CN114134229A

CN114134229A - Marker, kit, method and application for diagnosing colorectal cancer and/or intestinal polyp

Info

Publication number: CN114134229A
Application number: CN202111262440.0A
Authority: CN
Inventors: 张友德; 王国侠
Original assignee: Guizhou Baijing Biotechnology Co ltd
Current assignee: Shenzhen Ruimeng Innovation Biotechnology Co ltd
Priority date: 2021-10-28
Filing date: 2021-10-28
Publication date: 2022-03-04

Abstract

The invention discloses application of an ETV4 gene and/or a CDH3 gene in serving as/preparing a marker of colorectal cancer and/or intestinal polyp. The invention discovers that: by detecting the mRNA expression level of the ETV4 gene and/or the CDH3 gene, colorectal cancer samples or intestinal polypus samples can be well distinguished from human excrement samples, namely intestinal healthy people, patients with intestinal polyps and patients with colorectal cancer. The present invention detects/diagnoses colorectal cancer or intestinal polyps using a quantitative detection reagent containing mRNA of ETV4 gene and/or CDH3 gene, and has very high detection sensitivity and specificity for colorectal cancer or intestinal polyps.

Description

Marker, kit, method and application for diagnosing colorectal cancer and/or intestinal polyp

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a marker, a kit, a method and application for diagnosing colorectal cancer and/or intestinal polyp.

Background

According to the 2020 global cancer data report of the world health organization international agency for research on cancer (IARC), the incidence of colorectal cancer is at the 3 rd position and the mortality at the 2 nd position in all cancers. According to the results of 'Chinese tumor registration annual newspaper' issued by the Chinese national cancer center, the incidence and mortality of colorectal cancer are obviously increased after the age of 45 years, and the incidence of colorectal cancer in big cities is 2 times that in small cities. In 2020, more than 55 million people in China newly suffer from colorectal cancer, and more than 28 million people die of colorectal cancer.

The pathological process of the colorectal cancer is slow, and early symptoms are not obvious. More than 90% of colorectal cancers develop from intestinal polyps. Intestinal polyps are a type of lesion in which the mucosal surface bulges within the intestinal lumen, resulting in localized hyperplasia. Intestinal polyps can be detected and resected as soon as possible, and colorectal cancer can be prevented. From intestinal polyps to colorectal cancer, it generally takes 3 to 10 years, and colorectal cancer is therefore one of the cancers most likely to be controlled by early screening. Research has shown that early Screening and treatment of colorectal cancer can significantly improve prognosis and reduce mortality (Lin et al, Screening for clinical cancer: updated evidence report and systematic review for the US predictive Services task force [ J ]. JAMA, 2021, 315(19): 1978-1997.).

Fibercolonoscopy is by far the most accurate method of colorectal cancer screening, and enteroscopy plus pathological biopsy is considered the gold standard for colorectal cancer screening and diagnosis. However, enteroscopy is prone to complications such as bleeding, bowel perforation and infection. Meanwhile, the compliance of the examination is greatly reduced in the complicated preoperative preparation process of bowel clearing, anesthesia and the like, the occurrence of discomfort in the examination process, high cost and the like. Another major reason for poor enteroscopy compliance comes from psychological aspects, and many people are reluctant to receive enteroscopy because of embarrassment and fear (Garman et al, color cancer screening, society, and follow-up in enteroscopy papers. am J Med Sci,2006.332(4): p.159-63). Therefore, a screening method with high sensitivity, high specificity and high compliance is urgently needed.

Fecal-based genetic testing is increasingly gaining importance as a new noninvasive colorectal cancer screening method. The us FDA approved the fecal-based Cologuard gene screening kit for sale in 2014, which is considered to be the technology currently closest to enteroscopy accuracy, with over 90% specificity. Compared with enteroscopy, the method has the advantages of no pain, no wound and convenient sampling, thereby having high compliance. Meanwhile, a plurality of gene detection methods based on the excrement also appear in China. It is noted that these stool-based gene tests are essentially targeted for DNA gene methylation markers. The components in the feces are complex and contain a large amount of inhibiting substances of Taq polymerase, so that the effect of amplifying the extracted nucleic acid by a PCR method is poor, and the sample treatment is complex, the process is long in time consumption and the detection cost is expensive. In addition, none of these fecal-based gene methylation detection methods has ideal sensitivity for intestinal polyps, e.g., Cologuard has only 42% sensitivity for detection of precancerous adenomatous intestinal polyps.

The ETV4(ETS variable transcription factor 4; also called E1A-F, E1AF, PEA3, PEAS3) gene belongs to one member of PEA3 subfamily in ETS transcription factor family, and can regulate the expression of various genes. It has been found that the expression of the ETV4 gene is higher in tumor tissues of colorectal cancer than in tissue of intestinal polyps (Aline Simoneti Fonseca et al, ETV4 plant a role on the primary events during the adonoma-adonociceps progress in the intestinal cancer). The protein encoded by the CDH3(Cadherin-3, also known as CDHP, HJMD, PCAD) gene is P-Cadherin, a member of the Cadherin family, first discovered in the placenta in 1986. Studies have shown that the CDH3 gene is highly expressed in tumor tissues of colorectal cancer (Shantha Kumara et al, P-Cadherin (CDH3) is overexpressed in tumor tissue and has potential as a serum marker for tumor cancer monitoring, Oncocoscience, Vol.4,2017, P139-147). It has also been reported that the CDH3 gene is highly expressed in polyp tissues of intestinal polyps (Hiroto Kita et al, Differential gene expression beta gene expression and normal mucosa in the colon in a microarray analysis, Journal of gastroenterology,2006,41: 1053-. The tumor Genome map (TCGA) project was combined by the National Cancer Institute (NCI) and National Human Genome Research Institute (NHGRI) in 2006 to initiate a program, using large-scale sequencing, to perform large-scale experiments on 36 cancers, and to search for genes associated with each Cancer or subtype by aligning tumor and normal tissues. Until the present invention was published, there was no study using the TCGA large sample database to verify the expression of ETV4 gene and/or CDH3 gene in intestinal cancer tissues, nor was there any study using ETV4 gene and/or CDH3 gene as reliable markers for fecal gene detection of colorectal cancer or intestinal polyps.

Through searching, no patent publication related to the present patent application has been found.

Disclosure of Invention

The invention aims to overcome the problems in the prior art and provides a colorectal cancer and/or intestinal polyp diagnosis marker, a kit, a method and application.

The technical scheme adopted by the invention for solving the technical problem is as follows:

application of ETV4 gene and/or CDH3 gene in aspects of serving as/preparing colorectal cancer and/or intestinal polyp markers.

Further, the test sample for use is stool, blood, intestinal polyp tissue, or colorectal cancer tissue.

Use of a biomarker for the diagnosis of colorectal cancer or intestinal polyps for the manufacture of a product for the diagnosis of colorectal cancer or intestinal polyps, wherein the biomarker for the diagnosis of colorectal cancer or intestinal polyps is the ETV4 gene and/or the CDH3 gene.

Further, the biomarkers are capable of diagnosing the occurrence of colorectal cancer or intestinal polyps;

alternatively, the test sample for use is stool, blood, intestinal polyp tissue, or colorectal cancer tissue.

Application of a quantitative detection reagent of ETV4 gene and/or CDH3 gene in preparation of a colorectal cancer or intestinal polyp diagnostic kit, wherein the quantitative detection reagent can detect mRNA of ETV4 gene and/or CDH3 gene.

Further, the detection sample of the quantitative detection reagent is feces, blood, intestinal polyp tissue or colorectal cancer tissue.

Further, the quantitative detection reagent can be used to perform any one of the following methods:

real-time fluorescent quantitative PCR, digital PCR, northern blotting denaturing gradient gel electrophoresis, nucleic acid chip detection, denatured high performance liquid chromatography, in situ hybridization, biological mass spectrometry, high-throughput RNA sequencing technology, a second generation hybridization capture technology based on antibody capture of Qiagen company, Siemens bDNA technology, and QuantiMAT capture hybridization target branched chain DNA signal amplification technology.

A probe for detecting/diagnosing colorectal cancer or intestinal polyps, comprising a probe for quantitatively detecting an mRNA expression level of ETV4 gene and/or CDH3 gene.

Further, the probe consists of a capture probe and a closed probe; the capture probe sequence of the ETV4 gene is shown as SEQ ID No.1-20, and the blocking probe sequence of the ETV4 gene is shown as SEQ ID No. 21-50; the capture probe sequence of the CDH3 gene is shown as SEQ ID No.51-70, and the blocking probe sequence of the CDH3 gene is shown as SEQ ID No. 71-105.

Further, the probe is any one of nucleotide sequences shown as follows:

(I) a nucleotide sequence as shown in any one of SEQ ID No.1 to 105;

(II) a nucleotide sequence which is obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (I) and has the same or similar functions with the nucleotide sequence shown in (I);

(III) a nucleotide sequence with at least 80% identity to the nucleotide sequence shown in (I);

(IV) the sequence complementary to the sequence shown in (I), (II) or (III).

A kit for detecting/diagnosing colorectal cancer or intestinal polyps comprising the probe as described above.

Further, the kit also comprises one or more than two of an enzyme-labeled specific antibody, an enzyme substrate and a carrier coupled with a universal probe;

wherein the universal probe is complementary paired with a partial sequence of the capture probe of

claim

7 or 8;

the enzyme is alkaline phosphatase or horseradish oxidase;

the enzyme substrate is a chemiluminescent or fluorescent substrate;

the carrier is a magnetic bead or a cell culture plate or a microporous plate.

Further, the universal probe is a nucleotide sequence shown as SEQ ID No. 106.

Further, the sample detected by the kit is feces, blood, intestinal polyp tissue or colorectal cancer tissue.

A method of detecting colorectal cancer or intestinal polyps by detecting mRNA levels of the ETV4 gene and/or the CDH3 gene, to distinguish an intestinal healthy sample from a colorectal cancer sample or an intestinal polyp sample.

The method for detecting as described above, the mRNA level of the ETV4 gene and/or CDH3 gene is detected using a quantitative detection reagent capable of detecting the mRNA of the ETV4 gene and/or CDH3 gene, or using the probe according to any one of

claims

7 and 8, or using the kit according to any one of

claims

9 and 10.

The beneficial effects obtained by the invention are as follows:

1. in view of the fact that no effective marker for detecting/diagnosing intestinal polyps has been found, the present invention provides a novel marker and technical solution for detecting/diagnosing intestinal polyps from stool samples, with sensitivity and specificity to intestinal polyps exceeding 87%.

2. Compared with the existing marker for detecting the colorectal cancer, the marker and the technical scheme provided by the invention can detect the colorectal cancer with high sensitivity and specificity, and both the sensitivity and the specificity to the colorectal cancer in a stool sample exceed 92 percent.

3. The method for detecting the mRNA level of the ETV4 gene and/or the CDH3 gene in the fecal sample does not depend on PCR reaction, so that the method is not interfered by a PCR enzyme inhibitor which is abundantly present in feces, and has convenient operation and low cost.

4. The invention discovers that: the TCGA database analysis finds that the expression of the ETV4 gene and/or the CDH3 gene in the intestinal cancer tissue is obviously higher than that of a paracancer normal tissue, and the colorectal cancer sample or the intestinal polypus sample can be well distinguished from a human excrement sample by detecting the mRNA expression level of the ETV4 gene and/or the CDH3 gene, namely, the intestinal healthy person, the intestinal polyp patient and the colorectal cancer patient are distinguished. The present invention utilizes a quantitative detection reagent containing mRNA of ETV4 gene and/or CDH3 gene to detect/diagnose colorectal cancer or intestinal polyps from stool samples, and has very high detection sensitivity and specificity for colorectal cancer or intestinal polyps.

Drawings

FIG. 1 is a schematic diagram of the working principle of the kit according to the present invention; wherein, 1 represents that the solid carrier is a magnetic bead or a 96-hole microporous plate, 2 represents a universal probe, 3 represents target nucleic acid, 4 represents a capture probe, 5 represents a blocking probe, 6 represents an enzyme-labeled specific antibody, and 7 represents an enzyme luminescent substrate;

FIG. 2 is a graph of the relative expression levels of the ETV4 gene (FIG. 2A) and the CDH3 gene (FIG. 2B) in rectal adenocarcinoma and paracancerous normal tissues, colon carcinoma and paracancerous normal tissues analyzed by the TCGA database of the present invention;

FIG. 3 is a graph showing the detection of the expression levels of mRNA of ETV4 gene (FIG. 3A) and CDH3 gene (FIG. 3B) in intestinal cancer cells using the detection reagent and kit of the present invention;

FIG. 4 is a graph showing the detection of the mRNA expression level of ETV4 gene in a fecal sample using the detection reagent and kit of the present invention; wherein (A) the fluorescence value of mRNA of ETV4 gene detected in stool samples of healthy intestinal tract patients and patients with intestinal polyps; (B) the ETV4 gene detects the ROC curve of intestinal polyps; (C) fluorescence values of ETV4 gene mRNA detected in fecal samples of healthy intestinal and colorectal cancer patients; (D) the ETV4 gene detects the ROC curve of colorectal cancer;

FIG. 5 is a graph showing the expression level of mRNA of CDH3 gene in a fecal sample measured by the detection reagent and kit of the present invention; wherein (A) the fluorescence value of mRNA of CDH3 gene detected in stool samples of healthy intestinal tract patients and patients with intestinal polyps; (B) the CDH3 gene detects the ROC curve of intestinal polyps; (C) fluorescence values of CDH3 gene mRNA detected in stool samples of healthy intestinal and colorectal cancer patients; (D) ROC curve for detecting colorectal cancer by CDH3 gene.

Detailed Description

The present invention will be further described in detail with reference to examples for better understanding, but the scope of the present invention is not limited to the examples. Various equivalent modifications of the invention, which fall within the scope of the appended claims of this application, will occur to persons skilled in the art upon reading this disclosure.

Those skilled in the art can modify the process parameters appropriately to achieve the desired results with reference to the disclosure herein. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those of ordinary skill in the art that variations and modifications in the methods and applications described herein, as well as other suitable variations and combinations, may be made to implement and use the techniques of this invention without departing from the spirit and scope of the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the term "and/or" includes any and all combinations of one or more of the associated listed items. The raw materials used in the invention are all conventional commercial products if not specified, the method used in the invention is all conventional in the field if not specified, and the mass of each substance used in the invention is all conventional use mass.

Preferably, the test sample for use is stool, blood, intestinal polyp tissue, or colorectal cancer tissue.

Preferably, the biomarker is capable of diagnosing the occurrence of colorectal cancer or intestinal polyps;

Preferably, the detection sample of the quantitative detection reagent is feces, blood, intestinal polyp tissue or colorectal cancer tissue.

Preferably, the quantitative detection reagent can be used to perform any one of the following methods:

As will be apparent to those skilled in the art, detection of mRNA should not be construed as limited to the particular mRNA sequence transcribed directly from the gene described above, but may also include as a result of alternative mRNA variants, short chains or pre-mRNA processing. The nucleotide sequence of the variant has 95%, 96%, 97%, 98%, 99% or more identity to the corresponding marker sequence; short strands are sufficient as long as they represent the specific sequence of the full-length mRNA itself.

In the present invention, different transcripts of the ETV4 gene and/or CDH3 gene mRNA are known to those skilled in the art, for example the ETV4 gene recorded at NCBI has the following different transcripts, with the transcript numbers: NM _001261439.3, NM _001986.4, NM _001261438.3, NM _001369367.2, NM _001369366.2, NM _001261437.3, NM _001369368.2, NM _001079675.5, XM _ 024450644.1; for example, the CDH3 gene recorded by NCBI has the following different transcripts, the transcript numbers of which are respectively: NM _001317195.3, NM _001317196.2, NM _001793.6, XM _011522800.3, DQ054082.1, BC 014462.1.

Preferably, the mRNA of the ETV4 gene and/or CDH3 gene is detected by detecting the consensus sequence of the mRNA of the different transcripts of the ETV4 gene and/or CDH3 gene.

A probe for detecting/diagnosing colorectal cancer or intestinal polyps, characterized in that: the probe comprises a probe for quantitatively detecting the mRNA expression level of the ETV4 gene and/or the CDH3 gene.

Preferably, the probe consists of a capture probe and a closed probe; the capture probe sequence of the ETV4 gene is shown as SEQ ID No.1-20, and the blocking probe sequence of the ETV4 gene is shown as SEQ ID No. 21-50; the capture probe sequence of the CDH3 gene is shown as SEQ ID No.51-70, and the blocking probe sequence of the CDH3 gene is shown as SEQ ID No. 71-105.

Preferably, the probe is any one of the nucleotide sequences shown as follows:

(I) a nucleotide sequence as shown in any one of SEQ ID No.1 to 105;

(IV) the sequence complementary to the sequence shown in (I), (II) or (III).

Preferably, the kit also comprises one or more than two of an enzyme-labeled specific antibody, an enzyme substrate and a carrier coupled with a universal probe;

claim

7 or 8;

the enzyme is alkaline phosphatase or horseradish oxidase;

the enzyme substrate is a chemiluminescent or fluorescent substrate;

the carrier is a magnetic bead or a cell culture plate or a microporous plate.

According to various carrier forms frequently used in the art, the carrier of the present invention is preferably a magnetic bead, a cell culture plate or a 96-well microplate; the universal probe can be modified by some modifications, such as amino modification, and can be coupled with a group on the surface of a magnetic bead; the universal probes can also be coated on a cell culture plate or a 96-well microplate by a coating solution.

Preferably, the universal probe is a nucleotide sequence shown as SEQ ID No. 106.

Preferably, the universal probe is complementary and matched with a partial sequence of the capture probe, wherein the partial sequence is a 16bp sequence from the 3 'end to the 5' direction of the capture probe; in a specific embodiment of the invention, all capture probes with a terminal 16bp sequence of CTCTTGGAAAGAAAGT are capable of complementary paired binding to the universal probe shown in SEQ ID No. 106.

On the premise that the universal probe, the luminescent substrate and the enzyme-labeled antibody are all consistent, intestinal cancer cell total RNA with different concentrations is used as a test object for detection, and the result shows that the signal value detected by the probe has a better linear relation with the intestinal cancer cell total RNA concentration.

Preferably, the sample detected by the kit is feces, blood, intestinal polyp tissue or colorectal cancer tissue.

Preferably, the mRNA level of the ETV4 gene and/or the CDH3 gene is detected using a quantitative detection reagent capable of detecting mRNA of the ETV4 gene and/or the CDH3 gene, or using a probe as described above, or using a kit as described above.

According to the probe and other kit components provided by the invention, the working steps and principles of the probe and other kit components in specific detection are as follows:

obtaining total RNA containing ETV4 gene and/or CDH3 gene mRNA from a sample to be detected;

then adding the probe of the invention, combining a part of nucleotide sequence of the capture probe with a universal probe coupled with a carrier (magnetic beads, a cell culture plate or a 96-well microplate), and combining the other part of nucleotide sequence with mRNA of the ETV4 gene and/or the CDH3 gene; the blocking probe is combined with the mRNA partial sequence of ETV4 gene and/or CDH3 gene in a complementary mode.

After the probe sets are hybridized, an enzyme-labeled antibody and an enzyme fluorescent or chemiluminescent substrate are sequentially added. Finally, the enzyme-linked immunosorbent assay is used for detection, and the schematic diagram of the principle is shown in figure 1.

Specifically, the preparation and detection are as follows:

example 1: the kit for detecting/diagnosing colorectal cancer or intestinal polyp of the present invention

1. Probe needle

A capture probe and a blocking probe selected from the ETV4 gene and/or CDH3 gene of the invention; the probes are solubilized by treating with DEPC such that the final concentration of each probe is 20-50 fmole/. mu.L, preferably 30 fmole/. mu.L.

2. Kit matching components

And (3) a universal probe coupled with carriers such as magnetic beads, cell culture plates or 96-well microporous plates: shown as SEQ ID No. 106;

the 96-hole polystyrene microporous plate coated with the universal probe is provided by Tianjin Bei Cat technology, Inc.;

the specific antibody marked by horseradish oxidase is provided by Tianjin Bei Cat technology, Inc.;

the Amplex Red detection solution is provided by Tianjin Bei Cat technology Limited (Amplex Red is high-sensitivity and stable hydrogen peroxide detection

A reagent that is a fluorogenic substrate for horseradish oxidase);

DEPC treated water was purchased from Beijing Soilebao Tech Co., Ltd;

the 1XPBS buffer was purchased from Beijing Solaibao Tech Co., Ltd;

reaction solution: 100mM Tris-HCl,10mM EDTA,150mM Sodium citrate, 2% SDS, 40% formamide, 5% BSA,0.05mg/ml salmon sperm DNA; the balance is DEPC treated water; pH 7.4;

diluting liquid: 0.05

% Tween

20, 5% BSA in 1XPBS buffer (pH7.4).

Example 2: expression of ETV4 gene and/CDH 3 gene in rectal adenocarcinoma and colon cancer tissue

Entering a TCGA (https:// cancer. nih. gov /) database official website, downloading rectal adenocarcinoma and colon cancer option pages, selecting a clinical and RN As eq option, clicking an entry page to download a gene expression profile dataset and clinical information, including (1)92 cases of rectal adenocarcinoma tissues and 10 cases of paracancer normal tissues; (2)275 colon cancer tissues and 41 paracancerous normal tissues. And analyzing the expression levels of the ETV4 gene and/or the CDH3 gene in the tumor tissue and the para-carcinoma tissue through data extraction and processing, and drawing a box type graph. As shown in fig. 2A, the mRNA expression of ETV4 gene was significantly elevated in rectal adenocarcinoma tissue and colon cancer tissue compared to the respective paracancerous normal tissue; as shown in fig. 2B, the mRNA expression of the CDH3 gene was significantly elevated in rectal adenocarcinoma tissue and colon cancer tissue compared to the respective paracancerous normal tissue.

Example 3: the kit for detecting/diagnosing colorectal cancer or intestinal polyp detects the mRNA expression of the ETV4 gene and/or the CDH3 gene in intestinal cancer cells

1. Obtaining RNA of human intestinal cancer cells

Human intestinal cancer HT29 cell line and LOVO cell line were cultured in complete medium of high-glucose DMEM (containing 10% fetal bovine serum and 1% double antibody). When the confluency of the cells grown reached about 80%, the cell culture solution was discarded, the cells were rinsed with PBS, and a cell lysate of RNAioso Plus (purchased from TAKARA) was added to the dish and lysed on ice for 5 minutes. The lysed cells were scraped from the dish using a pipette gun and transferred to a 1.5mL enzyme-free centrifuge tube and centrifuged at 12000g for 5 minutes at 4 ℃. The supernatant was transferred to a new 1.5mL enzyme-free tube, 1/5 volumes of chloroform were added to the tube, the mixture was inverted and mixed 8-10 times, and then allowed to stand on ice for 5 minutes. Centrifuge at 12000g for 15min at 4 ℃. The liquid in the tube now divides into three layers: the upper layer is an aqueous phase and contains dissolved RNA; the middle is a protein phase; the lower layer is an organic phase. Carefully pipette the upper aqueous phase into a new enzyme-free tube. To the enzyme-free tube, an equal volume of isopropanol was added, mixed well, and left to stand at-20 ℃ for 30 minutes to precipitate RNA sufficiently. Centrifuge at 12000g for 10 min at 4 ℃. At this point, RNA precipitate appeared at the bottom of the centrifuge tube, the supernatant was discarded, 75% ethanol was added to the precipitate, the mixture was inverted upside down to wash the residual organic material, and then centrifuged at 12000g for 5 minutes at 4 ℃ to discard the supernatant. The washing was repeated once with 75% and the supernatant was discarded. The RNA precipitate was allowed to stand at room temperature for 5 minutes to completely volatilize ethanol, the RNA was dissolved in enzyme-free water, and the RNA concentration was measured with an ultraviolet spectrophotometer.

2. Preliminary reaction

If mRNA of the ETV4 gene is detected, a capture probe and a blocking probe of the ETV4 gene are used; if mRNA of the CDH3 gene is detected, a capture probe and a blocking probe of the CDH3 gene are used. Mixing the reaction solution, the RNA to be tested and a probe combination (probe of ETV4 gene or probe of CDH3 gene) in an enzyme-free tube:

blank control: 10 μ L of probe +20 μ L of treated Water with LDEPC +70 μ L of reaction solution

Test tube: 10. mu.L of probe + 20. mu.L of test RNA + 70. mu.L of reaction solution.

After mixing, the mixture was heated at 85 ℃ for 5 minutes and then placed on ice for 5 minutes.

3. Reaction of

The 96-well polystyrene microplate (supplied by tianjin bei maokou technologies) coated with the universal probe was taken out from the 4-degree refrigerator and rewarmed at normal temperature. And (3) respectively transferring 80 mu L of liquid in the blank control tube and the test tube in the step (2) to be added into the holes, tightly sealing the whole plate by using a sealing plate to stick paper, putting the plate into a thermostat at 65 ℃ for incubation, taking out the plate after 2 hours, discarding the liquid, washing the plate with 1XPBS for three times, and discarding the liquid at 200 mu L/hole every time.

4. Signal amplification

Diluting specific antibody with horseradish oxidase label by 500 times with diluent, mixing well, dripping into 96-well polystyrene microporous plate, incubating at 37 deg.C for 15min, discarding liquid, washing with 1XPBS for three times, 200 μ L/well each time, discarding liquid.

5. Signal detection

And adding the Amplex Red detection solution into a 96-hole polystyrene micropore plate, adding 200 mu L of the Amplex Red detection solution into each hole, carrying out fluorescence luminescence reaction on the Amplex Red and horseradish oxidase, reading fluorescence by using a microplate reader after 30 minutes, wherein the excitation wavelength is 530nm, and the emission wavelength is 590 nm.

6. Analysis of results

The results of the quantitative detection of ETV4 are shown in fig. 3A, and the results of the quantitative detection of CDH3 are shown in fig. 3B. The ETV4 or CDH3 detection signal obtained by the method has a linear relation with the concentration of RNA to be detected, the R value is greater than 0.98, and the mRNA of ETV4 or CDH3 can be detected from 0.2 mu g of intestinal cancer cell RNA at minimum.

Example 4: the kit for detecting/diagnosing colorectal cancer or intestinal polyp detects the mRNA expression of the ETV4 gene and/or the CDH3 gene in a stool sample

1. Sample collection

147 enteroscopy pathologically determined clinical samples were collected, including stool samples from 49 healthy intestinal patients, 49 patients with intestinal polyps, and 49 patients with colorectal cancer, and the basic information is shown in the following table.

2. RNA extraction

The RNA in feces was extracted using Qiagen RNeasy mini kit manufactured by QIAGEN. Putting 200mg of excrement in a test tube (if the excrement sample is liquid, 200 mu L of excrement is put in the test tube), adding 2mL of PBS, fully shaking and uniformly mixing, centrifuging for 5 minutes at 300g, and collecting supernatant; collecting supernatant 1mL, centrifuging at 12000rpm for 5min in a 1.5mL centrifuge tube, discarding supernatant, resuspending the precipitate with 1mL PBS, shaking, mixing, centrifuging at 12000rpm for 5min, and collecting precipitate. RNA was extracted according to the Qiagen RNeasy mini kit instructions and RNA concentration was measured using a UV spectrophotometer.

3. Detection of

Mixing the reaction solution, the probe and the fecal sample RNA in an enzyme-free tube: blank control wells: 10. mu.L of the probe, 20. mu.L of DEPC-treated water and 70. mu.L of the reaction solution; test wells: 10 μ L probe +20 μ L fecal sample RNA +70 μ L reaction. Heated at 85 ℃ for 5 minutes and placed on ice for 5 minutes. Transferring 80 μ L of the mixture from the enzyme-free tube to a 96-well polystyrene microporous plate (provided by Tianjin Bei Cat technology Co., Ltd.) coated with a universal probe, sealing the whole plate with a sealing plate paper, placing the plate in a thermostat at 65 ℃ for standing and incubating, taking out after 2 hours, discarding the liquid, washing with 1XPBS three times, and discarding the liquid at 200 μ L/well each time. Adding the specific antibody with the horseradish oxidase label into the diluent, diluting by 500 times, mixing uniformly, dripping into a 96-hole polystyrene microporous plate, incubating for 15in at 37 ℃, discarding liquid, washing for three times by 1XPBS (crosslinked polyethylene glycol succinate) with 200 muL/hole each time, and discarding liquid. And adding the Amplex Red detection solution into a 96-hole polystyrene micropore plate, adding 200 mu L of the Amplex Red detection solution into each hole, carrying out fluorescence luminescence reaction on the Amplex Red and horseradish oxidase, and reading fluorescence by using an enzyme-linked immunosorbent assay after 30 minutes, wherein the excitation wavelength is 530nm, and the emission wavelength is 590 nm.

4. Results

The fluorescence value of the fecal RNA samples in each test well was obtained by subtracting the fluorescence value of the blank control well from the fluorescence value of each test well and plotted using Graph Prism 8.0.1 software, with the results shown in FIGS. 4 and 5. FIG. 4A shows the fluorescence values of mRNA of ETV4 gene detected in stool samples of patients with intestinal polyps and healthy persons with intestinal polyps, which are significantly higher than those of healthy persons with intestinal polyps and are statistically different. FIG. 4B is a ROC curve of the ETV4 gene for detection of intestinal polyps. FIG. 4C shows the fluorescence values of mRNA of ETV4 gene detected in fecal samples of colorectal cancer patients and healthy intestinal people, and the fluorescence values of colorectal cancer patients are significantly higher than those of healthy intestinal people and are statistically different. FIG. 4D is a ROC curve of ETV4 gene for colorectal cancer. For intestinal polyps, ETV4 gene detection sensitivity was 95.96%, specificity was 87.76%, and the area under the subject curve was 0.8911. For colorectal cancer, ETV4 gene detection sensitivity was 92.84%, specificity was 93.88%, and subject area under the curve was 0.9875.

FIG. 5A shows the fluorescence values of mRNA of CDH3 gene detected in fecal samples of patients with intestinal polyps and healthy intestinal persons, which are significantly higher than those of healthy intestinal persons and statistically different. FIG. 5B is a ROC curve for CDH3 gene to detect intestinal polyps. FIG. 5C shows the fluorescence values of mRNA of CDH3 gene detected in fecal samples of colorectal cancer patients and healthy intestinal people, and the fluorescence values of colorectal cancer patients are significantly higher than those of healthy intestinal people and are statistically different. FIG. 5D is a ROC curve of CDH3 gene for colorectal cancer. For intestinal polyps, CDH3 gene detection sensitivity was 87.76%, specificity was 89.80%, and the area under the subject curve was 0.9525. For colorectal cancer, the CDH3 gene test sensitivity was 95.62%, the specificity was 97.96%, and the area under the subject curve was 0.9971.

The following sequences are all Artificial sequences (Artificial sequence)

SEQ ID No.(5’-3’)

1 GGCGATTTGCTGCTGAAGGTGTAGGGCTTTTTCTCTTGGAAAGAAAGT

2 AGCTTCCCCAGCGGGCCGATCAGTTTTTCTCTTGGAAAGAAAGT

3 GGCAGGGAGCCCGGGTCCATGTTTTTCTCTTGGAAAGAAAGT

4 GGGACTCTGGGGCTCCTTCTTGATCCTTTTTCTCTTGGAAAGAAAGT

5 GGGAGTGGCGGCTTCCTGCTGCTTTTTCTCTTGGAAAGAAAGT

6 TGGGGCTGGGAGGTGCCAGAGGATTTTTTCTCTTGGAAAGAAAGT

7 GGGCTGCTGGAAGACGGAGCTATGTTCTTTTTCTCTTGGAAAGAAAGT

8 CGCACCCGGTGACATCTGAGTCGTAGTTTTTCTCTTGGAAAGAAAGT

9 CCCGTCACCTGGAGAGGGCCCATTTTTCTCTTGGAAAGAAAGT

10 AATGAGCTTGAACTCCATTCCCCGGCCCTTTTTCTCTTGGAAAGAAAGT

11 TGGCCGGTTCTTCTGGATGCCCCAGTTTTTCTCTTGGAAAGAAAGT

12 AGGGCCTCGGGCTCACACACAAACTTGTTTTTCTCTTGGAAAGAAAGT

13 GGACTGTGTCCTCCTCACTGACAGGCTTTTTCTCTTGGAAAGAAAGT

14 GCCAGCCAGCTCTGGGAGGTAGGTTTTTCTCTTGGAAAGAAAGT

15 GGCTAGGGCAACTGGTAGGACAGTGGTTTTTCTCTTGGAAAGAAAGT

16 GGTGAAACCCCCAGGGGAGTTTCTGAGATTTTTCTCTTGGAAAGAAAGT

17 GCAGTGGGAGATCTGGGGAGCTCAGTTTTTCTCTTGGAAAGAAAGT

18 CCTCCAGGGCCACAGCGTGGGTTTTTCTCTTGGAAAGAAAGT

19 CAACCTCCGCCTGCCTCTGGGAACATTTTTCTCTTGGAAAGAAAGT

20 CCAGCACCCCTCATCCCAGGTTCCTTTTTCTCTTGGAAAGAAAGT

21 ACTTGCTGGTCCAAGTATCCGGCTTTCATCC

22 CTGGAAGAGATCTTCAGAGTCGAGGGGC

23 GAGCCACGTCTCCTGGAAGTGACTTAGATC

24 GTAAAGGCACTGCTCGCCATGGTGGTAG

25 CCTGAGATGTGAAGGAGTGGCAAATGTCCAG

26 GCGAAGTCCGTCTGTTCCTGTTTGATCACC

27 GAGAAGCCCTCTGTGTGGAGGTACATTGATG

28 CAGAGGTTTCTCATAGCCATAGCCCATGGC

29 GACAACGCAGACATCATCTGGGAATGGTCG

30 ATCCAGCAAGGCCACCAGAAATTGCCACAG

31 GTCCAGGCAATGAAATGGGCATTTGTTGGGTC

32 GAGCGGCTCAGCTTGTCGTAATTCATGGC

33 GCTGATTGTCCGGGAAGGCCAAAGAGAAG

34 CGGTCAAACTCAGCCTTGAGAGCTGGAC

35 CGGGGCTCTCATCCAAGTGGGACAAAG

36 GGATCTGCCCCAGAGACATCTGTGGG

37 AATGACTCCGGTGAGCAGCTCAGAGTCTG

38 GCTGAGCTGAATTCCTCCAGGGCCCA

39 GTGTGGGGGGCTTGGACCTAGGAAGAA

40 AAGTTGGGAAGCGCCTTCTCTGTCCCC

41 TGAACCTCCTCACCCTCCTGCCAGTATG

42 CAGAGCACCAAGAACTGACAAACCGGGAC

43 GAGCAGGAACCCATCCCTCTCTGCTTATAC

44 AAGGGCAGAAGAAAGGCAAAGGGTCCCTTG

45 ATTAAGGTCTGGCAGATGTGGTGGAGGTGG

46 CTGAATGGAAATCAGGAACAAACTGCTCATCACTGTCTGGTACCTGAGCT

47 AAGGGCACCAGGGGCAGGGGACTTGATGGCGATTTGTCTGGGGGGGTC

48 CAGGGCTCCGACAGCTGGTGTTGGTAGGGGGCTGGGAGGGGTTCCCGGCC

49 ATGGTATTCTTGCTTAAAGCTCTGCTGGGGATAGGGTGGG

50 ACCCCACCCTGGTCCACGGCTGGCTGGCCCGCCTGTTCATACAGGGGATC

51 GGAGGCCGCGCACTGCAGCCATTTTTCTCTTGGAAAGAAAGT

52 GCTCCTGCTCCGCGCCTCCCTTTTTCTCTTGGAAAGAAAGT

53 TCGGTCACGATGATGGAGATGTTCATGGGGTTTTTTCTCTTGGAAAGAAAGT

54 GCGTGGCCAAAGAGCTCATACTTGGCAATCTTTTTTCTCTTGGAAAGAAAGT

55 CCTCTAAGACACTCCCTCGGAAGGTGTCTTTTTCTCTTGGAAAGAAAGT

56 TAGATGGCATCATCCTCATCCGTGGCTGTCTTTTTCTCTTGGAAAGAAAGT

57 CCTGTGCTCCGGTGAATGGTGAACATGAGTTTTTCTCTTGGAAAGAAAGT

58 CCATCCATGTCTGTGGCCTGGATGGTCATTTTTCTCTTGGAAAGAAAGT

59 GTAAAATGGTCCCCGTCGTCACCGCCTTTTTCTCTTGGAAAGAAAGT

60 CAAACCCTTCCTGGTTGTCAGGATGCCCTTTTTCTCTTGGAAAGAAAGT

61 GTGGCTGTGGAGGTTGGGAGCTTCAGTTTTTCTCTTGGAAAGAAAGT

62 TGATGTTCAGCACCTGGCGCACAGGGTTTTTCTCTTGGAAAGAAAGT

63 CTCTGCCGTCCAGTAGATGTCTGAGTCATCTTTTTCTCTTGGAAAGAAAGT

64 GGGCTCCTTGATCTTCCGCTTCTTTCTCACTTTTTCTCTTGGAAAGAAAGT

65 TGATGTCATAGTCCTGGTCCTCTTCGCCACTTTTTCTCTTGGAAAGAAAGT

66 GGAGAACCACCTCCGGCCTGGCTTTTTCTCTTGGAAAGAAAGT

67 GCCTAGTCGTCCTCCCCGCCACTTTTTCTCTTGGAAAGAAAGT

68 GAGATGCTCTGTGGCCTGACGTTTGGTCTTTTTCTCTTGGAAAGAAAGT

69 GCAAACCTGGAGAAGGAGGAGAGACGCTTTTTCTCTTGGAAAGAAAGT

70 GAAGACCGCCCGGCACGGCTCTTTTTCTCTTGGAAAGAAAGT

71 GGCCACTGGAGATGACGCTGATGGTG

72 CATTGGCATCAAGGATCTCCACTACTGCCAC

73 CACAAAAGGGGCCTCGTTGGTCACTTCAAC

74 CTCATTCACATCCTCCACGTGGACCACTATG

75 CAACAAAAGCAGCACCAGCAGGAGGAACAG

76 AGCTGAAGGGGGAACTGAGACCCCTTG

77 CTGCTGGGTCTCTCAGGATGCGGTAGCTGA

78 CACCACTGGCACGGGAACCCTTCTGCTAAC

79 ACGTCATATGTATCCTGCTTCAGGAACTTC

80 TTGTTGCCATGGTCAGACAGAGAAAGGTGC

81 ACAGTGGCCCTGATCACCGTCAGCTGCTCT

82 CAGGTTTCGACATGGCCATGGCAGTCGCAC

83 AGGATGAAACCTCCCTTCCAGGGTCCAGGG

84 GAGCCGCTGCCCTCATAGTCGAACACCAAG

85 GAGGTGAGGGAGCTCAGGGACGCGGCGTCG

86 TGCCCACATTCCTCCATCCTGAAAGGCTAA

87 GGTCAGTCACAGCAGGCCCAGGCCCAGGAC

88 GGTTCCATTCCAGAGAGAAAGTCCACTGTA

89 CAGAAATGCAGGACGGCCAGTGGGCCCAGC

90 TCCGAATGGGAGGCATTGGGGTCTGGAAAC

91 TGAATGGTATGGTATGTGAGTTAGATGCCA

92 TTGGGTGAAGCCAGCAGGGTAAACAGAGCC

93 CCCTGAGCCCACTTAGGCATGGAAGCTGAC

94 GGGCTGTGGAGGGGCTCAGCCTTGGGGTAA

95 GCAGCCGCTGTTCCAGAAGAGACCTTGCTG

96 GAAGTCGTCACACACTGTCCTGCAGGGAGG

97 TTCAACAGGGACCCCTCCAGCATAGAAGAG

98 GCCTGGGCGACAGAACGAGACTCCGTCTCA

99 AGTGAGCCAAGATCACACCACTGCACTCCA

100 AATGGCGTGAACCCAGGAGGCAGAGCTTGC

101 ATCCTGGCTAACACAGTGAAACCCCGTCTC

102 GGGCGGATCACGAGGTCAGGAGATCGAGAC

103 TGTAATCCTAGCACTTTGGGAGGCCGACGT

104 GTGCCAGCGCTGGGCGCGGTGGCTCAAGCC

105 GGTAGCTGTTACCAACTAACAGATTGCATGGACCATGTGC

106 ACTTTCTTTCCAAGAG

Although the embodiments of the present invention have been disclosed for illustrative purposes, those skilled in the art will appreciate that: various substitutions, changes and modifications are possible without departing from the spirit and scope of the invention and the appended claims, and therefore the scope of the invention is not limited to the embodiments disclosed.

Sequence listing

<110> Guizhou Baijing Biotechnology Co., Ltd

<120> colorectal cancer and/or intestinal polyp diagnosis marker, kit, method and application

<160> 106

<170> SIPOSequenceListing 1.0

<210> 1

<211> 48

<212> DNA/RNA

<213> capture Probe sequence 1 of ETV4 Gene (Unknown)

<400> 1

ggcgatttgc tgctgaaggt gtagggcttt ttctcttgga aagaaagt 48

<210> 2

<211> 44

<212> DNA/RNA

<213> capture Probe sequence 2 of ETV4 Gene (Unknown)

<400> 2

agcttcccca gcgggccgat cagtttttct cttggaaaga aagt 44

<210> 3

<211> 42

<212> DNA/RNA

<213> capture Probe sequence 3 of ETV4 Gene (Unknown)

<400> 3

ggcagggagc ccgggtccat gtttttctct tggaaagaaa gt 42

<210> 4

<211> 47

<212> DNA/RNA

<213> capture Probe sequence 4 of ETV4 Gene (Unknown)

<400> 4

gggactctgg ggctccttct tgatcctttt tctcttggaa agaaagt 47

<210> 5

<211> 43

<212> DNA/RNA

<213> capture Probe sequence 5(Unknown) of ETV4 Gene

<400> 5

gggagtggcg gcttcctgct gctttttctc ttggaaagaa agt 43

<210> 6

<211> 45

<212> DNA/RNA

<213> Capture Probe sequence 6 of ETV4 Gene (Unknown)

<400> 6

tggggctggg aggtgccaga ggattttttc tcttggaaag aaagt 45

<210> 7

<211> 48

<212> DNA/RNA

<213> capture Probe sequence 7(Unknown) of ETV4 Gene

<400> 7

gggctgctgg aagacggagc tatgttcttt ttctcttgga aagaaagt 48

<210> 8

<211> 47

<212> DNA/RNA

<213> capture Probe sequence 8(Unknown) of ETV4 Gene

<400> 8

cgcacccggt gacatctgag tcgtagtttt tctcttggaa agaaagt 47

<210> 9

<211> 43

<212> DNA/RNA

<213> capture Probe sequence 9(Unknown) of ETV4 Gene

<400> 9

cccgtcacct ggagagggcc catttttctc ttggaaagaa agt 43

<210> 10

<211> 49

<212> DNA/RNA

<213> capture Probe sequence 10(Unknown) of ETV4 Gene

<400> 10

aatgagcttg aactccattc cccggccctt tttctcttgg aaagaaagt 49

<210> 11

<211> 46

<212> DNA/RNA

<213> capture Probe sequence 11(Unknown) of ETV4 Gene

<400> 11

tggccggttc ttctggatgc cccagttttt ctcttggaaa gaaagt 46

<210> 12

<211> 48

<212> DNA/RNA

<213> capture Probe sequence 12(Unknown) of ETV4 Gene

<400> 12

agggcctcgg gctcacacac aaacttgttt ttctcttgga aagaaagt 48

<210> 13

<211> 47

<212> DNA/RNA

<213> Capture Probe sequence 13 of ETV4 Gene (Unknown)

<400> 13

ggactgtgtc ctcctcactg acaggctttt tctcttggaa agaaagt 47

<210> 14

<211> 44

<212> DNA/RNA

<213> capture Probe sequence 14(Unknown) of ETV4 Gene

<400> 14

gccagccagc tctgggaggt aggtttttct cttggaaaga aagt 44

<210> 15

<211> 47

<212> DNA/RNA

<213> capture Probe sequence 15(Unknown) of ETV4 Gene

<400> 15

ggctagggca actggtagga cagtggtttt tctcttggaa agaaagt 47

<210> 16

<211> 49

<212> DNA/RNA

<213> Capture Probe sequence 16(Unknown) of ETV4 Gene

<400> 16

ggtgaaaccc ccaggggagt ttctgagatt tttctcttgg aaagaaagt 49

<210> 17

<211> 46

<212> DNA/RNA

<213> capture Probe sequence 17(Unknown) of ETV4 Gene

<400> 17

gcagtgggag atctggggag ctcagttttt ctcttggaaa gaaagt 46

<210> 18

<211> 42

<212> DNA/RNA

<213> capture Probe sequence 18(Unknown) of ETV4 Gene

<400> 18

cctccagggc cacagcgtgg gtttttctct tggaaagaaa gt 42

<210> 19

<211> 46

<212> DNA/RNA

<213> capture Probe sequence 19(Unknown) of ETV4 Gene

<400> 19

caacctccgc ctgcctctgg gaacattttt ctcttggaaa gaaagt 46

<210> 20

<211> 45

<212> DNA/RNA

<213> capture Probe sequence 20(Unknown) of ETV4 Gene

<400> 20

ccagcacccc tcatcccagg ttcctttttc tcttggaaag aaagt 45

<210> 21

<211> 31

<212> DNA/RNA

<213> blocking Probe sequence 1 of ETV4 Gene (Unknown)

<400> 21

acttgctggt ccaagtatcc ggctttcatc c 31

<210> 22

<211> 28

<212> DNA/RNA

<213> blocking Probe sequence 2 of ETV4 Gene (Unknown)

<400> 22

ctggaagaga tcttcagagt cgaggggc 28

<210> 23

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 3 of ETV4 Gene (Unknown)

<400> 23

gagccacgtc tcctggaagt gacttagatc 30

<210> 24

<211> 28

<212> DNA/RNA

<213> blocking Probe sequence 4 of ETV4 Gene (Unknown)

<400> 24

gtaaaggcac tgctcgccat ggtggtag 28

<210> 25

<211> 31

<212> DNA/RNA

<213> blocking Probe sequence 5(Unknown) of ETV4 Gene

<400> 25

cctgagatgt gaaggagtgg caaatgtcca g 31

<210> 26

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 6(Unknown) of ETV4 Gene

<400> 26

gcgaagtccg tctgttcctg tttgatcacc 30

<210> 27

<211> 31

<212> DNA/RNA

<213> blocking Probe sequence 7(Unknown) of ETV4 Gene

<400> 27

gagaagccct ctgtgtggag gtacattgat g 31

<210> 28

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 8(Unknown) of ETV4 Gene

<400> 28

cagaggtttc tcatagccat agcccatggc 30

<210> 29

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 9(Unknown) of ETV4 Gene

<400> 29

gacaacgcag acatcatctg ggaatggtcg 30

<210> 30

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 10(Unknown) of ETV4 Gene

<400> 30

atccagcaag gccaccagaa attgccacag 30

<210> 31

<211> 32

<212> DNA/RNA

<213> blocking Probe sequence 11(Unknown) of ETV4 Gene

<400> 31

gtccaggcaa tgaaatgggc atttgttggg tc 32

<210> 32

<211> 29

<212> DNA/RNA

<213> blocking Probe sequence 12(Unknown) of ETV4 Gene

<400> 32

gagcggctca gcttgtcgta attcatggc 29

<210> 33

<211> 29

<212> DNA/RNA

<213> blocking Probe sequence 13 of ETV4 Gene (Unknown)

<400> 33

gctgattgtc cgggaaggcc aaagagaag 29

<210> 34

<211> 28

<212> DNA/RNA

<213> blocking Probe sequence 14(Unknown) of ETV4 Gene

<400> 34

cggtcaaact cagccttgag agctggac 28

<210> 35

<211> 27

<212> DNA/RNA

<213> blocking Probe sequence 15(Unknown) of ETV4 Gene

<400> 35

cggggctctc atccaagtgg gacaaag 27

<210> 36

<211> 26

<212> DNA/RNA

<213> blocking Probe sequence 16(Unknown) of ETV4 Gene

<400> 36

ggatctgccc cagagacatc tgtggg 26

<210> 37

<211> 29

<212> DNA/RNA

<213> blocking Probe sequence 17(Unknown) of ETV4 Gene

<400> 37

aatgactccg gtgagcagct cagagtctg 29

<210> 38

<211> 26

<212> DNA/RNA

<213> blocking Probe sequence 18(Unknown) of ETV4 Gene

<400> 38

gctgagctga attcctccag ggccca 26

<210> 39

<211> 27

<212> DNA/RNA

<213> blocking Probe sequence 19(Unknown) of ETV4 Gene

<400> 39

gtgtgggggg cttggaccta ggaagaa 27

<210> 40

<211> 27

<212> DNA/RNA

<213> blocking Probe sequence 20(Unknown) of ETV4 Gene

<400> 40

aagttgggaa gcgccttctc tgtcccc 27

<210> 41

<211> 28

<212> DNA/RNA

<213> blocking Probe sequence 21 of ETV4 Gene (Unknown)

<400> 41

tgaacctcct caccctcctg ccagtatg 28

<210> 42

<211> 29

<212> DNA/RNA

<213> blocking Probe sequence 22(Unknown) of ETV4 Gene

<400> 42

cagagcacca agaactgaca aaccgggac 29

<210> 43

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 23 of ETV4 Gene (Unknown)

<400> 43

gagcaggaac ccatccctct ctgcttatac 30

<210> 44

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 24(Unknown) of ETV4 Gene

<400> 44

aagggcagaa gaaaggcaaa gggtcccttg 30

<210> 45

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 25 of ETV4 Gene (Unknown)

<400> 45

attaaggtct ggcagatgtg gtggaggtgg 30

<210> 46

<211> 50

<212> DNA/RNA

<213> blocking Probe sequence 26(Unknown) of ETV4 Gene

<400> 46

ctgaatggaa atcaggaaca aactgctcat cactgtctgg tacctgagct 50

<210> 47

<211> 48

<212> DNA/RNA

<213> blocking Probe sequence 27(Unknown) of ETV4 Gene

<400> 47

aagggcacca ggggcagggg acttgatggc gatttgtctg ggggggtc 48

<210> 48

<211> 50

<212> DNA/RNA

<213> blocking Probe sequence 28(Unknown) of ETV4 Gene

<400> 48

cagggctccg acagctggtg ttggtagggg gctgggaggg gttcccggcc 50

<210> 49

<211> 40

<212> DNA/RNA

<213> blocking Probe sequence 29(Unknown) of ETV4 Gene

<400> 49

atggtattct tgcttaaagc tctgctgggg atagggtggg 40

<210> 50

<211> 50

<212> DNA/RNA

<213> blocking Probe sequence 30(Unknown) of ETV4 Gene

<400> 50

accccaccct ggtccacggc tggctggccc gcctgttcat acaggggatc 50

<210> 51

<211> 42

<212> DNA/RNA

<213> capture Probe sequence 1(Unknown) of CDH3 Gene

<400> 51

ggaggccgcg cactgcagcc atttttctct tggaaagaaa gt 42

<210> 52

<211> 41

<212> DNA/RNA

<213> capture Probe sequence 2(Unknown) of CDH3 Gene

<400> 52

gctcctgctc cgcgcctccc tttttctctt ggaaagaaag t 41

<210> 53

<211> 52

<212> DNA/RNA

<213> capture Probe sequence 3(Unknown) of CDH3 Gene

<400> 53

tcggtcacga tgatggagat gttcatgggg ttttttctct tggaaagaaa gt 52

<210> 54

<211> 52

<212> DNA/RNA

<213> capture Probe sequence 4(Unknown) of CDH3 Gene

<400> 54

gcgtggccaa agagctcata cttggcaatc ttttttctct tggaaagaaa gt 52

<210> 55

<211> 49

<212> DNA/RNA

<213> capture Probe sequence 5(Unknown) of CDH3 Gene

<400> 55

cctctaagac actccctcgg aaggtgtctt tttctcttgg aaagaaagt 49

<210> 56

<211> 51

<212> DNA/RNA

<213> capture Probe sequence 6(Unknown) of CDH3 Gene

<400> 56

tagatggcat catcctcatc cgtggctgtc tttttctctt ggaaagaaag t 51

<210> 57

<211> 50

<212> DNA/RNA

<213> capture Probe sequence 7(Unknown) of CDH3 Gene

<400> 57

cctgtgctcc ggtgaatggt gaacatgagt ttttctcttg gaaagaaagt 50

<210> 58

<211> 49

<212> DNA/RNA

<213> capture Probe sequence 8(Unknown) of CDH3 Gene

<400> 58

ccatccatgt ctgtggcctg gatggtcatt tttctcttgg aaagaaagt 49

<210> 59

<211> 47

<212> DNA/RNA

<213> capture Probe sequence 9(Unknown) of CDH3 Gene

<400> 59

gtaaaatggt ccccgtcgtc accgcctttt tctcttggaa agaaagt 47

<210> 60

<211> 49

<212> DNA/RNA

<213> capture Probe sequence 10(Unknown) of CDH3 Gene

<400> 60

caaacccttc ctggttgtca ggatgccctt tttctcttgg aaagaaagt 49

<210> 61

<211> 47

<212> DNA/RNA

<213> capture Probe sequence 11(Unknown) of CDH3 Gene

<400> 61

gtggctgtgg aggttgggag cttcagtttt tctcttggaa agaaagt 47

<210> 62

<211> 47

<212> DNA/RNA

<213> capture Probe sequence 12(Unknown) of CDH3 Gene

<400> 62

tgatgttcag cacctggcgc acagggtttt tctcttggaa agaaagt 47

<210> 63

<211> 51

<212> DNA/RNA

<213> capture Probe sequence 13(Unknown) of CDH3 Gene

<400> 63

ctctgccgtc cagtagatgt ctgagtcatc tttttctctt ggaaagaaag t 51

<210> 64

<211> 51

<212> DNA/RNA

<213> capture Probe sequence 14(Unknown) of CDH3 Gene

<400> 64

gggctccttg atcttccgct tctttctcac tttttctctt ggaaagaaag t 51

<210> 65

<211> 51

<212> DNA/RNA

<213> capture Probe sequence 15(Unknown) of CDH3 Gene

<400> 65

tgatgtcata gtcctggtcc tcttcgccac tttttctctt ggaaagaaag t 51

<210> 66

<211> 43

<212> DNA/RNA

<213> capture Probe sequence 16(Unknown) of CDH3 Gene

<400> 66

ggagaaccac ctccggcctg gctttttctc ttggaaagaa agt 43

<210> 67

<211> 43

<212> DNA/RNA

<213> capture Probe sequence 17(Unknown) of CDH3 Gene

<400> 67

gcctagtcgt cctccccgcc actttttctc ttggaaagaa agt 43

<210> 68

<211> 49

<212> DNA/RNA

<213> capture Probe sequence 18(Unknown) of CDH3 Gene

<400> 68

gagatgctct gtggcctgac gtttggtctt tttctcttgg aaagaaagt 49

<210> 69

<211> 48

<212> DNA/RNA

<213> capture Probe sequence 19(Unknown) of CDH3 Gene

<400> 69

gcaaacctgg agaaggagga gagacgcttt ttctcttgga aagaaagt 48

<210> 70

<211> 42

<212> DNA/RNA

<213> capture Probe sequence 20(Unknown) of CDH3 Gene

<400> 70

gaagaccgcc cggcacggct ctttttctct tggaaagaaa gt 42

<210> 71

<211> 26

<212> DNA/RNA

<213> blocking Probe sequence 1 of CDH3 Gene (Unknown)

<400> 71

ggccactgga gatgacgctg atggtg 26

<210> 72

<211> 31

<212> DNA/RNA

<213> blocking Probe sequence 2 of CDH3 Gene (Unknown)

<400> 72

cattggcatc aaggatctcc actactgcca c 31

<210> 73

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 3(Unknown) of CDH3 Gene

<400> 73

cacaaaaggg gcctcgttgg tcacttcaac 30

<210> 74

<211> 31

<212> DNA/RNA

<213> blocking Probe sequence 4(Unknown) of CDH3 Gene

<400> 74

ctcattcaca tcctccacgt ggaccactat g 31

<210> 75

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 5(Unknown) of CDH3 Gene

<400> 75

caacaaaagc agcaccagca ggaggaacag 30

<210> 76

<211> 27

<212> DNA/RNA

<213> blocking Probe sequence 6(Unknown) of CDH3 Gene

<400> 76

agctgaaggg ggaactgaga ccccttg 27

<210> 77

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 7(Unknown) of CDH3 Gene

<400> 77

ctgctgggtc tctcaggatg cggtagctga 30

<210> 78

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 8(Unknown) of CDH3 Gene

<400> 78

caccactggc acgggaaccc ttctgctaac 30

<210> 79

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 9(Unknown) of CDH3 Gene

<400> 79

acgtcatatg tatcctgctt caggaacttc 30

<210> 80

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 10(Unknown) of CDH3 Gene

<400> 80

ttgttgccat ggtcagacag agaaaggtgc 30

<210> 81

<211> 30

<212> DNA/RNA

<213> blocked Probe sequence 11(Unknown) of CDH3 Gene

<400> 81

acagtggccc tgatcaccgt cagctgctct 30

<210> 82

<211> 30

<212> DNA/RNA

<213> blocked Probe sequence 12(Unknown) of CDH3 Gene

<400> 82

caggtttcga catggccatg gcagtcgcac 30

<210> 83

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 13 of CDH3 Gene (Unknown)

<400> 83

aggatgaaac ctcccttcca gggtccaggg 30

<210> 84

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 14(Unknown) of CDH3 Gene

<400> 84

gagccgctgc cctcatagtc gaacaccaag 30

<210> 85

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 15(Unknown) of CDH3 Gene

<400> 85

gaggtgaggg agctcaggga cgcggcgtcg 30

<210> 86

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 16(Unknown) of CDH3 Gene

<400> 86

tgcccacatt cctccatcct gaaaggctaa 30

<210> 87

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 17(Unknown) of CDH3 Gene

<400> 87

ggtcagtcac agcaggccca ggcccaggac 30

<210> 88

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 18(Unknown) of CDH3 Gene

<400> 88

ggttccattc cagagagaaa gtccactgta 30

<210> 89

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 19(Unknown) of CDH3 Gene

<400> 89

cagaaatgca ggacggccag tgggcccagc 30

<210> 90

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 20(Unknown) of CDH3 Gene

<400> 90

tccgaatggg aggcattggg gtctggaaac 30

<210> 91

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 21 of CDH3 Gene (Unknown)

<400> 91

tgaatggtat ggtatgtgag ttagatgcca 30

<210> 92

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 22(Unknown) of CDH3 Gene

<400> 92

ttgggtgaag ccagcagggt aaacagagcc 30

<210> 93

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 23 of CDH3 Gene (Unknown)

<400> 93

ccctgagccc acttaggcat ggaagctgac 30

<210> 94

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 24(Unknown) of CDH3 Gene

<400> 94

gggctgtgga ggggctcagc cttggggtaa 30

<210> 95

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 25(Unknown) of CDH3 Gene

<400> 95

gcagccgctg ttccagaaga gaccttgctg 30

<210> 96

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 26(Unknown) of CDH3 Gene

<400> 96

gaagtcgtca cacactgtcc tgcagggagg 30

<210> 97

<211> 30

<212> DNA/RNA

<213> blocked Probe sequence 27(Unknown) of CDH3 Gene

<400> 97

ttcaacaggg acccctccag catagaagag 30

<210> 98

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 28(Unknown) of CDH3 Gene

<400> 98

gcctgggcga cagaacgaga ctccgtctca 30

<210> 99

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 29(Unknown) of CDH3 Gene

<400> 99

agtgagccaa gatcacacca ctgcactcca 30

<210> 100

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 30(Unknown) of CDH3 Gene

<400> 100

aatggcgtga acccaggagg cagagcttgc 30

<210> 101

<211> 30

<212> DNA/RNA

<213> blocked Probe sequence 31(Unknown) of CDH3 Gene

<400> 101

atcctggcta acacagtgaa accccgtctc 30

<210> 102

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 32(Unknown) of CDH3 Gene

<400> 102

gggcggatca cgaggtcagg agatcgagac 30

<210> 103

<211> 30

<212> DNA/RNA

<213> blocked Probe sequence 33(Unknown) of CDH3 Gene

<400> 103

tgtaatccta gcactttggg aggccgacgt 30

<210> 104

<211> 30

<212> DNA/RNA

<213> blocking Probe sequence 34(Unknown) of CDH3 Gene

<400> 104

gtgccagcgc tgggcgcggt ggctcaagcc 30

<210> 105

<211> 40

<212> DNA/RNA

<213> blocking Probe sequence 35(Unknown) of CDH3 Gene

<400> 105

ggtagctgtt accaactaac agattgcatg gaccatgtgc 40

<210> 106

<211> 16

<212> DNA/RNA

<213> general purpose Probe (Unknown)

<400> 106

actttctttc caagag 16

Claims

Use of the ETV4 gene and/or the CDH3 gene as/for the preparation of a marker for colorectal cancer and/or intestinal polyps.
2. Use according to claim 1, characterized in that: the detection sample applied is feces, blood, intestinal polyp tissue or colorectal cancer tissue.
3. Use of a biomarker for the diagnosis of colorectal cancer or intestinal polyps for the manufacture of a product for the diagnosis of colorectal cancer or intestinal polyps, wherein the biomarker for the diagnosis of colorectal cancer or intestinal polyps is the ETV4 gene and/or the CDH3 gene.
4. Use according to claim 3, characterized in that: the biomarkers are capable of diagnosing the occurrence of colorectal cancer or intestinal polyps;

alternatively, the test sample for use is stool, blood, intestinal polyp tissue, or colorectal cancer tissue.
Use of a quantitative detection reagent for ETV4 gene and/or CDH3 gene in the preparation of a kit for diagnosing colorectal cancer or intestinal polyps, wherein the quantitative detection reagent is capable of detecting mRNA of ETV4 gene and/or CDH3 gene.
6. Use according to claim 5, characterized in that: the detection sample of the quantitative detection reagent is feces, blood, intestinal polyp tissue or colorectal cancer tissue;

alternatively, the quantitative detection reagent can be used to perform any of the following methods:

real-time fluorescent quantitative PCR, digital PCR, Northern blotting denaturing gradient gel electrophoresis, nucleic acid chip detection, denaturing high performance liquid chromatography, in situ hybridization, biological mass spectrometry, high-throughput RNA sequencing technology, a second generation hybridization capture technology based on antibody capture of Qiagen company, Siemens bDNA technology and QuantiMAT capture hybridization target branched chain DNA signal amplification technology.
7. A probe for detecting/diagnosing colorectal cancer or intestinal polyps, characterized in that: the probe comprises a probe for quantitatively detecting the mRNA expression level of the ETV4 gene and/or the CDH3 gene.
8. The probe of claim 7, wherein: the probe consists of a capture probe and a closed probe; the capture probe sequence of the ETV4 gene is shown as SEQ ID No.1-20, and the blocking probe sequence of the ETV4 gene is shown as SEQ ID No. 21-50; the capture probe sequence of the CDH3 gene is shown as SEQ ID No.51-70, and the blocking probe sequence of the CDH3 gene is shown as SEQ ID No. 71-105;

or, the probe is any one of the nucleotide sequences shown as follows:

(I) a nucleotide sequence as shown in any one of SEQ ID No.1 to 105;

(II) a nucleotide sequence which is obtained by substituting, deleting or adding one or more bases in the nucleotide sequence shown in (I) and has the same or similar functions with the nucleotide sequence shown in (I);

(III) a nucleotide sequence with at least 80% identity to the nucleotide sequence shown in (I);

(IV) the sequence complementary to the sequence shown in (I), (II) or (III).
9. A kit for detecting/diagnosing colorectal cancer or intestinal polyps comprising the probe according to claim 7 or 8.
10. The kit of claim 9, wherein: the kit also comprises one or more than two of an enzyme-labeled specific antibody, an enzyme substrate and a carrier coupled with a universal probe;

wherein the universal probe is complementary paired with a partial sequence of the capture probe of claim 9 or 10;

the enzyme is alkaline phosphatase or horseradish oxidase;

the enzyme substrate is a chemiluminescent or fluorescent substrate;

the carrier is a magnetic bead or a cell culture plate or a microporous plate;

or the universal probe is a nucleotide sequence shown as SEQ ID No. 106;

or the sample detected by the kit is feces, blood, intestinal polyp tissue or colorectal cancer tissue.
11. A method of detecting colorectal cancer or intestinal polyps, comprising: the method distinguishes between a sample of gut health and a sample of colorectal cancer or intestinal polyp by detecting the mRNA levels of the ETV4 gene and/or the CDH3 gene.
12. The detection method according to claim 11, characterized in that: the mRNA level of ETV4 gene and/or CDH3 gene is detected using a quantitative detection reagent capable of detecting mRNA of ETV4 gene and/or CDH3 gene, or using the probe of claim 7 or 8, or using the kit of claim 9 or 10.