innate immunity of invertebrates, the invention performs intramuscular injection on the penaeus monodon by using two gram-negative bacteria and one gram-positive bacteria, and analyzes the expression trend of the PmGSK3 beta under the stimulation of different microorganisms. The result shows that under the stimulation of staphylococcus aureus, the expression level of the PmGSK3 beta in the hepatopancreatic tissue and the gill tissue is obviously higher than that of the PBS control group, and the gram-positive bacteria can be supposed to obviously activate the expression of the PmGSK3 beta. Under the stimulation of Vibrio harveyi and Vibrio anguillarum, two gram-negative bacteria have similar expression patterns. In the hepatopancreas, the expression level of PmGSK3 beta at 9 hours and 72 hours after the Vibrio harveyi is stimulated is obviously lower than that of a control group, and the expression level of PmGSK3 beta at 12 hours in hepatopancreas tissues after the Vibrio anguillarum is stimulated is obviously lower than that of PBS of the control group, which indicates that gram-negative bacteria have certain inhibition capacity on the expression of PmGSK3 beta in the hepatopancreas. In similar results in studies of influenza infection, down-regulated expression of GSK3 β may also positively modulate virus-induced host apoptosis inhibiting influenza virus replication. In gill tissues, the expression levels of PmGSK3 beta at3 hours and 9 hours after the Vibrio harveyi is stimulated are obviously higher than those of a control group, and the expression level of PmGSK3 beta at3 hours after the Vibrio anguillarum is stimulated is obviously higher than that of the control group, which indicates that gram-negative bacteria have certain activation capacity on the expression of PmGSK3 beta in gill tissues.

In order to further explore the functions of the PmGSK3 beta in ammonia nitrogen stress response, the application silences the expression of the PmGSK3 beta gene by an RNA interference technology, and researches the expression change trend of the PmGSK3 beta by a high-concentration acute ammonia nitrogen stress experiment after gene silencing. Experimental results show that after double-stranded RNA injection and acute stress of high-concentration ammonia nitrogen, the expression level of the PmGSK3 beta in the liver and the pancreas is obviously lower than that of a control group. In the high-concentration ammonia nitrogen stress process without the gene silencing process (figure 6), the expression level of the PmGSK3 beta in the liver and the pancreas is obviously up-regulated, which shows that the expression of the PmGSK3 beta can be obviously silenced by injecting double-stranded RNA, and the injected double-stranded RNA has better interference efficiency. Within 50 hours after PmGSK3 β silencing, the mortality rate was lower for dsGSK3 β than for both PBS and dsGFP (figure 7). Research shows that in litopenaeus vannamei, after GSK3 beta is silenced, the apoptosis pathway can be activated and WSSV infection can be obviously inhibited. It is speculated that in the process of high-concentration ammonia nitrogen stress, the silencing of the GSK3 beta gene activates an apoptosis pathway, and the spreading of ammonia nitrogen toxicity is inhibited by the damaged apoptosis under the ammonia nitrogen stress, so that the ammonia nitrogen tolerance of the penaeus monodon is improved.

4. Development of SNP site of glycogen synthase kinase gene of penaeus monodon

4.1 materials and methods

4.1.1 Experimental materials

The samples for screening SNP by the candidate gene method are penaeus monodon wild populations from different geographical positions, mainly including African wild population, Thailand wild population and China trilobate population. The method comprises the steps of collecting samples of African wild populations in the area near Mosangbike in the south Africa, collecting samples of Thai wild populations in the area of Taguchi island in Thailand, and collecting samples of trileaf populations in the area of trileaf in China.

The invention uses extreme groups with different tolerance to ammonia nitrogen as experimental materials to carry out SNP typing. The ammonia nitrogen extreme group is carried out through an ammonia nitrogen stress experiment, and the ammonia nitrogen concentration used in the experiment is the semi-lethal concentration of 96h of acute ammonia nitrogen stress. The ammonia nitrogen concentration is controlled by adding ammonium chloride. The ammonia nitrogen stress experiment is carried out in workshop No. 4 of Shenzhen experimental base of the south China sea aquatic product institute. Carrying out 96-hour acute ammonia nitrogen stress experiments on a plurality of bred mixed families, judging the strength of ammonia nitrogen tolerance according to death time, selecting the first 150 persons with the strongest ammonia nitrogen tolerance as ammonia nitrogen tolerant groups, and selecting the last 150 persons with the weakest ammonia nitrogen tolerance as ammonia nitrogen sensitive groups.

In the experiment, 8-10cm of juvenile shrimps of each family which are mixedly cultured in a standard coarse pond are selected as experimental materials, and fluorescence with different colors is used for marking the tail of the shrimps so as to distinguish the families. Evenly putting 32 families of shrimps into 4 cement ponds, arranging two parallel shrimps in each 50 shrimps in each family in parallel, wherein the salinity is 30, and the water temperature is 25 +/-1 ℃. Changing seawater every 24 hours, counting the number of dead shrimps every 3 hours, fishing out the dead shrimps, and identifying the family through identifying the color of the fluorescent marker. And (3) when the experiment is finished, all the penaeus monodon of all families in the experiment die, selecting the 150-tailed shrimps which die firstly as the ammonia nitrogen sensitive population, selecting the 150-tailed shrimps which die lastly as the ammonia nitrogen tolerant population, and taking a muscle sample to store in DNA.

4.1.2 amplification of genomic sequence of Penaeus monodon glycogen synthase kinase

The cDNA total length of the penaeus monodon glycogen synthase kinase gene (PmGSK3 beta) obtained by RACE technology is 2380bp, wherein the ORF size is 1233 bp. The structure and sequence length of the existing GSK3 beta gene are inquired in NCBI according to the known sequence, the possible gene structure and sequence length of the penaeus monodon GSK3 beta gene are further presumed, a specific primer is designed according to the known sequence, and the mixed DNA of the penaeus monodon is used as a template to amplify the genome sequence of PmGSK3 beta. Specific primers used for amplification of PmGSK3 β are shown in table 3:

TABLE 3 primer sequences used in the experiment for the amplification of PmGSK3 β

4.2 results of the experiment

4.2.1 amplification of PmGSK3 beta genomic sequence, resequencing and screening of SNP sites

The genome sequence and structure of GSK3 beta of other species are searched in NCBI, and it is speculated that GSK3 beta may have 8 exons and 7 introns, so that the complete sequence of the 5 th intron is obtained by amplification at present, the fragment size is 314bp, and part of the amplified sequence is shown in FIG. 9.

8 SNP sites are obtained by screening 2694bp of amplified glycogen synthase kinase GSK3 beta gene of penaeus monodon, and the frequency of one allele of each site in the population is not less than 1%. Among them, 7 SNP sites were located on the intron, 1 SNP site was located on the exon, and the detailed site information is shown in Table 4.

TABLE 4 SNP sites on the genome of Penaeus monodon

4.2.2 correlation analysis of SNP sites of glycogen synthase kinase gene of penaeus monodon and ammonia nitrogen resistance traits

Selecting 4 SNP sites with better quality and suitable for typing from 8 SNPs obtained by screening on the amplified prawn GSK3 beta gene, and performing correlation analysis with ammonia nitrogen resistance in two extreme groups with ammonia nitrogen resistance. The results are shown in Table 5.

TABLE 5 correlation analysis of SNP sites of GSK3 beta gene of Penaeus monodon and ammonia nitrogen resistance traits

4.3 results and analysis

The method adopts a direct assay method to screen 8 SNP loci on partial glycogen synthase kinase of the penaeus monodon, and the minimum allele frequency of each SNP locus is more than 1%. In the primary screening process, 1 SNP locus PmGSK3 beta-580 on an exon is a non-synonymous mutation, and the leucine mutation coded by the mutation is phenylalanine. But the mutation frequency of the gene is lower in SNP typing detection. Non-synonymous SNP mutation is a research hotspot and is considered as a high-efficiency mutation site, and a plurality of non-synonymous SNP sites related to the growth, stress resistance, immunity and other traits of organisms are developed.

The groups used for the correlation analysis are two extreme groups with different ammonia nitrogen tolerance, and the ammonia nitrogen sensitive group 60 which dies first and the ammonia nitrogen tolerant group 60 which dies last are selected through an ammonia nitrogen acute stress experiment. Finally, a PmGSK3 beta-932 locus on the intron is selected to perform genotype phenotype association analysis, and the result shows that in a Fisher test model, the G mutation of the PmGSK3 beta-932 locus has no significance in an ammonia nitrogen resistant group and an ammonia nitrogen intolerant group (0.05< P <1), and the A mutation of the PmGSK3 beta-938 locus has no significance in an ammonia nitrogen resistant group and an ammonia nitrogen intolerant group (0.05< P <1), so that the two loci are not suitable for being used as candidate loci of an ammonia nitrogen resistant new strain. And the C mutation of the PmGSK3 beta-940 locus has a significant difference (P <0.05) between an ammonia nitrogen resistant group and an ammonia nitrogen intolerant group, so that the locus can be inferred to have a certain correlation with the ammonia nitrogen resistance of the penaeus monodon. The PmGSK3 beta gene plays an important role in innate immunity and ammonia nitrogen stress response, and the complete genome of the PmGSK3 beta gene is not obtained by amplification at present, so that the PmGSK3 beta gene still deserves further SNP screening on the complete genome.

The invention is not limited to the specific embodiments described above, which are intended to illustrate the use of the invention in detail, and functionally equivalent production methods and technical details are part of the disclosure. In fact, a person skilled in the art, on the basis of the preceding description, will be able to find different modifications according to his own needs, which modifications are intended to be within the scope of the claims appended hereto.

Sequence listing

<110> research institute for aquatic products in south China sea

<120> a penaeus monodon glycogen synthase kinase GSK3 beta gene and application thereof

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>1233

<212>DNA

<213> Glycogen synthase kinase GSK3(Glycogen synthase kinase-3)

<400>1

atgagtggac gacccaggac gacgagcttc gccgagggga acaaagggcc accttcagtt 60

tccttcccgg ggatgaaaat aagtagtaaa gatggcaaca agattaccac agttattgcc 120

acccctggcc agggctcaga tagaccgcag gaggtatcat atatggacac aaaagtcatt 180

ggaaatggca gtttcggtgt ggtgttccaa gccaagctct gtgagacagg ggagctcgtt 240

gccattaaga aggtgcttca ggacaaacgc tttaagaacc gagagctgca gattatgaga 300

agactagaac actgtaatat agtgaaactg aagtatttct tctactccag tggagacaag 360

aaggaagaag tgttcttgaa cctagtgtta gaatttattc cagagacagt atataaagta 420

gcaaggcatc acagcaaaca aaaacaaact ataccaatca gctatattaa gttgtatatg 480

taccagttgt tccgaagcct tgcctatatt cactccctgg gtgtctgtca tcgtgatata 540

aagccacaga accttctcct ggacccagaa acgggtgttc tcaaactatg tgactttggg 600

agtgccaaac atttggttcg cggagaaccc aatgtatcgt acatctgctc ccgctattac 660

agggctccag aactcatatt tggggcaact gattatacca ccaatattga cgtatggagt 720

gcaggatgcg ttttagcgga acttctcctg gggcagccta tcttcccagg tgactcgggt 780

gtggaccagt tagtagaaat catcaaagtc ctgggcacac cgacacgtga acaaatcagg 840

gaaatgaacc cgaattacac agagttcaaa tttccgcaga ttaagtctca tccgtggcag 900

aaggtgttcc gtcaacgcac cccagaagac gccataaacc ttgtgtcacg actgctggaa 960

tacacaccat ctgcgcgcat cacgccccta caggcctgcg cgcacaaatt ctttgacgaa 1020

ctcagggatc caaacaccag actacccaac aatcgggagt taccacccct cttcaatttt 1080

accgaacatg aaatcaagat ccagccagag ctgaacaaca aattgattcc ttctcactat 1140

cgaggtgagc cggcaaacag cagcagtggt ggtggctcat ctgccgttga ctcttctgag 1200

ggtgctgcag ctgctgctgt aaatgataat tga 1233

<210>2

<211>410

<212>PRT

<213> Glycogen synthase kinase GSK3(Glycogen synthase kinase-3)

<400>2

Met Ser Gly Arg Pro Arg Thr Thr Ser Phe Ala Glu Gly Asn Lys Gly

1 5 10 15

Pro Pro Ser Val Ser Phe Pro Gly Met Lys Ile Ser Ser Lys Asp Gly

20 25 30

Asn Lys Ile Thr Thr Val Ile Ala Thr Pro Gly Gln Gly Ser Asp Arg

35 40 45

Pro Gln Glu Val Ser Tyr Met Asp Thr Lys Val Ile Gly Asn Gly Ser

50 55 60

Phe Gly Val Val Phe Gln Ala Lys Leu Cys Glu Thr Gly Glu Leu Val

65 70 75 80

Ala Ile Lys Lys Val Leu Gln Asp Lys Arg Phe Lys Asn Arg Glu Leu

85 90 95

Gln Ile Met Arg Arg Leu Glu His Cys Asn Ile Val Lys Leu Lys Tyr

100 105 110

Phe Phe Tyr Ser Ser Gly Asp Lys Lys Glu Glu Val Phe Leu Asn Leu

115 120 125

Val Leu Glu Phe Ile Pro Glu Thr Val Tyr Lys Val Ala Arg His His

130 135 140

Ser Lys Gln Lys Gln Thr Ile Pro Ile Ser Tyr Ile Lys Leu Tyr Met

145 150 155 160

Tyr Gln Leu Phe Arg Ser Leu Ala Tyr Ile His Ser Leu Gly Val Cys

165 170 175

His Arg Asp Ile Lys Pro Gln Asn Leu Leu Leu Asp Pro Glu Thr Gly

180 185 190

Val Leu Lys Leu Cys Asp Phe Gly Ser Ala Lys His Leu Val Arg Gly

195 200 205

Glu Pro Asn Val Ser Tyr Ile Cys Ser Arg Tyr Tyr Arg Ala Pro Glu

210 215 220

Leu Ile Phe Gly Ala Thr Asp Tyr Thr Thr Asn Ile Asp Val Trp Ser

225 230 235 240

Ala Gly Cys Val Leu Ala Glu Leu Leu Leu Gly Gln Pro Ile Phe Pro

245 250 255

Gly Asp Ser Gly Val Asp Gln Leu Val Glu Ile Ile Lys Val Leu Gly

260 265 270

Thr Pro Thr Arg Glu Gln Ile Arg Glu Met Asn Pro Asn Tyr Thr Glu

275 280 285

Phe Lys Phe Pro Gln Ile Lys Ser His Pro Trp Gln Lys Val Phe Arg

290 295 300

Gln Arg Thr Pro Glu Asp Ala Ile Asn Leu Val Ser Arg Leu Leu Glu

305 310 315 320

Tyr Thr Pro Ser Ala Arg Ile Thr Pro Leu Gln Ala Cys Ala His Lys

325 330 335

Phe Phe Asp Glu Leu Arg Asp Pro Asn Thr Arg Leu Pro Asn Asn Arg

340 345 350

Glu Leu Pro Pro Leu Phe Asn Phe Thr Glu His Glu Ile Lys Ile Gln

355 360 365

Pro Glu Leu Asn Asn Lys Leu Ile Pro Ser His Tyr Arg Gly Glu Pro

370 375 380

Ala Asn Ser Ser Ser Gly Gly Gly Ser Ser Ala Val Asp Ser Ser Glu

385 390 395 400

Gly Ala Ala Ala Ala Ala Val Asn Asp Asn

405 410

<210>3

<211>2380

<212>DNA

<213> Glycogen synthase kinase GSK3(Glycogen synthase kinase-3)

<400>3

gggatcaata atggaacgca tctcgcaagg cctgtgaata tcgcgagtgc ggcgctcggg 60

aggaatatcg gaaatcccac tcatgcgttg ggccctcgcg gctgcctcgg agggatatga 120

ctcccctgta gtgtgtgaat taccatgaaa acctcagtga tgacggcaag ggaggtagta 180

tagcaggaaa catggacctg cctggcggag ctgggcccgt gattctctcg tgcgcgtgaa 240

atgaaacggg attttcgaca gtttcctcct tatttgaacc tttccgacga tgagtggacg 300

acccaggacg acgagcttcg ccgaggggaa caaagggcca ccttcagttt ccttcccggg 360

gatgaaaata agtagtaaag atggcaacaa gattaccaca gttattgcca cccctggcca 420

gggctcagat agaccgcagg aggtatcata tatggacaca aaagtcattg gaaatggcag 480

tttcggtgtg gtgttccaag ccaagctctg tgagacaggg gagctcgttg ccattaagaa 540

ggtgcttcag gacaaacgct ttaagaaccg agagctgcag attatgagaa gactagaaca 600

ctgtaatata gtgaaactga agtatttctt ctactccagt ggagacaaga aggaagaagt 660

gttcttgaac ctagtgttag aatttattcc agagacagta tataaagtag caaggcatca 720

cagcaaacaa aaacaaacta taccaatcag ctatattaag ttgtatatgt accagttgtt 780

ccgaagcctt gcctatattc actccctggg tgtctgtcat cgtgatataa agccacagaa 840

ccttctcctg gacccagaaa cgggtgttct caaactatgt gactttggga gtgccaaaca 900

tttggttcgc ggagaaccca atgtatcgta catctgctcc cgctattaca gggctccaga 960

actcatattt ggggcaactg attataccac caatattgac gtatggagtg caggatgcgt 1020

tttagcggaa cttctcctgg ggcagcctat cttcccaggt gactcgggtg tggaccagtt 1080

agtagaaatc atcaaagtcc tgggcacacc gacacgtgaa caaatcaggg aaatgaaccc 1140

gaattacaca gagttcaaat ttccgcagat taagtctcat ccgtggcaga aggtgttccg 1200

tcaacgcacc ccagaagacg ccataaacct tgtgtcacga ctgctggaat acacaccatc 1260

tgcgcgcatc acgcccctac aggcctgcgc gcacaaattc tttgacgaac tcagggatcc 1320

aaacaccaga ctacccaaca atcgggagtt accacccctc ttcaatttta ccgaacatga 1380

aatcaagatc cagccagagc tgaacaacaa attgattcct tctcactatc gaggtgagcc 1440

ggcaaacagc agcagtggtg gtggctcatc tgccgttgac tcttctgagg gtgctgcagc 1500

tgctgctgta aatgataatt gagatggatg gtggccagcc cagtcagcct ctcctgcagc 1560

ctccacacca gccttcctgc ccccttgtgc ctgcatccag caatatctgg acccagctgt 1620

gtacagagct ccagttttgg gataaagctt ggccaagggg gctgtggagg ccagtcttct 1680

tgggcagata gctgtacttc acgtatggct gtaatcatgt ggccctcata atgtgtaaag 1740

tgtacataca ttgaacatta ctagtgaatg actctcccag gcttgaggca cccagcagcc 1800

acaccatttg cttgttattg catacactgt tgtgccagtg tggcccagcc caggtgtcct 1860

tgatctgttg gtaggagctt ggtgctgatg gtaaccttct gattgcccag cccactgcat 1920

ggtggtcatc gtgacctcag ggtcatggag cacccagctc ctcgcacacc agtggagcca 1980

gcctctgatg cattgtattt gtcttggact atcatagtta ggtccatgat gtctgcacca 2040

agttttgtag gccactgttg catgggagtt tgtatgctgt gatgaggtgt atagtatgac 2100

caacagcaat gtgctccctc ttgatattgt gctgcctccc acctcccctg ctgtcccctt 2160

gccttttcac ctgcagcagc tagttcaccc caagccagtg ctagtgatga gttgtgagtt 2220

gttggtgtgt cacactgagt tagtgccaat gttacttgta gtgtcacctc cgttggccca 2280

ccctgggctc actttgttcc tgctcttctg ccagggacac cagcttccct tacagcctca 2340

gtgtctctgg aattgcaaaa aaaaaaaaaa aaaaaaaaaa 2380

Claims

1. A penaeus monodon glycogen synthase kinase GSK3 beta gene is characterized in that the base sequence of the gene is shown as SEQ ID NO: 1 is shown.

2. The protein encoded by the glycogen synthase kinase GSK3 beta gene of penaeus monodon of claim 1, which is characterized in that: the amino acid sequence of the encoded protein is shown as SEQ ID NO: 2, respectively.

3. The gene of claim 1 or the encoded protein of claim 2, for use in improving ammonia nitrogen tolerance of Penaeus monodon.

4. An SNP locus related to ammonia nitrogen resistance of penaeus monodon is characterized in that: the SNP locus is SEQ ID NO: 1, wherein the base is mutated from C to G at position 940 of the base sequence shown in 1.