CN114149992B

CN114149992B - MiR-CM1 of Phellinus linteus and application thereof

Info

Publication number: CN114149992B
Application number: CN202111417901.7A
Authority: CN
Inventors: 朱才彬
Original assignee: Shanghai Cheermore Biological Technology Co Ltd
Current assignee: Shanghai Cheermore Biological Technology Co Ltd
Priority date: 2021-11-25
Filing date: 2021-11-25
Publication date: 2024-04-23
Anticipated expiration: 2041-11-25
Also published as: CN114149992A

Abstract

The invention belongs to the field of biotechnology and medicine, relates to the separation and identification of miR-CM1 from Phellinus linteus, and particularly relates to application of miR-CM 1. The miR-CM1 has a nucleotide sequence shown as SEQ ID NO.1 and has good anti-aging activity. miR-CM1 can bind to the 3' UTR of Mical < 2 >, regulate the expression of target gene Mical < 2 >, and further change the expression of downstream skin aging markers. Therefore, miR-CM1 can resist aging induced by ultraviolet radiation when applied to photoaged skin cells or tissues. The invention also provides a skin external preparation containing miR-CM1, and the skin external preparation has an anti-aging effect. Provides a new research direction and development foundation for the development of anti-aging skin care products.

Description

MiR-CM1 of Phellinus linteus and application thereof

Technical field:

The invention belongs to the field of biotechnology and medicine, relates to the separation and identification of miR-CM1 from Phellinus linteus, and particularly relates to application of miR-CM 1.

The background technology is as follows:

Skin is the first line of defense for the human body and is most susceptible to damage and aging from the external environment. Among them, ultraviolet rays are the most important factors inducing skin aging. Skin aging is caused by ultraviolet radiation of the sun, and is characterized by poor keratinization of epidermis, abnormal hyperplasia, reduced collagen, loss of elasticity, wrinkles, etc. Ultraviolet radiation can cause matrix metalloproteinase to be expressed in the light injury part and degrade skin collagen. In addition, ultraviolet light can cause aging through active oxygen mediated inflammation. In modern society, as people continuously know the importance of skin care, skin care knowledge is continuously increased, skin care has become a daily use, and sun protection products have gradually become one of cosmetics used daily by people. Therefore, the method has great practical significance prospect in exploring and developing the raw materials and the mechanism of the anti-aging skin care product.

Mical2 is a monooxygenase enzyme that directly binds to and enhances the depolymerization of F-actin. In the absence of actin, it also acts as an NADPH oxidase to produce H ₂O₂, which is involved in regulating cytoskeletal dynamics and related basic biological processes. Mical2 is also involved in angiogenesis, vesicle transport, and vesicle transport; and are associated with the development and progression of a variety of tumors. Hydrogen peroxide (H ₂O₂), ultraviolet light, etc. can cause sustained Reactive Oxygen Species (ROS) stimulation, thereby causing human skin cell aging.

Phellinus linteus is a typical pharmaceutical fungus and contains compounds such as polysaccharides, polyphenols, and flavonoids. More and more researches show that the phellinus linteus plays a remarkable regulating and controlling role in resisting tumor, protecting liver, reducing inflammatory reaction, controlling blood sugar and the like. For example, the polysaccharide isolated from it can inhibit the expression of various inflammatory factors in cells. In addition, the water-soluble extract thereof plays an immunoregulatory role in atopic dermatitis. Phellinus linteus extract was listed in the catalog of used cosmetic raw materials (2021 edition). Currently, phellinus linteus extracts have been used in various skin care and cosmetic formulations.

MicroRNA (miRNA) is a class of endogenous non-coding RNA of about 19-25nt in length. miRNA is involved in gene posttranscriptional regulation, can regulate the growth and development of cells and organisms, and is related to human diseases. More and more researches show that exogenous plant miRNAs can regulate the expression of target genes of mammals, so that the cross-border regulation is realized. For example, zhang Chenyu found that miR2911 in honeysuckle can be absorbed by mice, inhibiting viral replication by targeting alphavirus. The application discovers that miRNA in phellinus linteus can perform cross-boundary regulation on human skin cells and exert anti-aging activity. The preparation method has great potential application value in the research and development of anti-aging skin care products.

The invention comprises the following steps:

The invention aims to provide miR-CM1 of phellinus linteus and application thereof, wherein miR-CM1 can control down-regulated expression of Mical genes, further change expression of downstream skin aging markers, and has potential value in development and application of anti-aging skin care products.

One of the technical schemes provided by the invention is miRNA from Phellinus linteus, specifically miR-CM1, which has a nucleotide sequence shown in SEQ ID NO. 1;

Further, the precursor sequence MIR-CM1 of the miR-CM1 has a nucleotide sequence shown in SEQ ID NO. 2;

Further, the DNA encoding the precursor sequence MIR-CM1 has the nucleotide sequence shown in SEQ ID NO. 3.

The second technical scheme provided by the invention is the application of the miR-CM 1;

further, the application is the application of miR-CM1 in regulation and control of Mical gene expression;

still further, the Mical Gene is in NCBI database for Gene ID 9645;

Further, the use is the use of miR-CM1 in skin care products, cosmetics or make-up products, and in the preparation of products for preventing or treating photoaging; the miR-CM1 can target the 3'utr of Mical' 2, reducing expression of Mical2 (matching results are shown in figure 2).

The third technical scheme provided by the invention is an external preparation for skin containing the miR-CM 1;

further, the skin external agent includes, but is not limited to, a skin care product, a cosmetic, an application agent, or the like;

the coating agent comprises, but is not limited to, oil agent, water agent, ointment or gel agent and the like;

further, the addition amount of the miR-CM1 in the skin external agent is 0.2% -5% (weight percentage);

further, the external preparation for skin is in the form of at least one of water, essence, gel, emulsion, skin base solution or cream;

Further, an emulsion containing miR-CM1 comprises the following components (in percentage by weight): 0.01-0.05% of EDTA disodium, 2-5% of glycerol, 0.05-0.2% of xanthan gum, 0.1-0.3% of p-hydroxyacetophenone, 0.5-3% of Montanov L-emulsifier, 0.5-3% of ARLACEL 170 emulsifier, 0.1-0.5% of glyceryl stearate, 0.5-3% of cetostearyl alcohol, 2-6% of caprylic/capric triglyceride, 0.5-3% of polydimethylsiloxane, 0.1-0.5% of methyl propylene glycol, 0.5-3% of polyethyleneimine-1500, 0.5-3% of sodium hyaluronate, 10.2-5% of miR-CM and the balance of deionized water;

preferably, the addition amount of miR-CM1 is 0.5-1%;

Preferably, the emulsion containing miR-CM1 comprises the following components (in weight percent): EDTA disodium 0.03%, glycerol 4%, xanthan gum 0.1%, p-hydroxyacetophenone 0.2%, montanov L-emulsifier 1%, ARLACEL170 emulsifier 1%, glyceryl stearate 0.3%, cetostearyl alcohol 1%, caprylic/capric triglyceride 4%, polydimethylsiloxane 1%, methyl propylene glycol 0.35%, polyethylene imine-1500% 1%, sodium hyaluronate 1%, miR-CM 1.75%, and deionized water in balance.

The fourth technical scheme provided by the invention is the application of the miR-CM 1-containing skin external preparation, in particular the application of the miR-CM 1-containing emulsion, which can resist ultraviolet-induced aging and increase the collagen content of the ultraviolet irradiation part of the skin.

The invention has the beneficial effects that:

the invention screens out a novel phellinus linteus miRNA (miR-CM 1) and a precursor MIR-CM1 thereof, wherein the miR-CM1 has good anti-aging activity. miR-CM1 can bind to the 3' UTR of Mical < 2 >, regulate the expression of target gene Mical < 2 >, and further change the expression of downstream skin aging markers. Therefore, miR-CM1 can resist aging induced by ultraviolet radiation when applied to photoaged skin cells or tissues.

The invention provides a formula of a miR-CM1 basic skin care product, and the formula proves that the miR-CM1 basic skin care product has an anti-aging effect. Provides a new research direction and development foundation for the development of anti-aging skin care products.

The miR-CM1 disclosed by the invention can provide a mechanism support for researching the anti-aging skin care product of the phellinus linteus extract, and a wider space is provided for researching and developing the anti-aging skin care product.

Description of the drawings:

FIG. 1 is a secondary structure of miR-CM1 precursor MIR-CM 1.

FIG. 2 is a graph showing the matching of miR-CM1 and Mical' UTR of 2.

FIG. 3 Regulation of Mical by miR-CM1

Wherein A: a graph of the change result of the mRNA expression content of Mical under the condition of transfection miR-CM1 mimics; b: results of changes in activity of Mical-3' UTR luciferase transfected with miR-CM1 mimics and miR-CM1 variant.

NC is negative control; mimics is an analog reference; mutant is a mutant.

FIG. 4 changes in senescence-associated markers upon application of miR-CM1 in skin cells

Wherein, A is the variation level of ROS relative expression quantity; b: a level of change in SOD activity; the level of change in the relative expression level of beta-galactosidase associated with C-aging.

FIG. 5 changes in collagen content before and after application of miR-CM1 skin care products in mouse skin.

Wherein A: dyeing pinus massoniana; b: statistical graphs of collagen content.

Detailed Description

The following description of the embodiments of the present invention will be made clearly and fully with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention.

The experimental procedures in the following examples, unless otherwise specified, are conventional in the art. The materials, reagents and the like used, unless otherwise specified, are all commercially available.

In the present invention, miR represents miRNA;

Phellinus linteus (Phellinus linteus) used in the present invention was purchased from North Nanopsis (BNCC), strain number BNCC109781.

Example 1 screening and identification of miRNAs

1. Preparation of samples

The extraction of the RNA sample may be from a lysate of Phellinus linteus or from an exosome of Phellinus linteus. For lysates: cutting Phellinus linteus in PBS under high pressure, and centrifuging at high speed to obtain supernatant, which is lysate of Phellinus linteus. For exosomes: the exosome of Phellinus linteus is obtained by homogenizing Phellinus linteus, and centrifuging at differential speed. The dead cells were removed by first centrifugation at 3000 Xg for 30 minutes, the supernatant was collected and centrifuged at 10000 Xg for 60 minutes to remove cell debris. The resulting supernatant was further centrifuged at 150000Xg for 90 minutes, and the exosomes (pellet) were suspended in PBS buffer.

RNA extraction and quality detection

Total RNA from the exosome samples was extracted using Trizol (Siemens, america) method. Detecting the integrity of RNA by agarose gel electrophoresis, wherein the electrophoresis shows that 28S and 18S bands are clear and have no degradation; detecting the concentration and purity of RNA by using an ultra-micro spectrophotometer (Tiangen, background), wherein the OD260/280 value is between 1.8 and 2.2, and the OD260/230 is more than or equal to 2.0, which indicates that the purity of the RNA is qualified. The concentration of the RNA sample is more than or equal to 200 ng/. Mu.L, and the total amount is more than or equal to 2. Mu.g. The RNA preliminary detection quality is qualified, so that the construction of a downstream high-quality small RNA-seq library is ensured. Further quality control and miRNA sequencing were performed.

3. Library construction:

The qualified RNA is used for constructing a miRNA library, a proper amount of total RNA is taken for joint connection reaction, a phosphate group is arranged at the 5 'end of the mature miRNA, the 3' end is hydroxyl, the structure is different from other RNA, and under the action of T4 RNA ligase 2 and T4 RNA ligase, 3 'joints and 5' joints with known sequences are added at the two ends. For RNA with 5 'and 3' linkers attached, cDNA of the first strand is synthesized using reverse transcription complementary to the sequence on the linker. And (3) taking the reaction product of the step as a template, and synthesizing and amplifying a double-chain library of miRNA by using PCR. Isolation of miRNA library with insert size of 22-24nt by polyacrylamide gel electrophoresis. And (5) performing quality inspection and quantitative evaluation on the constructed sequencing library to determine whether the sequencing library is suitable for being put on machine.

4. Sequencing on machine

And diluting the sample which is qualified in quality inspection, and loading the sample according to the corresponding proportion according to the sequencing flux requirements of different samples. The library was sequenced using an Illumina high throughput sequencing platform, a double ended sequencing strategy.

5. Bioinformatic analysis (including novel miRNA prediction and expression analysis)

In order to ensure the quality of information analysis, the raw sequencing sequences (raw reads) obtained by sequencing are filtered to obtain CLEAN READS for subsequent analysis. Quality filtration was performed using FASTX-Toolkit software. And carrying out small RNA length distribution statistics on the sequences after quality control, wherein miRNAs are concentrated at 21nt or 22nt. In addition, BLAST comparison is carried out on the sequences after quality control and mature miRNA sequences of corresponding species in the miRBase database, and the sequences are compared with the Rfam database and the reference genome, so that the sequencing result is subjected to preliminary evaluation. The results were annotated for different types of Small RNAs.

Novel miRNA prediction and expression analysis. Because the hairpin structure of the miRNA precursor can be used for predicting miRNA, the miRNA can be compared to a genome sequence, the sequences at two sides of the miRNA can be intercepted for predicting the secondary structure of the RNA, and the novel miRNA can be obtained by combining with the information such as the Dicer enzyme binding site, the free energy of the secondary structure and the like. Comparing reads with a reference genome by adopting mirdrep 2 software, and according to the comparison result of the reads and the genome, combining homologous miRNA sequences of related species, such as RNA secondary structures of RNAfold and the like, predicting and identifying new miRNA mature bodies (STAR MIRNA and material miRNA) and precursor sequences of the species, and counting the expression condition of each sample new miRNA.

Through the separation and identification, the novel miRNA from Phellinus linteus is named miR-CM1. The secondary structure is shown in figure 1, and the figure shows that the miRNA-like precursor forms a stable stem-loop structure, the mature sequence of the miRNA-like precursor is shown in a sequence table SEQ ID NO.1, the precursor sequence of the miRNA-like precursor is shown in a sequence table SEQ ID NO.2, and the coding gene of the precursor sequence of the miRNA-like precursor is shown in a sequence table SEQ ID NO. 3.

SEQ ID NO.1 (miR-CM 1 mature sequence): uaccaugggaguggacgua (19 bp).

Example 2 miR-CM1 Targeted modulation of Mical2 expression

The 3'UTR of miR-CM1 and Mical2 were matched as shown in FIG. 2, i.e., miR-CM1 was able to bind specifically to the 3' UTR of Mical.

1. Real-time fluorescent quantitative PCR detection of gene expression

1) Preparation of cell samples

Human immortalized epidermal cells (HaCat cells) were cultured in DMEM (Gibco, usa) supplemented with 10% fetal bovine serum (BI, israel) and 100U/mL penicillin streptomycin mix (melem, china) and grown in a 5% concentration CO ₂ incubator at 37 ℃;

Experimental group: cell samples were collected after transfection of miR-CM1 mimics with Lipo2000 transfection reagent (Siemeaway, USA) for 48h in the above cultured HaCat cells. Transfection protocol: taking a 24-well plate as an example, other culture materials were adjusted for transfection scale with reference to the instructions, all numbers and volumes were calculated per well. Cells were inoculated in 500 μl of antibiotic-free medium and allowed to fuse up to 50% of the time during transfection. The amount of cells per well at the time of transfection was as follows: 20pmol miR-CM1 mimics was diluted with 50. Mu.L of Opti-MEM medium and gently mixed. mu.L of Lipo2000 was diluted in 50. Mu.L of Opti-MEM medium and incubated for 5 min at room temperature. The first two solutions were mixed (to make the total volume 100. Mu.L), gently mixed, and left at room temperature for 20 minutes to form 100. Mu.L of transfection solution. mu.L of the transfection solution was added to each well of cells, and the mixture was gently shaken. (the present invention relates to the transfection procedure using this method unless otherwise specified).

Control group: the human immortalized epidermal cells (HaCat cells) were cultured normally without any treatment.

MiR-CM1 mimics is miR-CM1 analogue, and miR-CM1 mimics analogue is a double-chain sequence: the sense strand sequence is: 5'-uaccaugggaguggacgua-3' (with miR-CM1, SEQ ID NO.1 19 bp); the antisense strand sequence is: 5'-cguccacucccaugguauu-3' (SEQ ID NO. 4).

2) Extraction of Total RNA

Total RNA was extracted from the samples by Trizol (Siemens, USA) method. The integrity and purity of the RNA samples were checked as in example 1, step 2.

3) Reverse transcription

CDNA was synthesized by reverse transcription using Hifair III 1st Strand cDNA SHnthesis SuperMix for qPCR (GDNA DIGESTER plus) (next holy, shanghai) kit. The removal of genomic residual genomic DNA and reverse transcription system was as follows:

the following mixture was prepared in an RNase-free centrifuge tube, and gently swirled and mixed. Incubate at 42℃for 2min.

Preparation of reverse transcription reaction System (20. Mu.L System)

25 ℃ For 5min;55 ℃ for 15min;85 ℃ for 5min. The obtained cDNA was stored at-20 ℃.

4) QPCR experiment

QPCR was performed using Hieff UNICON Universal Blue qPCR SYBR GREEN MASTER Mix (next holy, shanghai).

The primers used for detection were as follows:

Mical2 upstream primer: TGACAGCCAAGAAGCAGAGCCT (SEQ ID NO. 5);

Mical2 downstream primer: GGTAGTTGGTGGCAAAGTCTGC (SEQ ID NO. 6).

Adopts beta-actin as an internal reference gene:

Beta-actin upstream primer: CACCATTGGCAATGAGCGGTTC (SEQ ID NO. 7);

beta-actin downstream primer: AGGTCTTTGCGGATGTCCACGT (SEQ ID NO. 8).

CDNA stock was diluted 4-fold and qPCR reaction system (20. Mu.l) was prepared on ice:

After thoroughly mixing, 20. Mu.L of the reaction solution was sucked into the reaction well, the heat-sealing film was sealed, and the mixture was centrifuged briefly. Detection was performed on a PCR instrument. qPCR reaction procedure was as follows: a pre-denaturation stage, 95 ℃ for 2min;40 cyclic stages (including denaturation, annealing/extension), denaturation 95 ℃,10s, annealing/extension 60 ℃,30s; melting curve phase (instrument default settings); experimental data were obtained for subsequent results analysis.

Experiments were repeated at least three times. And calculating Mical relative expression quantity by taking the reference gene as a reference. The results (FIG. 3-A) show that the expression of HaCat cells Mical2 transfected with miR-CM1 mimics was significantly lower than that of the control group.

2. Dual luciferase reporter detection

1) Cell sample preparation

Human embryonic kidney cell line 293T cells (HEK-293T) were cultured in DMEM (Gibco, USA) supplemented with 10% fetal bovine serum (BI, israel) and 100U/mL penicillin streptomycin cocktail (Mei Lun, china) and grown in 5% strength CO ₂ incubator at 37 ℃.

Co-transfecting miR-CM1 NC, miR-CM1 mimics and miR-CM1 mutans with a double-luciferase reporter plasmid into HEK-293T cells by using Lipo2000 transfection reagent (Sieimer, america), and collecting cell samples after 48 hours; the control group was transfected with only the dual luciferase reporter plasmid.

MiR-CM1 NC is miR-CM1 negative control, and the sequence of the miR-CM1 negative control is shown as (SEQ ID NO. 9);

miR-CM1 mutant, namely miR-CM1 mutant, is obtained by mutating miR-CM1mimics sequence, and the sequence is shown as (SEQ ID NO. 10);

the part sequence of Mical 'UTR of Mical gene is linked with pSiCheck carrier to obtain dual-luciferase report plasmid, mical 3' UTR part sequence is shown in SEQ ID NO. 11. Plasmid construction was submitted to Beijing Optimu Biotech Co.

2) Fluorescein activity change detection

The detection of firefly luciferase and Renilla luciferase was performed using the Dual-Lumi double-luciferase reporter detection kit (Biyunsan, shanghai).

By detecting the change of miR-CM1 to Mical2 luciferase activity, the result (shown in figure 3-B) shows that (the control group is set to be 1), miR-CM1 mimics transfection can extremely remarkably reduce luciferase activity, and miR-NC and miR-CM1 mutant transfection luciferase activity is not remarkably different from that of the control group, so that Mical2 is miR-CM1 target gene.

Thus, the miR-CM1 has an inhibition effect on Mical's 2 expression, and miR-CM1 regulates Mical's 2 expression.

Example 3 miR-CM1 regulates expression of markers associated with cell senescence by ultraviolet radiation

1. Cell sample preparation

Hacat was fine cultured in DMEM (Gibco, usa) supplemented with 10% fetal bovine serum (BI, israel) and 100U/mL penicillin streptomycin mix (melem, china) and grown in a 5% concentration CO ₂ incubator at 37 ℃;

The cultured HaCat cells were pre-protected by Lipo2000 transfection reagent (sameiaway, usa) transfection miR-CM1 mimics, and after 24h pre-protection, old medium was aspirated, washed 3 times with PBS, and cells were covered with an appropriate amount of Phosphate Buffer (PBS). The irradiation was performed at a dose of 10J/cm ² using an ultraviolet tube (Philips, netherlands) of UVA source. Subsequently, PBS was discarded, fresh medium was supplemented, and the sample was collected for detection after further incubation for 6 hours (miR-CM 1 group).

Wherein, the control group Hacat cells are normally cultured without treatment (no miR-CM1 pre-protection and no ultraviolet irradiation); the Model group (Model group) is not pre-protected and is irradiated only by ultraviolet rays; the miR-CM1 group is pre-protected and irradiated by ultraviolet.

2. Functional test related to cell aging

1) ROS expression level detection

The level of active oxygen in the cells of the different treatment groups was detected using an active oxygen detection kit (soribao, beijing). The results are shown in FIG. 4A.

2) SOD activity detection

The cells were collected and washed 1-2 times with pre-chilled PBS. The pellet was homogenized in a chilled PBS ice water bath. The homogenate was then centrifuged at 4℃and the supernatant was taken as the sample to be tested.

The CuZn/Mn-SOD activity detection kit (WST-8 method) (Biyun Tian, shanghai) is used for detecting the activity of the cell superoxide dismutase (SOD) in different treatment groups. The results are shown in FIG. 4B.

3) Aging-related beta-galactosidase expression level detection

Beta-galactosidase (SA-beta-Gal) staining associated with cell senescence was performed in different treatment groups using a beta-galactosidase in situ staining kit (Biyun Tian, shanghai). For 6-well plates, the cell culture broth was aspirated, 1 ml of β -galactosidase staining fixative was added and fixed at room temperature for 10 minutes. The cell fixative was aspirated and the cells were washed 3 times for 3 minutes with PBS. The PBS was removed by blotting, 1 ml of staining working fluid was added to each well and incubated overnight at 37℃and the 6-well plate was sealed with a preservative film to prevent evaporation. And (5) observing under a common optical microscope, and taking a picture. The results are shown in FIG. 4C.

As a result of cell senescence-related functional experiments, as shown in FIG. 4, miR-CM1 was found to be capable of extremely significantly inhibiting cell senescence caused by ultraviolet radiation, reducing ROS and SA-beta-Gal levels, and improving SOD activity.

Example 4 miR-CM1 skin emulsion increasing collagen expression in mouse skin aging caused by ultraviolet irradiation 1) preparation of miR-CM1 skin emulsion

The formula of the miR-CM1 skin care product basic emulsion comprises the following components: calculated according to the weight percentage, EDTA disodium 0.03%, glycerin 4%, xanthan gum 0.1%, p-hydroxyacetophenone 0.2%, montanov L-emulsifier 1%, ARLACEL170 emulsifier 1%, glyceryl stearate 0.3%, cetostearyl alcohol 1%, caprylic/capric triglyceride 4%, polydimethylsiloxane 1%, methyl propylene glycol 0.35%, polyethyleneimine-1500% 1%, sodium hyaluronate 1%, miR-CM 1.75%, and the balance deionized water.

According to the above formula, the preparation method comprises the following steps:

Firstly, mixing EDTA disodium, glycerol, xanthan gum, p-hydroxyacetophenone, montanov L-emulsifier, ARLACEL 170 emulsifier, glycerol stearate, cetostearyl alcohol, caprylic/capric triglyceride, polydimethylsiloxane and methyl propylene glycol in advance for emulsification to obtain basic emulsion;

then, pre-mixing polyethyleneimine-1500 and sodium hyaluronate into a solution, adding miR-CM1 (the adopted miR-CM1 is a nucleic acid molecule synthesized according to a nucleotide sequence shown in a sequence table SEQ ID NO. 1) into the solution, gently mixing, and standing for 25min to obtain a mixed solution containing miR-CM 1;

and finally, adding the mixed solution containing miR-CM1 into the basic emulsion at the temperature of below 40 ℃ to obtain the miR-CM1 skin care emulsion.

2) Establishment of mouse photoaging model

Kunming mice (females, 6-8 weeks) were randomized into three groups (n=5), back dehairing treatment. Normal feeding of mice in each group; wherein the control group was not given any treatment; performing ultraviolet irradiation (UVA irradiation with frequency of three times per week and dosage of 8J/CM ² for 4 weeks) on the miR-CM1 group and the Model group, and applying the skin care emulsion prepared in the step 1) after each irradiation of the miR-CM1 group; after each irradiation of the Model group, the skin care emulsion without miR-CM1 is given (the preparation method is the same as that in the step 1), and only miR-CM1 components are removed for smearing treatment. All mice were euthanized after 4 weeks. Back skin tissue was collected and fixed in formalin.

3) Masson staining

Tissues were dehydrated and embedded in paraffin according to standard procedures. Sections were obtained at 4 μm thickness and stained using the Masson trichromatic staining kit (soribao, beijing).

Masson trichromatic staining, also known as Masson staining, is the most classical method in connective tissue staining, and is the authoritative and classical technical method for dyeing collagen fibers. Trichromatic staining generally refers to staining of the nucleus and selective display of collagen and muscle fibers. The principle of this method of staining is related to the size of the anionic dye molecules and the penetration of the tissue: the size of the molecules is represented by the molecular weight, small molecular weight is easy to penetrate through tissue with compact structure and low permeability, and large molecular weight can only enter into tissue with loose structure and high permeability. The molecular weight of aniline blue is large, so Masson staining gives collagen fibers a blue color (stained with aniline blue). Statistics of blue area after masson staining can be used to evaluate skin tissue collagen content, and statistics of blue area ratio by imageJ software is shown in the right side of fig. 5.

According to the results of animal aging-related functional experiments (shown in figure 5), the collagen content is reduced after ultraviolet irradiation, and the miR-CM1 skin care emulsion can resist the reduction of the collagen content caused by the ultraviolet irradiation, so that the miR-CM1 skin care emulsion can remarkably inhibit skin aging caused by the ultraviolet irradiation and increase the collagen content of a treatment group.

The foregoing description of the preferred embodiments of the invention is not intended to be limiting, but rather is intended to cover all modifications, equivalents, alternatives, and improvements that fall within the spirit and scope of the invention.

SEQUENCE LISTING

<110> Shanghai Chengmu Biotechnology Co., ltd

<120> MiR-CM1 of Phellinus linteus and application thereof

<130> 1

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> RNA

<213> Phellinus linteus (Phellinus linteus)

<400> 1

uaccauggga guggacgua 19

<210> 2

<211> 108

<212> RNA

<213> Phellinus linteus (Phellinus linteus)

<400> 2

ucgucccuca caugucucuc gugcagaugc aacggguuua guucaccccg uugauauucu 60

gaacgugaua ccaugggagu ggacguaaga cugaauacaa cuccuaug 108

<210> 3

<211> 108

<212> DNA

<213> Phellinus linteus (Phellinus linteus)

<400> 3

tcgtccctca catgtctctc gtgcagatgc aacgggttta gttcaccccg ttgatattct 60

gaacgtgata ccatgggagt ggacgtaaga ctgaatacaa ctcctatg 108

<210> 4

<211> 19

<212> RNA

<213> Artificial sequence

<400> 4

cguccacucc caugguauu 19

<210> 5

<211> 22

<212> DNA

<213> Artificial sequence

<400> 5

tgacagccaa gaagcagagc ct 22

<210> 6

<211> 22

<212> DNA

<213> Artificial sequence

<400> 6

ggtagttggt ggcaaagtct gc 22

<210> 7

<211> 22

<212> DNA

<213> Artificial sequence

<400> 7

caccattggc aatgagcggt tc 22

<210> 8

<211> 22

<212> DNA

<213> Artificial sequence

<400> 8

aggtctttgc ggatgtccac gt 22

<210> 9

<211> 21

<212> RNA

<213> Artificial sequence

<400> 9

uucuccgaac gugucacgut t 21

<210> 10

<211> 19

<212> RNA

<213> Artificial sequence

<400> 10

uucgaagcga guggacgua 19

<210> 11

<211> 228

<212> DNA

<213> human

<400> 11

cacacttctg ctctaaggtg actggttttc ttgccaattt tcaaagagtg gtactaaccc 60

ccaacccgct ttccgcaccc cgtcctctcc gccagcagta ctggttgcac taactgtgag 120

tgtcttgcat actgatggac tcatttggtg gcatggttgg ctaacagcat ggcggggggt 180

gttcagcttg agacccatgc ctgtgttcat ttcccatgga gctggcag 228

Claims

1. The miRNA from phellinus linteus is characterized by specifically being miR-CM1, and the nucleotide sequence of the miRNA is shown as SEQ ID NO. 1.

2. The miRNA from Phellinus linteus of claim 1, wherein the precursor sequence MIR-CM1 of miR-CM1 has a nucleotide sequence shown in SEQ ID NO. 2;

the DNA of the coding precursor sequence MIR-CM1 has a nucleotide sequence shown in SEQ ID NO. 3.

3. The use of a miRNA from phellinus linteus of claim 1, wherein it is the use of miR-CM1 for the preparation of products for preventing or treating photoaging.

4. An external preparation for skin comprising miR-CM1 according to claim 1, comprising: 0.01-0.05% of EDTA disodium, 2-5% of glycerol, 0.05-0.2% of xanthan gum, 0.1-0.3% of p-hydroxyacetophenone, 0.5-3% of Montanov L-emulsifier, 0.5-3% of ARLACEL 170 emulsifier, 0.1-0.5% of glyceryl stearate, 0.5-3% of cetostearyl alcohol, 2-6% of caprylic/capric triglyceride, 0.5-3% of polydimethylsiloxane, 0.1-0.5% of methyl propylene glycol, 0.5-3% of polyethyleneimine-1500, 0.5-3% of sodium hyaluronate, 0.2-5% of miR-CM and the balance of deionized water.

5. The external preparation for skin according to claim 4, comprising the following components: EDTA disodium 0.03%, glycerol 4%, xanthan gum 0.1%, p-hydroxyacetophenone 0.2%, montanov L-emulsifier 1%, ARLACEL 170 emulsifier 1%, glyceryl stearate 0.3%, cetostearyl alcohol 1%, caprylic/capric triglyceride 4%, polydimethylsiloxane 1%, methyl propylene glycol 0.35%, polyethylene imine-1500% 1%, sodium hyaluronate 1%, miR-CM 1.75%, and deionized water in balance.