CN101065393A - Drug screening and molecular diagnostic test for early detection of colorectal cancer: reagents, methods, and kits thereof - Google Patents

Abstract

A novel approach to the early detection of colorectal cancer (''CRC''), using a molecular diagnostic test to evaluate grossly normal-appearing colonic tissue for the early detection of colorectal cancer is disclosed. Such grossly normal-appearing colonic mucosal cells may be collected from non-invasive or minimally invasive procedures. The use of novel biomarker panels for drug screening also is disclosed. Such biomaker panels may be used wholly or in part as surrogate endpoints for monitoring effectiveness of a prospective drug in the intervention of pathologies, such as cancers, for example CRC, lung, prostate, and breast, and neurodegenerative diseases, for example Alzheimer's and ALS.

Description

Drug screening and molecular diagnosis detection for colorectal cancer early detection: reagent, method and its kit

Priority claim

U.S. Provisional Patent Application No. 60/614,746, entitled MOLECULARDIAGNOSTIC TEST FOR EARLY DETECTION OF COLORECTALCANCER:REAGENTS, METHODS, AND KITS THEREOF, by Nancy M.Lee, wait in submission (Attorney Docket No.NLEE-01001US0) on September 30th, 2004；

U.S. Provisional Patent Application No. 60/651,344, entitled METHODS OF USE OF ABIOMARKER PANEL FOR DRUG SCREENING waits in submission (Attorney Docket No.NLEE-01002US0) on 2 8th, 2005 by Nancy M.Lee；With

U.S. Patent Application No. 1/_, _, entitled DRUG SCREENING ANDMOLECULAR DIAGNOSTIC TEST FOR EARLY DETECTION OFCOLORECTAL CANCER:REAGENTS, METHODS, AND KITSTHEREOF, by Nancy M.Lee, wait in submission (Attorney DocketNo.NLEE-01001US1) on September 29th, 2005.

The cross reference of related application

The application is related to the PCT/US2004/022594 of entitled " Biomarker Panel for Colorectal Cancer " submitted on July 14th, 2004 is equal to by Nancy M.Lee, it requires the U.S. Provisional Application No. 60/488 for being equal to entitled " the MolecularBiomarker Panel for Determination of Colorectal Cancer " that submits on July 18th, 2003 by Nancy M.Lee, the priority of 660 (Attorney Docket No.CPMC-01000US0), and also require by N Ancy M.Lee is equal to the U.S. Patent Application No. 10/690 of entitled " the Biomarker Panel forColorectal Cancer " that submits on October 22nd, 2003, the priority of 880 (Attorney Docket No.CPMC-01000US1), each application is by reference to being fully incorporated in this.

Nucleotide and/or amino acid sequence list are in the form of computer-readable and hard copy (hard-copy) includes in this application.The information for including with computer-reader form is by reference to being fully incorporated in this.The information of computer-reader form is also included on disk, and the such information submitted on disk is by reference to being fully incorporated in this.No. 1 compress disk includes following files: NLEE1001WO0.ST25.txt (9/30/2005 generates, 96K).The disk sum of submission is 1.

Background

The technical field of present disclosure is related to reagent, method and kit for colorectal cancer (" CRC ") early detection, with for screening the method for treating effective drug to pathology such as cancer and neurodegenerative disease, the cancer such as CRC, lung cancer, prostate cancer and breast cancer, the neurodegenerative disease such as Alzheimer disease and ALS.These reagents, method and kit be based on one group of biomarker, the biomarker effective for the assessment of risks of CRC and other such pathology, early detection, establish prognosis, interference assessment, recurrence, and about treatment interference drug invention.

In medical domain, begin to seek the clinical method for CRC assessment of risks and early detection for a long time.Currently, CRC is the second main cause in western countries in the relevant death of cancer-.It is exactly that early detection is the key that increase survival rate by the piece image of more than ten years clearly shown about the research of CRC.

Therefore, a kind of approach of long-sought of CRC early detection is had become for effectively carrying out CRC early detection and being therefore efficiently used for seeking for the biomarker that CRC is treated.Since having found carcinomebryonic antigen (" CEA "), seek continue for more than 40 years for the biomarker effective for CRC early detection.It is advantageous also in the sampling method for early diagnosing detection use in conjunction with CRC as minimally-invasive property or Noninvasive.Noninvasive and the sampling method of minimally-invasive property increase the compliance of patient, and generally reduce cost.In addition, generating reliable diagnostic assessment based on such data setting, and ideal for analyzing typical complicated, multivariate data the bioinformatics method of bioanalysis.

Treatment interference for many types of cancer such as CRC, lung cancer, prostate cancer and breast cancer, including operation, chemotherapy and radiotherapy and their combination.For CRC, other than finding the noninvasive method of early detection, continue the current area of research and development in course of drug development.

Such one secondary picture is clearly shown by the research about CRC of more than ten years, the early detection with effective treatment interference is the key that increase survival rate.Up to the present, most common drug is 5 FU 5 fluorouracil (" 5FU ") in CRC treatment, usually combines with folic acid vitamin, folinic acid and is intravenously applied.When transfer has occurred and that, and cancer has diffused into the different piece of body, a kind of strategy for being called primary chemotherapy is used.For CRC, the Existing policies of primary chemotherapy are 5FU, the capecitabine for applying oral form, it is combined with the following: Camptosar, a kind of topoisomerase I inhibiting factor, or oxaliplatin, a kind of organic metal inhibiting DNA synthesis, drug containing platinum.

Currently, including two research fields: angiogenesis inhibitors and signal transduction inhibitor for the strategy of CRC new drug development.

New bio-pharmaceutical includes the therapeutic agent based on albumen and ribozyme.Therapeutic agent based on humanized antibody includes example such as Erbitux and Avastin.Erbitux, a kind of signal transduction inhibitor, it is therefore an objective to inhibit the EGF-R ELISA (" EGFR ") on cancer cell surfaces.Avastin, a kind of angiogenesis inhibitors, it is therefore an objective to inhibit the known vascular endothelial growth factor (" VEGF ") for promoting angiogenic growth.In addition, blood vessel enzyme (Angiozyme), a kind of example based on ribozyme therapy, are the angiogenesis inhibitors for VEGF-R1 expression of receptor.New drug based on traditional small molecule includes example such as Iressa, is based on quinazoline template, and acting on is signal transduction inhibitor and SU11248, is based on dihydroindole ketone template, acts on as anti-angiogenesis inhibitor.

Many potential disadvantages and uncertainty are still had for the rebirth medicine of these CRC treatment.For many promising drug candidates, in addition to typical contraindication, such as gastric disorder causing nausea, vomiting, headache and diarrhea, it has been observed that other more serious side effects, such as stomach perforation, the blood pressure being raised and lowered, extremely tired and internal haemorrhage.In addition, they are in the stage of the very early stage of clinical test although many produced based on blood vessel is inhibited or drug therapy that signal transduction inhibits looks like promising.

Therefore, there are the needs for biomarker and Bioinformatic methods in the art, the biomarker effectively early detection CRC, along with minimum level or the sampling method of Noninvasive, the Bioinformatic methods are that the early detection of CRC generates strong diagnosis detection together with biomarker.There is also the needs for medicament research and development in this field, it can provide effective treatment before the cancer development for diagnosing the patient with symptom, serious side effect is minimized simultaneously, the symptom such as cancer, such as CRC, lung cancer, prostate cancer and breast cancer, and neurodegenerative disease, such as Alzheimer disease and ALS.

Brief description

Fig. 1 is the embodiment for listing the sequence table of one group of biomarker of invention of the disclosure.

Fig. 2 is the distribution curve with the control subject versus test subjects of the one side assessment of the bioinformatics assessment of the one side and the disclosed invention of Fig. 1 biomarker group.

Fig. 3 shows the distribution and their point of cut-off of log (base2) expression value of gene PPAR- γ, IL-8, SAA 1 and COX-2.

Fig. 4 A and 4B show that different loci of the expression of different genes in the MNCM of the individual with colon cancer family's medical history changes.

Fig. 5 shows the flow chart of the one side of the bioinformatics method for assessing data.

Fig. 6 is the embodiment of wiping sampling (swabsampling) and movement system of property sampling minimally-invasive for colonic mucosal cells.

Fig. 7 is the flow chart for describing drug screening disclosure one side.

Fig. 8 is the flow chart for describing drug screening disclosure another aspect.

It is described in detail

Up to the present, by adenomatous polyp (" APC "), p53 and Ki-ras gene and corresponding albumen, and its research of the relational approach of regulation is participated in, has been obtained for more understandings to CRC biology.However, for specific gene, its expression, the research of protein product and regulation, with understand what gene be key include in the group for CRC analysis between there are apparent difference, nursing of the group for CRC analysis effective for management of disease patient.It include the specific point mutation of APC, p53 and Ki-ras and microsatellite instability marker gene BAT-26 for group proposed by CRC.

For CRC, begin to seek the biomarker for assessment of risks and CRC early detection for a long time.Difference between assessment of risks and early detection is about the deterministic degree of acquired CRC.Biomarker for assessment of risks assigns the CRC certainty lower than 100% in a time interval, and the biomarker for being used for early detection assigned in specific time interval seizure of disease almost 100% certainty.Risk factor may be used as not diagnosing the replacement terminal (surogate endpoint) of the individual with cancer, and condition is the presence of determining relationship between the replacement terminal and the result of determination.The example of determining CRC terminal is the example of adenomatous polyp.It has been determined that adenomatous polyp is necessary not a sufficient condition for the individual for developing CRC later.This is by the fact that prove, that is, the 90% of cancerous lesion is adenomatous polyp or tendency before all intrusions, and all individuals with adenomatous polyp of but not all continue to develop into CRC later.

Adenomatous polyp has been identified as the replacement terminal of CRC, and adenomatous polyp is certifiable by colonoscopy or sigmoidoscope naked eyes.In such invasive method, Tissue biopsy samples can be derived from polyp or the damage of the Histological assessment for tissue.Molecular diagnosis method disclosed herein is not from the confirmable polyp of naked eyes or damage for generally seeming normal colonic mucosal cells.However, invasive method need not be used to obtain Patient Sample A for Histological assessment as further disclosure herein.Noninvasive or minimally-invasive property method can be used to obtain, such as, blood sample, fecal specimens or the wiping sampling for generally seeming normal rectal cell can carry out molecular diagnosis detection on these samples to assess the existence or non-existence of CRC.The collection of the Noninvasive or minimally-invasive property that generally seem normal colonic mucosal cells (the tissue biopsy or wiping sampling of rectal cell), blood sample and/or fecal specimens is not disclosed for the method for CRC early detection described previously, molecule and/or protein expression diagnosis detection are carried out later, and the variation in tissue can be detected before showing that CRC is obvious any unfavorable histological change.

Fig. 1 is the table for providing the sequence table for including and summarizing in present disclosure.The table of Fig. 1, which is listed, implements one group of biomarker used in the disclosed invention.One embodiment of biomarker group is the 16 determining coded sequences provided by SEQ.ID NOs 1-16, and another embodiment of biomarker group is the 16 determining protein sequences provided by SEQ.ID NOs 17-32.The two embodiments are represented as CRC early detection and provide the molecular labeling group of necessary selectivity and sensitivity.It should be understood that the segment and variant of biomarker described in the sequence table are also effective biomarker in embodiment group for CRC early detection.Segment means any imperfect or isolated segment of polynucleotide or polypeptide in sequence table.Moreover, it should be appreciated that will almost announce daily about genetic mutation, it those of is especially in hot research gene, such as new discovery of the gene of participation disorders such as cancers.Therefore, the sequence table provided is exemplary the gene reported now, but it is to be understood that, for analysis method purpose, the variant of gene and their segment are also included.

In Fig. 1, in table 1-16 be biomarker group one side, be polymerized nucleoside coding sequences, and name and abbreviation including gene.17-32 of Fig. 1 are another embodiments of biomarker group, are albumen corresponding with 1-16 coded sequences or polypeptide, amino acid sequence.It is the molecular indicators of specific biological characteristic by the biomarker that National Institutes of Health (National Institutes of Health (" NIH ")) defines；The biochemical characteristics or aspect of progression of disease or therapeutic effect can be used to measure.Biomarker group is the selection of biomarker, and combining can be used to measure progression of disease or therapeutic effect.Biomarker can be various molecules.As mentioned previously, there is the demand for having the CRC biomarker effective for selectivity needed for CRC early detection and sensitivity.Therefore, an embodiment disclosed herein is a set of effective biomarker distinguished in offer CRC early detection of selection.

In the one side of present disclosure, for the early detection of CRC, the expression by the SEQ.ID NOs 1-16 polynucleotide shown is determined from the cell for the sample for being derived from patient by Noninvasive or minimally-invasive property method.The method of consideration includes blood sampling, stool sampling and rectal cell wiping sampling or biopsy.In the art, such analysis of polynucleotide expression is usually called gene expression profile mapping.Map for gene expression profile, measure leading indicator of the mRNA level in-site as biological aspect in sample --- in this case, the indicator as CRC.A kind of most common method for analysis gene expression profile mapping is to generate multiple copies from the mRNA of biological sample (sample is derived from above-disclosed patient by non-or minimally-invasive property method) using the method for being known as reverse transcription.In reverse transcription method, by methods known in the art, the mRNA of sample is separated from biological sample cell.Then, it is used to generate the corresponding DNA sequence dna that mRNA is initially transcribed from it for the mRNA to copy.During post transcription cloning, the DNA copy of generation does not have control region (that is, introne) in gene.Therefore, these multiple copies made of mRNA are called " cDNA ", represent complementary or duplication DNA.33-64 are set of primers, the transcriptive process,reversed for the every kind of biomarker that can be used for listing at 1-16.All nucleotide and amino acid biomarker sequences determined in SEQ.ID NOs 1-64 can be found in appended printout, and the purport including the application, and it can be found on disk, the disk is incorporated herein and is incorporated herein by reference as a part of the application.

Since mRNA level in-site initial in reverse transcription method and sample proportionally expands cDNA copy, even if it has become the standard method for allowing to identify and quantify low-level mRNA present in biological sample.In any specific biological aspect, gene can be incremented regulation or decrement regulation, and therefore mRNA level in-site changes accordingly.

In the one side of present disclosure, gene expression profile mapping method include, passing through non-or minimum level-invasive method, such as blood sampling, stool sampling, rectal cell wiping sampling, and/or the biopsy of rectal cell tissue and from the biological sample that patient takes, the quantitative measurment of the cDNA level of at least two kinds of biomarkers of the biomarker group selected from SEQ.ID NOs.1-16.The tissue taken needs not be obvious illness；In fact, even if the invention of the disclosure considers to be used to assess generally to seem the normally cell of (grossly normal-appearing) and carry out CRC detection.Such gene expression profile drawing method is needed using primer, enzyme and for cDNAs preparation, detection and quantitative other reagents.The method for generating cDNA from sample mRNA is called reverse transcriptase polymerase chain reaction (" RT-PCR ").The primer that SEQ.ID NOs 33-64 is listed is especially suitable for carrying out gene expression profile mapping based on biological imaging RT-PCR disclosed in biomarker group.A series of primers are devised using Primer Express Software (Applied Biosystems, Foster City, CA).Special candidate is selected, then detection confirms only have cDNA to obtain the pollution expanded without by genomic DNA.Accordingly, it is specifically designed, selects and have detected the primer that SEQ.ID NOs 33-64 is listed.

In the step of generating cDNA from isolated cell RNA later, the primer that SEQ.ID NOs 33-64 is listed is important, for the quantitatively copy of amplifying target genes expression product in real-time PCR.Optimal primer sequence and optimal primer length are the main considerations of design of primers.Optimal primer sequence can influence specificity and sensitivity of the primer in conjunction with template.The primer length for thinking 18-30 base is optimal range.Theoretically, 18 bases are the shortest lengths for representing unique sequences, will be hybridized in only one position in most of eukaryotic gene groups.The primer that SEQ.ID NOs 33-64 is listed in 21-27 base range, and designs and effectively is used to the cDNA of nucleotide group of the amplification selected from SEQ.ID NOs 1-16 on primer length.The specificity of primer is proved by the single dissociation curve of single product and PCR product on 10% polyacrylamide gel electrophoresis (" PAGE ").

Once primer has designed, and demonstrates specificity, they can largely be synthesized, and be saved to be advantageously used in applying in the future.Since PCR reaction forms sensitivity to buffer concentration and buffer, so primer should be maintained in the suitable diluent for not interfering amplified reaction.One example of suitable diluent is 10mM Tris buffer, and with or without 1mM EDTA, this depends on the detection sensitivity for EDTA.Alternatively, the example for another suitable diluent of primer is the deionized water of not nuclease.Primer in such as silication pipe, and can be lyophilized if necessary with equal part in container appropriate.Liquid or the sample of freeze-drying are optionally stored in the refrigerated storage temperature for being defined as biological sample long-term preservation, at about -20 DEG C to about -70 DEG C.The concentration of primer is typically in 0.1-0.5mM in amplified reaction.About 10 times of typical dilution gfactor from liquid storage to final reacting mixture, so as to equal part primer liquid storage typically between about 1 and 5mM.

Other than the specially designed primer that SEQ.ID Nos.33-64 is listed, following reagent is also needed for RT-PCR, such as the reagent containing dinucleotides triphosphoric acid mixture, its have all 4 kinds of dinucleotides triphosphoric acids (such as, dATP, dGTP, dCTP and dTTP), reagent with reverse transcriptase, and the reagent with thermostable DNA polymerase.In addition, also needing buffer, inhibitor and activator for RT-PCR process.

One side of Fig. 2 description for the bioinformatic data reduction method of CRC early detection, its show 17 control (left side) Mahalanobis range distributions, with 14 with CRC family's medical history individual (in) and 24 trouble it is polypiferous individual (right side) compared with.Using the biomarker group of the polynucleotide selected from SEQ.ID NOs.1-16, assess from the tissue sample for generally seeming that normal colonic mucosal tissue is taken.For each control and detection subject, the average of the gene expression dose of each about the 16 kinds of genes represented by the polynucleotide selected from SEQ.ID NOs 1-16 calculates in 2 domain log base.Then, based on the normal distribution of multivariable, to compare the multivariable average for determining 16 dimension spaces, to determine the boundary of normal expression level.For each control, the Mahalanobis distance (" M-dist ") of the multivariable average of other 16 controls is measured, and the multivariable average compareed to 17 determines the M-dist of each detection subject.In each group that Fig. 2 is shown, from it is single individual institute in a organized way biopsy form a vertical row.For suffering from polypiferous individual, tissue biopsy of the asterisk label from the individual with hyperplastic polyp.Horizontal line indicates -chi square distribution 95%ile with 16 freedom degrees.It is different from the average value of control in 0.05 level of p < in all values (corresponding about 25 M-dist) on this line.The data clearly illustrate there is the gene expression pattern changed in the substantially normal colonic mucosal tissue sample of detection subject.Therefore, the data prove the sensitivity and selectivity of the enhancing of the diagnosis detection using the biomarker group of the polynucleotide selected from SEQ.ID NOs.1-16.

The flow chart 300 of the one side of bioinformatics method of Fig. 3 display using the expression and distribution mapping of the polynucleotide selected from SEQ.ID Nos.1-16 for assessing analyzed sample data.Using the polynucleotide group for being selected from SEQ.ID Nos.1-16, the purpose of the bioinformatic analysis of the gene expression data for analyzing molecules diagnosis detection is the measurement that is single, being easy to calculating using exception (abnormality).Since comprehensive apparently multi-variables analysis determines the conspicuousness of all expression variations, so needing to analyze by expression pattern of the multi-variables analysis to all genes selected from SEQ.ID NOs 1-16 entirety.There are the detections of some species of multivariable, can be used to assess the existence or non-existence using colorectal cancer in the Patient Sample A that molecular diagnosis disclosed herein detects and detects effective for bioinformatic analysis, the bioinformatic analysis.The example of multi-variables analysis for assessing the Patient Sample A's data detected using the polynucleotide biomarker group selected from SEQ.ID NOs 1-16 includes that ANOVA and Mahalanobis distance (" M-Dist ") detects.

ANOVA is the general detection for explaining the correlation between expression.For multivariable ANOVA detection, it is necessary to be based on Wilks ' λ standard, and it is carried out in log (base 2) value for carrying out the detected data of molecular diagnosis using the polynucleotide group selected from SEQ.ID NOs 1-16, with the normal distribution of acquisition value.

M-dist analysis is another example of multi-variables analysis, it is contemplated that the correlation between the changeability and gene pairs of every kind of gene expression summarizes the difference between two kinds of gene expression patterns with single number.M-dist is used as the detection of outsider (individual case for being markedly different from all other individual case in group) usually with multivariate data.M-dist can be converted into p- value by reference to having -chi square distribution of the freedom degree equal to variable (that is, gene) number.However, needing in order to avoid the dependence of the multivariate normality for hypothesis using rank sum test, Mann-Whitney is examined, and compares the M-dist of individual case (that is, with those of polyp) and control.It is analyzed by using Mann-Whitney, hypothesis of the inference of the difference about expression pattern independent of multivariate normality.Therefore, the determination of the conspicuousness of the determination of the conspicuousness for all test subject expressions that this method allows to integrate and each individual expression value.

Provided hereinafter a working examples of above disclosure.Hao, C-Y, equal, Alterationof Gene Expression in Macroscopically Normal Colonic Mucosa fromIndividuals with a Family History of Sporadic Colon Cancer, 11 Clin.CancerRes., 1400-07 (Feb.15,2005).Further guidance of the example as the practitioner of this field common skill is provided, and limitation of the invention cannot be construed in any way.

Using this case study, develop colon cancer due to CRC family's medical history and in the morphologically normal colonic mucosa (" MNCM ") of the individual in the high-risk with colon cancer no, whether the expression of some genes changes.

People experimenter

In the conventional colonoscopy of individual for accessing California Pacific Medical Center (" CPMC "), the MNCM for carrying out rectum and sigmoid colon organizes biopsy, the individual does not have adenomatous polyp, colon cancer or other colonic damages without colon cancer medical history or previous colon cancer, and when checking.This research includes 12 individuals (table 3) and 16 individuals without known colon cancer family's medical history in first order relatives with colon cancer family's medical history.Although the information of family's cancer medical history is obtained by the self-report of patient without being confirmed from hospital's cancer registry, nearest research has confirmed that the accuracy of the self-report family's medical history about colon cancer.In 12 individuals with colon cancer family's medical history, 2 are mother and daughter (the case # 6 and 7 in table 3), and 2 are elder sister and younger brother (case #11 and 12), remaining is incoherent.In the group with colon cancer family's medical history, the subject age of research was in 18-64 years old range, and control group was at 16-83 years old (colonoscopy has been carried out due to chronic abdominal pain in 16 years old subject).The research process for obtaining the normal biopsy specimens of research obtains the approval of CPMC Institutional Review Board.All study subjects are carried out to obtain the method appropriate for being apprised of content.

The extraction and preparation of RNA and cDNA

The Tissue biopsy samples that colon segment between caecum and liver bending section obtains are classified as colon ascendens sample；Colon segment between liver bending section and spleen bending section those of obtains sample and is classified as transverse colon samples；Sample, which those of is obtained, from the colon segment lower than spleen bending section is classified as colon descendens；It those of obtains sample from the colon meander lower than colon descendens and is classified as rectosigmoid colon samples (from rectum about 5-25cm).The Tissue biopsy samples number obtained from each patient is different.Other than the transverse colon segment of a subject from family's medical history group and colon descendens segment only obtain 1 part of sample, 2-8 parts of Tissue biopsy samples are obtained from each colon segment.39 parts of colon ascendens samples, 37 parts of transverse colon samples, 45 parts of colon descendens samples and 77 parts of rectosigmoid colon samples are obtained in total from 12 individuals with colon cancer family's medical history；53 parts of colon ascendens samples, 48 parts of transverse colon samples, 49 parts of colon descendens samples and 104 parts of rectosigmoid colon samples are obtained in total from 16 individuals without colon cancer family's medical history.All Tissue biopsy samples are quick-frozen on dry ice, and take laboratory immediately and carry out the RNA preparation and reverse transcription.

Gene expression analysis

Pass through the expression of quantitative RT PCR analysis the following: oncogene c-myc, CD44 antigen (" CD44 "), cyclooxygenase 1 and 2 (" COX-1 " and " COX-2 "), cyclin D1, cyclin- dependent kinases inhibiting factor (" p21^cip/waf1"); interleukin 8 (" IL-8 "); interleukin-8 receptor (" CXCR2 "); osteopontin (" OPN "); melanoma growth-stimulating activity (" Gro α/MGSA "); GRO3 oncogene (" Gro γ "), macrophage colony-stimulating factor 1 (" MCSF-1 "), peroxisome proliferation activated receptor, α, δ and γ (" PPAR- α, δ and γ ") and Serum Amyloid A 1 (" SAA1 ").Carry out quantitative RT-PCR.Briefly, when the PCR product of accumulation is more than arbitrarily fixed threshold value, recurring number (" C is recorded_TValue ").In order to standardize this value, by Δ C_TValue is determined as the C of every kind of gene of detection_TThe C of value and beta-actin_TDifference between value.Calculate the average delta C of every kind of gene in control group_TValue.By Δ Δ C_TValue is determined as the Δ C of every part of individual sample_TThe average delta C of value and this gene obtained from control sample_TDifference between value.Then, as described, by these Δ Δs C_TValue is used to calculate relative gene expression values.(Applied Biosystems, User Bulletin #2, December 11,1997).When available cDNA sample, all PCR are carried out in duplicate.The result is also verified as internal contrast using Histidyl-tRNA synthetase.Using beta-actin or his-tRNA synzyme as reference, relative gene expression values generate similar result.Here statistical analysis is obtained as normalization controls using beta-actin.

Statistical analysis

The icp gene expression pattern between the control group subject with the individual of colon cancer family's medical history and without colon cancer family's medical history.It is not that the expression of every kind of gene and the method by reducing statistical indices (statistical power) is independently examined to adjust Multiple range test, we examine the expression pattern of all genes by difference multi-variables analysis (" MANOVA ") with Wilks ' λ standard.This detection is the multivariate analog examined for the F- of difference univariate analysis, examines the identity property of average value.Such analysis considers the correlation between gene expression dose, and controls false positive rate and providing expression pattern single inspection whether different between group and group based on all genes in subset.

The evidence different between group and group by the way that there are expression patterns, then we examine using unitary variant t- to determine which gene pairs comprehensive differences works.This conversion is needed due to completing normal distribution, so, all MANOVA, which are examined, is based on Wilks ' λ standard, and carries out on the log of expression (base 2).Our data by every group (family's medical history is to no family's medical history) different number individuals every subject different number of sample composition.Analysis includes the random effects terms about sum individual in group about a vivo sample, to illustrate sampling plan.If Y_ijkThe log2 gene expression values of kth part sample of i-th group of jth name patient are indicated, then statistical models pass through following equations mathematical notation: Y_ijk=M+A_i+B_ij+e_ijk, wherein A_iIt is (fixation) group effect, B_ijIt is (random) patient effect and e_ijkIt is (random) sample in patient effect.

By the variable for defining the sample from colon ascendens with value 1, value 2 defines the variable of the sample from transverse colon, value 3 defines the variable of the sample from colon descendens, the variable of the sample of the proctosigmoid part from colon is defined with value 4, whether the order of magnitude (in formula or under formula) that we also have detected differential expression increases from colon ascendens part to rectum along colon.This variable is added in model, so as to detect its influence to certain genes using unitary variant ANOVA.

The definition of point of cut-off

The log (base 2) of expression from all Tissue biopsy samples of control group is used to calculate the point of cut-off of every kind of gene upregulation or decrement regulation.The tolerance limit table of normal distribution is used to define point of cut-off, so that the Distributed parts no more than P will be above point of cut-off, or be lower than point of cut-off for the gene of decrement regulation for the gene of upregulation.Each point of cut-off is defined by point of cut-off=average value+k (SD), wherein average value and the value of SD (standard deviation) based on control group.K value is found in table, and depends on the number of P value and normal specimens.Owen, D.B., Noncentral t andtolerance limits, in Brimbauim ZW, ed.Handbook of Statistical Tables, Reading, MA:Addison-Wesley, 1962,108-127.It is assumed that the Gaussian Profile of every kind of gene expression dose, people are it is anticipated that the slicer from normal population less than 1% has the expression more than 99% tolerance limit (p=0.01).

Be higher by a possibility that sample number that 99%ile is observed is due to contingency in each case to calculate, we apply binomial distribution method, every kind of situation sample number of p=0.01 and n=multiplied by detection number of genes.For example, we have 2 parts of samples for case #1 (table 3)；The two all shows the unconventionality expression of PPAR- γ and SAA1, and alternative one is for PPAR- δ abnormal expression, and none is abnormal for IL-8 and COX-2.Therefore, for this case, having 5 parts in the samples of 10 parts of detections is more than the upper limit 0.01.This is that occurrent possibility is 2.4 × 10^-8.General formula is given below: $\mathrm{Pr}\{x\&GreaterEqual;k|p,n\}=\underset{i=k}{\overset{5n}{\mathrm{\&Sigma;}}}{\left(0.01\right)}^i{\left(0.99\right)}^{5n-i},$ Wherein k is the number for being more than 99%ile and n is sample number (number of genes of detection is 5).

As a result

The gene expression of change in the rectosigmoid mucosa of the individual with colon cancer family's medical history:

12 individual (10 women and 2 males) compositions have the group of colon cancer family's medical history；16 individuals (9 women and 7 males) are as a control group.(table 1) for the expression of 16 kinds of genes, we analyze 92 parts of colon ascendens samples, 85 parts of transverse colon samples, 94 parts of colon descendens Tissue biopsy samples and 181 parts of rectosigmoid biopsy samples in total.The expression of these known genes changes in human colon carcinoma advanced stage.We also confirm changes in some MNCM cut off in the operation of colorectal cancer patients in these genes.

With continued reference to table 1, the analysis of 16 individual 104 part Tissue biopsy samples from not family's medical history, and the analysis of 12 individual 77 part Tissue biopsy samples from the first order relatives with colon cancer family's medical history are as a result represented.According to the gene expression for analyzing sample described in method.Number in table is represented to be averaged the expression of MCT relative to control group.If do not changed between individuals, the normal gene expression level of control group should be equal to 1.It is carried out in the log2 expression value of 16 kinds of genes using the multi-variables analysis of Wilks λ standard, to determine the significance of difference between two groups.Gene is listed from minimum to maximum P value.

The multi-variables analysis of all 16 kinds of gene expression values shows the significant difference (p=0.01) in the Tissue biopsy samples from the proctosigmoid region with and without those of sporadic colonic cancer patient.Between this two groups individuals, the gene expression of the Tissue biopsy samples from colon descendens, colon ascendens and transverse colon do not have significant ground it is different (respectively, p=0.06,0.22 and 0.52).Most of difference of rectosigmoid biopsy sample is only provided by 5 kinds (tables 1) of these genes: PPAR- γ, SAA1, IL-8, COX-2 and PPAR- δ.It is similar to the change of gene expression in the MNCM of cancer patient, we have found that, in the MNCM of the individual with sporadic colonic cancer family's medical history, the expression of SAA1, IL-8 and COX-2 obtain upregulation and PPAR- γ and the expression of PPAR- δ obtains decrement regulation.

It is probably due to the consciousness for the enhancing for needing early stage to carry out colonoscopy in the group with colon cancer family's medical history, (56 ± 16 years old) youth of (± SD) age (45 ± 12 years old) than control group that be averaged of family's medical history group.In addition, there are gender differences (in family's medical history groups 10 women and 2 males, relative to 9 women and 7 males in control group) between this two groups.However, it has been found that gender does not influence gene expression dose (p=0.67).Also, in addition to PPAR- δ 0.01, there is no correlation between age and the expression (all p > 0.05) of SAA1, IL-8, COX2 and PPAR- γ.However, the unconventionality expression (decrement regulation) of PPAR- δ is with age.Therefore, the comparison between the control of young family's medical history group and old age will be tended in family's medical history group find less rather than more unconventionality expressions.In other words, we may underestimate the incidence of the expression of change of the PPAR- δ in family's medical history group.

Table 1. compared with the control, from colon cancer family's medical history individual normal rectal sigmoid colon Tissue biopsy samples in gene expression dose

Gene	It compares (n=104)		Patient (n=77) with family's medical history		P value
							Range	Average value ± (S.D.)	Range	Average value ± (S.D.)
PPAR-γ	0.44-1.65	1.07±0.41	0.20-2.59	0.79±0.40	0.006
						SAA1	0.17-22	2.16±3.67	0.33-2343	151±452	0.02
IL-8	0.14-13	1.71±1.94	6.84-13	6.84±2.82	0.02
						COX-2	0.17-18	1.82±2.75	0.24-30	5.11±9.01	0.07
PPAR-δ	0.39-2.66	1.11±0.48	0.16-2.22	0.89±0.46	0.07
						CD44	0.35-4.13	1.14±0.64	0.11-4.98	1.41±0.78	0.12
c-Myc	0.24-3.66	1.21±0.75	0.26-4.31	1.48±0.82	0.14
						MCSF-1	0.38-22	1.81±2.59	0.20-11	2.04±2.19	0.21
Gro-α	0.01-51	2.61±5.48	0.34-57	5.76±11.63	0.22
						Gro-γ	0.16-35	2.18±4.29	0.12-41	2.55±5.91	0.25
P21	0.51-2.15	1.10±0.62	0.20-7.68	0.90±0.32	0.27
						PPAR-α	0.31-2.38	1.09±0.55	0.26-2.21	1.00±0.40	0.54
CXCR2	0.22-13	1.45±1.78	0.43-4.44	1.49±1.55	0.55
						OPN	0.19-13	1.66±2.05	0.15-12	1.41±1.92	0.73
CyclinD	0.34-3.48	1.28±0.85	0.13-3.21	1.29±0.79	0.81
						COX-1	0.27-5.97	1.21±0.85	0.25-2.63	1.09±0.51	0.87

The point of cut-off of " normal " gene expression is compared

Relative gene expression level in rectosigmoid colon samples is different between individuals, more much more (table 1) than the respective value from control from the sample that the individual with colon cancer family's medical history obtains.Therefore, by calculating the point of cut-off (p=0.01) of every kind of gene, we define " normal " expression of every kind of gene using the expression of every kind of gene of control group.Fig. 3 shows the distribution and their point of cut-off of log (base2) expression value of gene PPAR- γ, IL-8, SAA1 and COX-2.As expected, the Tissue biopsy samples from control group less than 1% have the expression (p=0.01, Fig. 3) of these genes higher or lower than transversal.However, 21%, 12% and 8% Tissue biopsy samples from family's medical history group are respectively provided with the expression of SAA1, IL-8 and COX-2 higher than point of cut-off, and there is 12% sample PPAR- γ lower than point of cut-off to express (table 2).

Table 2. has the Tissue biopsy samples number (N) of the gene expression above/below point of cut-off in normal individual and individual with colon cancer family's medical history

Gene	Tissue biopsy samples (n=104) N (%) from normal control	From Tissue biopsy samples (n=77) N (%) with family's medical history
			PPAR-γ	0	9 (12%)
SAAI	0	16 (21%)*
			IL-8	0	9 (12%)*
COX-2	1 (1%)*	6 (8%)*
			PPAR-δ	0	2 (3%)
Gro-γ	1 (1%)*	2 (3%)*
			PPAR-α	0	2 (3%)
Gro-α	0	0
			MCSF-1	1 (1%)*	0
OPN	1 (1%)*	0
			P21	0	0
CD44	1 (1%)*	0
			CXCR2	1 (1%)*	0

c-Myc	0	0
			CyclinD	0	0
COX-1	0	0

has the gene expression dose lower than point of cut-off

^*With the gene expression dose for being higher than point of cut-off

There is the number of patients changed to list in table 3.

Then, we analyze each of family's medical history group body (table 3).Show the Tissue biopsy samples number shown lower than (for PPAR- γ and δ) or the expression for being higher than (for IL-8, SAA1 and COX-2) point of cut-off.The individual that all Tissue biopsy samples all show expression in the normal range is indicated with (-) symbol.All grand parents with colon cancer are maternals in our current research.When colon cancer is diagnosed, the age of family member is expressed as follows:^***Indicate that colon cancer is diagnosed before 50 years old；^**It indicates before 60 years old；With^*It indicates after 60 years old.When colon cancer is diagnosed, the age of remaining family member is unavailable.In addition to father patient of case #10 is other than the 1970s suffers from lung cancer, 12 patients in family's medical history group report other types of cancer without one in family.

As indicated in table 3, the gene most often changed for 5 kinds, 9 in 12 individuals with colon cancer family's medical history are below or above the Tissue biopsy samples of point of cut-off at least one expression.The expression of change of 2 individuals (case #1 and 2) with gene as 3 kinds in obvious normal rectosigmoid mucosa.On the contrary, there was only the expression of 1 change with one of this 5 kinds of genes in 16 individuals of control group (referring to table 2).Cutoff value is set, so that 1% expression will be false positive.However, the biopsy samples number obtained from each individual is different.In order to adjust sample number, for each case, we, which also calculate, is being higher than a possibility that sample number observed outside 99%ile is caused due to contingency.This calculating is based on binomial distribution.As shown in table 3, the gene expression for the change observed in 7 in 12 family's medical history group individuals is unlikely due contingency and causes (p < 0.01).In this 7 cases, 5 kinds of at least two kinds of expression of gene are changed.In addition, PPAR- γ and SAA1 are the genes (table 3) most often changed occurred in 12 individual 5 with colon cancer family's medical history in 16 kinds of genes of analysis.

The summary that table 3.PPAR- γ, IL-8, SAA1, COX-2 and PPAR- δ is expressed in the rectosigmoid biopsy sample of the individual with colon cancer family's medical history

Case	Gender	Age (year)	Family member with cancer	The Tissue biopsy samples of # analysis	PPAR-γ	SAA1	IL-8	COX-2	PPAR-δ	# changes the gene of expression	Due to a possibility that accidentally sexually revising
													# has the sample of the expression changed
				1	F	53	Mother***	2	2	2	-									-	1	3	< 0.001
2	F	53	Mother*									6	2	-	1	-	1	3	< 0.001
				3	M	43	Father*	5	3	1	-									-	-	2	< 0.001
4	F	47	Mother*									7	-	7	1	-	-	2	< 0.001
				5	F	52	Mother	8	-	-	-									-	-	0	1
6	F	52	Father and daughter***									6	-	-	1	-	-	1	0.26
				7	F	18	Grandfather and daughter***	8	2	-	-									1	-	2	< 0.01
8	F	35	Mother*And grandmother									8	-	-	8	6	-	2	< 0.001
				9	F	46	Father**	8	-	-	-									-	-	0	1
10	F	64	Elder sister*									6	-	1	-	-	-	1	0.26
				11	F	36	Mother and grandfather	7	-	-	-									-	-	0	1
12	M	38	Mother and grandfather									6	1	6	-	-	-	2	< 0.001
				# has the individual of the gene expression changed					5	5	4									2	2

The expression of different genes with colon cancer family's medical history individual MNCM different loci and change.

Family's medical history group individual case analysis shows, different genes changes in the rectosigmoid biopsy sample of different subjects.For example, SAA1 and PPAR- γ is changed in case #3, IL-8 and SAA1 are changed in case #4；And in case #8 COX-2 and IL-8 rather than SAA1 is changed (Fig. 4 A).In addition, some genes are changed (IL-8 in SAA and case #8 in such as case #4) in all rectosigmoid biopsy samples of same patient, and some only change in some such Tissue biopsy samples (i.e., the COX-2 in IL-8 and case #8 in SAA1 and PPAR- γ in case #3, case #4).In addition, some such change are confined to proctosigmoid region, the IL-8 in such as case #4；And some other regions that can extend to colon, the SAA1 (Fig. 4 B) in such as case #4.

We have also observed that, for PPAR- γ (p=0.001 tendency) and SAA1 (p < 0.001), rather than for IL-8 (p=0.20), COX2 (p=0.58), nor PPAR- δ (p=0.54), the difference of the gene expression between two groups of individuals increases with the length of colon.These results indicate that along colon, there are increased abnormalities from colon ascendens to rectal portion between two groups of individuals, although reducing in our current research to the sample number of colon ascendens part, can still be detected.

From previous examples, it can be deduced that following conclusions.The colorectum carcinogenesis of about 5-10% is in a kind of patient of the colon cancer (familial adenomatous polyposis and hereditary nonpolyposis colorectal cancer) with 2 kinds of autosomal dominant inheritance forms, or (the Burt R. in the patient with inflammatory bowel disease occurs, Peterson G.M.In:Young G., Rozen, P.& Levin, B.Saunders, ed.inPrevention and Early Detection of Colorectal Cancer, Philadelphia, 171-194 (1996)).In remaining colon cancer, about 20% is related with colon cancer family's medical history, colon cancer family's medical history (Smith R.A. related to 2 times of colon cancer increased danger are developed, von EschenbachA.C., Wender R., equal, American Cancer Society guidelines for the earlydetection of cancer:update of early detection guidelines for prostate, colorectal, and endometrial cancers, and Update 2 001--testing for early lungcancer detection, 51 CA Cancer J Clin.38-75；quiz 77-80(2001)).Although it has been reported that chain (the Wiesner G.L. of chromosome 15q13-14 and 9q22.2-31.2 in familial colorectal cancer patients subset, Daley D., Lewis S., equal, A subset of familial colorectalneoplasia kindreds linked to chromosome 9g 22.2-31.2,100 Proc Natl Acad SciUSA, 12961-5 (2003)), but the hereditary basis of these most of cases is unknown.In our current research, we have demonstrated that the essence that PPAR- γ, IL-8 and SAA1 are expressed in the proctosigmoid MNCM of the patient with sporadic colonic cancer family's medical history changes, even if that there is no detectable colons is abnormal for these individuals.We it is previous research shows that, other than PPAR- γ, IL-8 and SAA1, when compared with the normal individual of no colon cancer, polyp and family's medical history, in the MNCM of colorectal cancer patients, the expression of PPAR- δ, p21, OPN, COX-2, CXCR2, MCSF-1 and CD44 change also significantly.These observations show that the expression of the change of gene relevant to cancer development in MNCM may be a kind of result sexual behavior part, and may than apparent morphological abnormalities appearance spot earlier.Develop colon cancer not yet for example, the expression of the change of PPAR- γ, SAA1 and IL-8 is likely to occur in but be in the high MNCM to the individual in danger for developing colon cancer；And the expression of other genes such as change of PPAR- δ, p21, OPN, COX-2, CXCR2, MCSF-1 and CD44, (the Chen L-C in the MNCM for the individual that colon cancer has been developed occurs when may be a little later, Hao C-Y, Chiu Y.S.Y., equal, Alteration ofGene Expression in Normal Appearing Colon Mucosa of APCmin Mice andHuman Cancer Patients, 64 Cancer Research 3694-3700 (2004)).

Hereditary and raw afterwards change (Tycko B. has been reported in the macroscopic normal tissue of some tumours, Genetic and epigenetic mosaicism in cancer precursor tissues, 983Ann N Y Acad Sci., 43-54 (2003)).For example, allelic loss is proven in the normal breast terminal ductal leaflet of neighbouring primary breast cancers.(Deng G., Lu Y., Zlotnikov G., Thor A.D., Smith H.S., Loss of heterozygosity in normal tissue adjacent tobreast carcinomas, 274 Science, 2057-9 (1996)).Such allelic loss (Li Z. related to the increased risk of local recurrence, Moore D.H., Meng Z.H., Ljung B.M., Gray J.W., Dairkee S.H., Increased risk of local recurrence is associated withallelic loss in normal lobules of breast cancer patients, 62 Cancer Res., 1000-3 (2002)).In addition, seem normal colonic mucosal cells than apoptosis (the Bernstein C. that the mucosa cells of the individual of colon cancer before not suffering from are induced more resistant against cholic acid with preceding colon cancer (prior colon cancer) individual, Bernstein H., Garewal H., equal, A bileacid-induced apoptosis assay for colon cancer risk and associated qualitycontrol studies, 59 Cancer Res., 2353-7 (1999)；With Bedi A., Pasricha P.J., Akhtar A.J., Inhibition of apoptosis during development of colorectalcancer., 55 Cancer Res., 1811-6 (1995) are waited).Since apoptosis for removing there is the cell for the DNA damage that do not repair to be important (Payne C.M. in colon epithelial cell, Bernstein H., Bernstein C., Garewal H., Role of apoptosis in biology andpathology:resistance to apoptosis in colon carcinogenesis, 19 UltrastructPathol., 221-48 (1995)), the reduction of apoptosis may cause the delay of DNA- damaging cells, and increase the danger of Cancer-causing mutation.

PPAR- γ is regulated and controled by decrement in certain cancers.The ligand of PPAR- γ inhibits cell growth and Cell differentiation inducing activity (Kitamura S., Miyazaki Y., Shinomura Y., Kondo S., Kanayama S., Matsuzawa Y., Peroxisome proliferator-activated receptorgamma induces growth arrest and differentiation markers of human coloncancer cells, 90 Jpn J Cancer Res 75-80 (1999)), and It has been reported that PPAR- γ loses mutation (the Sarraf P. of function in human colon carcinoma, Mueller E., Smith W.M., equal, Loss-of-function mutations in PPAR gamma associated with human coloncancer, 3 Mol.Cell, 799-804 (1999)).Therefore, it is observed that PPAR- γ expressed in MNCM decrement regulation may represent promote colonic epithelial cell growth and inhibit cell differentiation earliest events.In addition, PPAR- γ also negative regulation inflammatory response (Welch J.S., Ricote M., AkiyamaT.E., Gonzalez F.J., Glass C.K., PPAR gamma and PPAR delta negativelyregulate specific subsets of lipopolysaccharide and IFN-gamma target genesin macrophages, 100 Proc Natl Acad Sci USA 6712-7 (2003)).Inflammation is conducive to tumour by stimulation angiogenesis and cell Proliferation and (Nakajima N. occurs, Kuwayama H., ItoY., Iwasaki A., Arakawa Y., Helicobacter pylori, neutrophils, interleukins, andgastric epithelial proliferation, 25 Suppl.1 J Clin Gastroenterol., 98-202 (1997)).Similarly, IL-8 and acute phase protein SAAl regulates and controls inflammatory process (Dhawan P., Richmond A., Role of CXCL 1 in tumorigenesis of melanoma, 72 J LeukocBiol., 9-18 (2002)；With Urieli-Shoval S., Linke R.P., Matzner Y., Expressionand function of serum amyloid A, a major acute-phase protein, in normal anddisease states, 7 Curr Opin Hematol., 64-9 (2000)).(the Niederau C. in the colonic mucosa with inflammatory bowel disease individual, Backmerhoff F., Schumacher B., Inflammatorymediators and acute phase proteins in patients with Crohn ' s disease andulcerative colitis, 44 Hepatogastroenterology, 90-107 (1997)；And KeshavarzianA., Fusunyan R.D., Jacyno M., Winship D., MacDermott R.P., Sanderson I.R., Increased interleukin-8 (IL-8) in rectal dialysate from patients with ulcerativecolitis:evidence for a biological role for IL-8 in inflammation of the colon, 94Am J Gastroentero L., 704-12 (1999)), (the Bachwich D.R. in the colonic mucosa of the individual in the highly dangerous for developing colon cancer, Lichtenstein G.R., Traber P.G., Cancer ininflammatory bowel disease, 78 Med Clin North Am., 1399-412 (1994)), it has been reported that the upregulation of proinflammatory cytokine and acute phase protein.Epidemiologic observation also shows, chronic inflammation tends to colorectal cancer (Rhodes J.M. in advance, Campbell B.J., Inflammationand colorectal cancer:IBD-associated and sporadic cancer compared, 8Trends Mol Med., 10-6 (2002)；With Farrell R.J., Peppercorn M.A., Ulcerativecolitis, 359 Lancet 331-40 (2002)).Therefore, in the upregulation with sporadic colonic cancer family's medical history individual and the decrement regulation and IL-8 and SAA1 of the PPAR- γ observed in the normal mucosa of the individual with inflammatory bowel disease, it can be shown that conventional route participation causes this 2 groups colon tumor to occur.

The change expression with cancer and inflammation-related gene that we observe in the normal colonic mucosa of some individuals with colon cancer family's medical history, it is consistent with nearest report, nearest report (Erlinger T.P. related to serum C-reactive protein (" CRP ") concentration raised before developing colon cancer, PlatzE.A., Rifai N., Helzlsouer K.J., C-reactive protein and the risk of incidentcolorectal cancer., 291 JAMA, 585-90 (2004)).These discoveries show that in average-risk individuals (id.), inflammation is to develop the risk factor of colon cancer.However, CRP is the non-specific label of inflammation, the phase may indicate that the inflammation in the tissue in addition to colon.In our study, we analyze the tissue of colon carcinogenesis, and by the danger of more specifically assessment development colon cancer.

We do not know which kind of cellular type is responsible for the gene expression for the change observed.There are many cell types, including some type of mucosal epithelial cells, stroma cell and blood borne cell in colonic mucosa.We organize the research with other groups, and upregulation of the verified COX-2 albumen in MNCM is predominantly located at permeability macrophage and back burner in APC^min(Chen L-C, Hao C-Y, Chiu Y.S.Y. waits, Alteration of GeneExpression in Normal Appearing Colon Mucosa of APC to epithelial cell in mouse MNCM in abnormal crypts lesion^minMice and HumanCancer Patients, 64 Cancer Research 3694-3700 (2004)；With Hull M.A., BoothJ.K., Tisbury A., equal, Cyclooxygenase 2 is up-regulated and localized tomacrophages in the intestine of Min mice, 79 Br J Cancer, 1399-405 (1999)).From us about APC^minIn the early stage research of mouse MNCM, it may be due to secretory protein, such as IL-8 and SAA1, disappear (Chen L-C soon on tissue sections, Hao C-Y, Chiu Y.S.Y. waits, Alteration of Gene Expression in Normal Appearing Colon Mucosa ofAPC^minMice and Human Cancer Patients, 64 Cancer Research 3694-3700 (2004)), it has been found that there is technical difficulty by immunohistochemical staining detection increment-or decrement-regulation gene product in MNCM.Since the living tissue of limited quantity dissects sample and technical difficulty, we not can be carried out immunohistochemical staining to prove the cell type for causing the gene expression changed.If absolute RNA amount is that adequately, RNA in situ hybridization can be the better method for determining the cell position of change.Alternatively, carry out after laser microdissection RT-PCR may be able to determine that including cell type.Regardless of the cell type for the gene expression for being responsible for changing, our result proves, normal individual relative to no colon cancer family's medical history, the gene expression of change is present in the normal colonic mucosa of some individuals with colon cancer family's medical history and has increased danger (the Burt R. for forming colon cancer known to these individuals, Peterson G.M.In:Young G., Rozen, P.& Levin, B.Saunders, ed.in Prevention and Early Detection ofColorectal Cancer, Philadelphia, 171-194 (1996)).

In the patient in rectosigmoid biopsy sample with the gene expression changed, some patients show to change (i.e. in all Tissue biopsy samples, the expression of SAA1 in case #4 and 12), and some patients only show the expression changed (i.e. in some Tissue biopsy samples, PPAR- γ, Fig. 2 in case #2 and #3).Since most of samples are assessed with duplicate multiple genes, to ensure the quality of cDNA, so, it is such heterogeneous it is not possible that be caused by technique variation.It is presumed that this heterogeneity may reflect in these individuals the frequency and/or distribution of " hot spot (hot spots) ".Possibly, individual in all rectosigmoid biopsy samples with the gene expression changed may have discrete hot spot with those of expression changed individual in some Tissue biopsy samples in its rectosigmoid mucosa with the molecule abnormality of extensive diffusive.Therefore, the individual in preceding group may have the integrative trend for developing polyp of colon or colon cancer, and then individual may have local trend those of in group.Develop colon cancer between this 2 groups or whether the risk of polyp is different not clear.In addition, observing the expression of the change of different genes combination in the rectosigmoid biopsy sample with family's medical history group individual.This observation shows that different molecular pathways may participate in the early stage of colon carcinogenesis.The gene expression changed in certain molecular pathways whether in the higher risk correlation of polyp or cancer again without determination.

There is the report than crypts lesions (pre-neoplastic Traumatic Colon) more in proximal colonic (Shpitz B. consistent in the lower distal colon of sporadic colon cancer patients and the mouse of carcinogen processing, Bomstein Y., Mekori Y., equal, Aberrant crypt foci in human colons:distributionand histomorphologic characteristics, 29 Hum Pathol., 469-75 (1998)；With Salim E.I., Wanibuchi H., Morimura K., equal, Induction of tumors in the colonand liver of the immunodeficient (SCID) mouse by2-amino-3-methylimidazo [4,5-f] quinoline (IQ)-modulation by long chain fattyacids, 23 Carcinogenesis, 1519-29 (2002)), it was found that most of changes in gene expression are in family's medical history group It is found in the lower distal colon of body.It is presumed that, when most of moisture is after large intestine end is by reabsorption, compared with the mucous membrane in other colon regions, the distal colon mucosa of sensitive individual is likely to be exposed at the allogenic material of higher concentration being present in excrement, and such exposure may this region cause more high probability change gene expression.

We have demonstrated that colon cancer family's medical history, rather than age or gender, it is the factor being responsible for for the gene expression difference observed in this 2 groups rectosigmoid mucosa.Available information is not explicitly shown the diet between this 2 groups of patients or any specific difference in drug therapy.However, without further research, we can not rule out diet or a possibility that medication affect gene expressed.Not all individual with colon cancer family's medical history will all develop colon cancer or tissues of adenomatous polyp (Smith, R.A., von Eschenbach A.C., Wender, R. wait, American Cancer Societyguidelines for the early detection of cancer:update of early detectionguidelines for prostate, colorectal, and endometrial cancers, and Update2001-testing for Early lung cancer detection, 51 CA Cancer J.Clin., 38-75；quiz 77-80(2001).).Consistent with this clinical observation, our analysis is it is also shown that the not all individual with colon cancer family's medical history has the gene expression changed all in MNCM.Since the gene analyzed in our current research participates in the development of colon cancer, we guess that the individual for having the gene expression changed in MNCM may be easier to develop polyp or cancer than those of the gene expression that does not change individual.In order to verify this hypothesis, the prospective study to numerous studies subject is needed.If such correlation is confirmed, the individual in the increased danger for developing colon cancer may be determined by the gene expression analysis of application rectosigmoid biopsy sample.Theoretically, by analyzing random MNCM sample, compared with there is the individual locally changed, it is easier to which determining has the comprehensive individual changed in MNCm.However, the genome suitable if it is the analysis selection of application Multi-example, then it may have sufficient predictive power to determine such patient.

Fig. 5 is referred now to, the processor of the introduction programming using conventional general purpose or dedicated digital computer and/or according to present disclosure, this is it will be apparent that the various aspects of Fig. 5 may be implemented for the technical staff of computer field.Introduction based on present disclosure, this is it will be apparent that suitable Software Coding can easily be formulated by skilled programmer for the technical staff of computer field.The present invention can also be connected with each other and realize by formulating integrated circuit and/or the computer circuits network by that will be suitable for, this is readily apparent the technical staff of computer field.

Various aspects include a kind of computer program product, it is a kind of with the/storage medium of information therein that indicates and/or be stored thereon, the storage medium can be used for programmable universal purpose or dedicated computation processor/device, to complete any feature described herein.Storage medium can include but is not limited to, one or more the following: any kind of physical medium, including floppy disk, CD, DVDs, CD-ROMs, micro-move device (microdrives), magneto-optic disk, holographic storage devices, ROMs, RAMs, EPROMs, EEPROMs, DRAMs, PRAMS, VRAMs, flash memory device, magnetically or optically card, nano-systems (including molecular memory ICs)；Paper or medium based on paper；And any kind of medium or device suitable for storing instruction and/or information.Various aspects include that a kind of all or part and can cross one or more public and/or private networks and the computer program product that transmits, wherein the transmission includes instruction (instruction) and/or information, can be used to complete any feature as described herein by one or more processors.In in all fields, transmission may include a variety of independent transmission.

It is stored on one or more computer-readable media (media), present disclosure includes the hardware for controlling general purpose/special purpose computer and/or processor, and the software that the computer and/or processor are interacted with the other mechanical device of people user or application result of the present invention.Such software can include but is not limited to, device driver, operating system, execution environments/containers, user interface and application software.

The execution of coding can be direct or indirect.Coding may include compilation, translation and other types of language.Unless in addition being limited by desired language, the execution and/or transmission of coding and/or function coding segment may include to other softwares or device, and local or long-range quoting or calling, to exercise the function.Described to quote or call may include quoting or calling to library modules, device driver and remote software, to exercise the function.Quoting or calling may include quoting or calling distributed and client/server system.

Fig. 6 describes the one aspect of present disclosure, has wiping sampling and conveyer system 400 for the minimally-invasive property sampling of colonic mucosal cells.The system 400 of Fig. 6 is made of swab 410 and container 420.Container 420 is set with stabilization, extraction such as by one kind described in this respect content shown in fig. 6 and saves colonic mucosal cells sample, detects until the diagnosis that disclosed biomarker group carries out CRC early detection to sample can be used.

Swab 410 has the head 412 to extend out from 414 end of bar.First 410 can be ellipse, square, rectangle, circle etc. with formula many shapes, and has the maximum width of about 0.5cm-1.0cm, and the length of about 1.0cm-10.0cm along the end of bar.First 412 can be comprised of any number of materials, such as the combination of cotton, staple fibre, polyester and foam of polymers or such material.Bar 414 with sufficient mechanical strength and adequately elastic material by being made, and the mechanical strength is enough to wipe rectal area, and sufficient elasticity is enough to prevent from injuring.The example of the bar material with intensity and elasticity for rectal swab includes timber, paper and various polymer materials, such as composition of polyester, polystyrene and polyurethane and such polymer.

Container 420 has main body 412 and cap 424.Main body 412 can have various length and diameters, to accommodate the swab 410 of the length range of the size and bar 414 with head 412 described above.The main body 412 of container can be made of many polymer materials, such as polyethylene, polypropylene, polycarbonate, poly- fluorocarbon or glass, and cap 424 is typically made of ideal polymer material, the example such as provided for main body 412.Container 420 has reagent 426 in bottom, when carrying out rectal area wiping sampling as minimally-invasive property sampling technique, is suitably stable for and extracts the colonic mucosal cells collected on swab 410.Further, it is possible to use not needing the container 420 of swab 410, there is the reagent 426 for being suitably stable for and extracting colonic mucosal cells sample from fecal specimens.

Other tissue degeneratiaon agent such as biosurfactants of the reagent 426 containing the concentration at least about guanidine thiocyanate solution of the buffering of 0.4M and concentration about 0.1-10%.Ideal biosurfactant can be zwitterionic, such as CHAPS or CHAPSO, non-ionic, such as TWEEN or any alkyl glycosides (alkylglucoside) surfactant or ion, such as SDS.Various buffers can be used, for example, it is generally known that for those of Good ' s buffer, such as Tris.In order to which reagent 426 to be effectively buffered to the pH of about 7.0-8.5, the concentration of buffer may be different.

Also contemplating can be handled using the sample that such as the wiping sampling mode of the one side of disclosure in Fig. 6 and conveyer system 400 are extracted, and data it is literary in use disclosed in computer hardware and software single instrument in analyzed.That is, can be analyzed in single instrument according to Fig. 5 from the sample that the one side of Fig. 6 disclosure obtains.However, it is also contemplated that the blood or fecal specimens of patient can be analyzed in single instrument.In one embodiment, the instrument is first element on one side, is used to carry out RT-PCR to Patient Sample A, to carry out gene expression profile mapping, as above.Gene expression profile mapping allows the cDNA to SEQ.ID Nos 1-16 quantitative, and the cDNA is the mRNA reverse transcription prepared from Patient Sample A's cell.The primer set of SEQ.ID Nos33-64 is reacted for RT-PCR, to cause mRNA chain corresponding with SEQ.ID Nos 1-16, and thus synthesizes cDNA corresponding with SEQ.ID Nos 1-16.

After cDNAs is obtained from RT-PCR, data are compared by the second element of the instrument, to control the data on the storage medium for having stored in the instrument.Application software uses above-disclosed multi-variables analysis, to execute the instruction in a manner of ANOVA, M-Dist or other multi-variables analyses.Based on statistical analysis, qualified diagnostician can assess the existence or non-existence of CRC, the progress of CRC and/or the therapeutic effect of CRC.

Single instrument can be used for the early detection of CRC in the another aspect of present disclosure, carry out the protein expression distribution mapping of Patient Sample A.Term " polypeptide (polypeptide) " or " polypeptide (polypeptides) " can be used interchangeably herein with term " albumen (protein) " or " albumen (proteins) ".As previously discussed, albumen is had studied and for a long time studies its potentiality as biomarker, but have seldom success.As the supplement of polynucleotide biomarker, there are valuable for protein biomarkers.So that the reason of information is provided by two kinds of biomarker includes such observation at present, i.e., mRNA expression is not the good predictor of protein expression level, the information modified after any protein translation is not provided with mRNA expression, and modification is crucial for its bioactivity after protein translation.Therefore, it in order to understand the expression and their complete structures of albumen, needs directly to analyze albumen.

Disclosed herein is the albumen listed in SEQ.ID NOs 17-32, corresponding with the gene that SEQ.ID NOs1-16 is indicated.The another aspect of the disclosed invention is the expression for the albumen that determining SEQ.ID NOs.17-32 is indicated.The Patient Sample A extracted by above-disclosed non-or minimally-invasive property method can be used to prepare the protein extract of fixed cell or sample cell.Cell for protein expression distribution mapping can be obtained by the method for Fig. 6, either alternatively for example obtained by blood sample or fecal specimens or other Noninvasives or minimally-invasive property method (or passing through more conventional invasive method, including such as sigmoidoscopy and other methods certainly).

In the first element of the instrument, cell or protein extract can be detected with one group of antibody for applied all biomarkers is --- monoclonal or polyclonal ---, to measure the level of desired polypeptides.The purpose of the detection is detection and quantitative albumen corresponding with the gene order of biomarker in SEQ.ID NOs 1-16, the i.e. expression of SEQ.ID NOs 17-32.

In the one side of the present disclosure in view of the method, the antibody of the antibody group based on biomarker group be can be incorporated on solid support.Secondary antibody can be used in method for protein expression distribution mapping, has and is directed to certain combinations, desired polypeptides part specificity.Such secondary antibody can be marked with effectively detecting and quantifying the molecule of combined polypeptide, and therefore when in conjunction with the polypeptide, marked and be used to detect and quantify.Additionally, it is contemplated that other reagents are for marking combined polypeptide to detect and to quantify.Such reagent can directly mark the polypeptide of combination, or similar with secondary antibody, can be the part for having specificity to the polypeptide for having markd combination.The example of such part includes but is not limited to small molecule, co-factor, substrate, complexant etc. or macromolecular, agglutinin, peptide, oligonucleotides etc..Such part can be natural or synthetic.

The example of detection mode about disclosed method includes but is not limited to spectroscopy techniques, such as fluorescence and UV-Vis spectroscope, scinticounting and mass spectrum.As the supplement of these detection modes, the example of the detection applied in these methods and the label for quantifying purpose includes but is not limited to chromophore label, flashing label and a large amount of labels (mass labels).The expression of the polynucleotide and polypeptide that are measured in the second element of instrument using these methods can be standardized relative to the control for determining that purpose determines for target.Contrasting data is stored in computer, is the third element of the instrument.

4th software element compares the data obtained from one or several Patient Sample As with contrasting data.Comparing will include at least one multi-variables analysis, and may include ANOVA, MANOVA, M-Dist and other methods known to persons of ordinary skill in the art.Once statistical analysis and comparing progress and completing, the personnel of doctor or other qualification can be that the CRC situation of one or several patients make diagnosis.

In terms of the drug screening for referring now to present disclosure, it should be appreciated that biomarker group disclosed herein is gene and its expression product, it is known that they participate in following metabolic pathways and process: 1) oxidative pressure/inflammation；2) APC/b- joins protein pathways；3) cell cycle/transcription factor；With 4) participate in cell/cell communications, growth, reparations and to damage and wound response cell factor and other factors effect.There are more and more evidences, these approach, and therefore the member of this biomarker group also participates in the cancer of many other types in addition to CRC, such as lung cancer, prostate cancer and breast cancer, and neurodegenerative disease, such as Alzheimer disease and amyotrophic lateral sclerosis (" ALS ").In such pathology, the gene and its expression product for participating in these approach are basic for the growth, maintenance and pressure response of many different types of cells.In pathology such as cancer and nerve degeneration, the expression of the change of the gene of certain changes leads to one or more pathological symptoms, so that the change of these genes and its expression product is the biomarkers characteristic of the specific pathology.In this regard, incoherent pathology on surface, such as various cancers and neurodegenerative disease, are the performances of extremely complex pathology, each described pathology includes the discrete member of the biomarker, and the biomarker is derived from the gene and its expression product of above-mentioned approach and process group.As the practical demonstration of this point, it should now be understood that cox 2 inhibitor is not only for the broad category of disease including colon cancer and other cancers, but also there is therapeutic value to neurodegenerative disease.

Disclosed herein is application of the theme biomarker group of Fig. 1 in drug invention method, and the drug discovery method is about pathology such as cancer, such as CRC, lung cancer, prostate cancer and breast cancer and neurodegenerative disease, such as Alzheimer disease and ALS.As mentioned above, the discrete mode of the gene and its expression product of change provides unique identification label for every kind of special disease, so described group provides required selectivity for various pathology.Drug means any therapeutic medicament for pathology treatment.This includes the molecule being conventionally synthesized, natural products, the natural products of synthetic modification and bio-pharmaceuticals product, such as polypeptide and polynucleotide and their combination, extract and preparation.

Drug screening is the first stage for being called the drug development of drug invention phase.Typically it is called leads by the promising drug of drug screening process qualification, that is, when through the standard of screening process, they be it is advanced, further detected in the drug discovery stage for being usually called lead and optimizing (lead optimization).If optimizing the stage by the lead of drug invention, the leads is exactly qualified candidate, and preferentially crosses next stage of the drug discovery stage to the drug development for being called pre- clinical test, and referred to as research new drug (" IND ").If the IND be it is advanced, it is preferential to carry out clinical test, it tests in people experimenter in this case.Finally, after FDA official approval, it can be commercialized if the IND is hopeful by what clinical experimental stage showed.The known entire drug discovery process for single candidate will spend the development cost of 10-15 and millions of dollar.Due to this, the current strategy of drug development mechanism is to concentrate on drug discovery stage, effectively finds out promising drug, and only will there is high the candidate of success potentiality further to pass through remaining drug development cycle.

In the screening stage of drug invention, the specific detection for assessing promising drug is carried out for qualified biological model system, for the terminal of its monitoring specificity.As about pathology such as cancer, such as CRC, lung cancer, prostate cancer and breast cancer, with the biomarker group of the replacement terminal of the drug screening of neurodegenerative disease such as Alzheimer disease and ALS, not still effective for the group of the early detection of such pathology, but also show such regulation, that is, the regulation is carried out by drug by such a way that pathology occurs or recurrence reduction is relevant.Additionally, effective for one or more members of the biomarker group of the early detection of such pathology, it is also used as the target of the drug screening for such pathology.It is then discussed, biomarker described in Fig. 1 may be used as the replacement terminal of model biological system and the target of drug screening.

In screening stage, it can be estimated that the promising drug of big library represents the flux of the tens of thousands of kinds of compounds in single screening scheme.Being considered as small throughput screening (" LTS ") is about 10,000- about 50,000 kind of promising drug, and moderate fluxes screening (" MTS ") represents about 50,00- about 100,00 kind of promising drug, and high flux screening (" HTS ") is 100,000- about 500,000 kind of promising drug.

The meaning of screening scheme includes the testing process screened and analysis method.So, screening scheme includes following factors, will such as be used for the type of the biological model of the detection；The condition detected；The type in the library of promising drug candidate or promising candidate；The type of equipment to be used；With data collection, processing and the mode of storage.The scale of screening scheme --- LTS, MTS or HIS --- is influenced by following factors, such as testing process (for example, detection type), analysis method (for example, miniaturization, automation) and computing capability and capacity.The meaning of biological model system includes all biological body, whole cells, cell lysate and target molecule.When considering treatment use, promising drug candidate means any kind of molecule or molecular preparation or suspension.For example, promising drug candidate can be molecule, natural products, the natural products of synthetic modification and bio-pharmaceuticals product, such as polypeptide and the polynucleotide and their combination, extract and preparation of synthesis.

As discussed above, Fig. 1 provides the sequence table for practicing the biomarker group of the disclosed invention.The one side of present disclosure is the biomarker group for 16 kinds of determining coded sequences that SEQ.ID NOs 1-16 is provided, and the another aspect of biomarker group is 16 kinds of determining albumen that SEQ.ID NOs 17-31 is provided.These two aspects of the invention provides selectivity required for pathology early detection and sensitivity, the pathology such as cancer, such as CRC, lung cancer, prostate cancer and breast cancer and neurodegenerative disease, such as Alzheimer disease and ALS.

As mentioned previously, CRC is a kind of typical pathology about new drug development.For CRC, there are no determine the biomarker or biomarker group for having acceptable high selectivity and sensitivity for CRC early detection.It therefore, is in terms of the biomarker group broken up in basis is provided for CRC early detection described in Fig. 1.The selectivity of the biomarker of clinical definition refers to the patient's percentage correctly diagnosed.The sensitivity of biomarker in clinical content is defined as disease a possibility that can be detected in the stage of curing.It is desirable that biomarker will have 100% clinical selectivity and 100% clinical sensitivity.Up to the present, there are no such biomarker or biomarker group is determined, there is the selectivity and sensitivity of acceptable height required for the wide scope demand effective for patient care management.

The analysis method screened may include above-disclosed for CRC early detection method, i.e., gene expression profile mapping is carried out from the mRNA of biological sample, to determine the gene expression of biomarker, how to be influenced (including using RT-PCR) by promising drug candidate with their expression, and/or the protein expression level of Fig. 1 polypeptide biomarker due to caused by application promising drug candidate；Then it is determined using multivariate statistical analysis, uses and do not use the promising drug candidate, the significance,statistical of the expression of various labels in group.

With reference to Fig. 7, the one side of drug screening disclosure considers that acquisition tissue sample, such as wipe samples (see Fig. 6), blood sample or tissue biopsy, the sample can pass through, for example, minimally-invasive property, invasive or Noninvasive method extracts.Suitable lysis buffer can be used to extract and save the RNA of cell in tissue sample.It is then possible to carry out RT-PCR on the RNA of extraction, and it is converted to cDNA, as disclosed above, used, the special primer of the biomarker group to Fig. 1 that for example, at least 2 SEQ.ID NOs 33-64 are listed, to screen the function and effect of drug.It is then detected that result can carry out multi-variables analysis and M-dist, as above, and result is compared with contrasting data.

Fig. 8 describes the another aspect of drug screening disclosure, wherein prepare the antibody for the SEQ.ID NOs 17-32 at least two kinds of biomarker proteins listed, and the antibody is used to detect biosystem from tissue biopsy for example listed above and other tissue samples, for example, full cell, cell lysate etc..The antibody is used to detect and quantify the expression for the biomarker peptide that SEQ.ID NOs 17-32 is determined, so that the expression of these biomarker peptides can be used as and quantitatively give the function of potential drugs to the biosystem and be monitored.As a result multivariable and unitary variant analysis and M-dist. can be carried out, as disclosed above, and is compared with contrasting data.

Disclosure herein is provided for the purpose for illustrating and describing.It is not intended to be exhaustive or disclosure is confined in the precise forms.The practitioner skilled for this field, many improvements and changes are obvious.In order to preferably explain the principle and practical application of embodiment disclosed in the technology, so that others skilled in the art select it will be appreciated that suitable for the various embodiments and various improvement of the concrete application considered and describe disclosure.

References cited herein before is by reference to being fully incorporated in this.

Sequence table

<110>uncommon Lee .M. in south

<120>for the drug screening of colorectal cancer early detection and molecular diagnosis detection: reagent, method and its kit

<130>NLEE-01001WO0 MCF/MLB

<150>60/614,746

<151>2004-09-30

<150>60/651,344

<151>2005-02-08

<150>Not Assigned

<151>2005-09-29

<160>64

<170>PatentIn version 3.3

<210>1

<211>1629

<212>DNA

<213>people

<400>1

gcagagcaca caagcttcta ggacaagagc caggaagaaa ccaccggaag gaaccatctc    60

actgtgtgta aacatgactt ccaagctggc cgtggctctc ttggcagcct tcctgatttc    120

cgcagctctg tgtgaaggtg cagttttgcc aaggagtgct aaagaactta gatgtcagtg    180

cataaagaca tactccaaac ctttccaccc caaatttatc aaagaactga gagtgattga    240

gagtggacca cactgcgcca acacagaaat tatgtaaagc tttctgatgg aagagagctc    300

cgtctggacc ccaaggaaaa ctgggtgcag agggttgtgg agaagttttt gaagagggct    360

gagaattcag aattcataaa aaaattcatt ctctgtggta tccaagaatc agtgaagatg    420

ccagtgaaac ttcaagcaaa tctacttcaa cacttcatgt attgtgtggg tctgttgtag    480

 ttgccaga  tgcaatacaa gattcctggt taaatttgaa tttcagtaaa caatgaatag    540

cttttcattg taccatgaaa tatccagaac atacttatat gtaaagtatt atttatttga    600

atctacaaaa aacaacaaat aatttttaaa tataaggatt ttcctagata ttgcacggga    660

gaatatacaa atagcaaaat tgaggccaag ggccaagaga atatccgaac tttaatttca    720

ggaattgaat gggtttgcta gaatgtgata tttgaagcat cacataaaaa tgatgggaca    780

ataaattttg ccataaagtc aaatttagct ggaaatcctg gatttttttc tgttaaatct    840

ggcaacccta gtctgctagc caggatccac aagtccttgt tccactgtgc cttggtttct    900

cctttatttc taagtggaaa aagtattagc caccatctta cctcacagtg atgttgtgag    960

gacatgtgga agcactttaa gttttttcat cataacataa attattttca agtgtaactt  1020

attaacctat ttattattta tgtatttatt taagcatcaa atatttgtgc aagaatttgg  1080

aaaaatagaa gatgaatcat tgattgaata gttataaaga tgttatagta aatttatttt  1140

attttagata ttaaatgatg ttttattaga taaatttcaa tcagggtttt tagattaaac  1200

aaacaaacaa ttgggtaccc agttaaattt tcatttcaga taaacaacaa ataatttttt  1260

agtataagta cattattgtt tatctgaaat tttaattgaa ctaacaatcc tagtttgata  1320

ctcccagtct tgtcattgcc agctgtgttg gtagtgctgt gttgaattac ggaataatga  1380

gttagaacta ttaaaacagc caaaactcca cagtcaatat tagtaatttc ttgctggttg  1440

aaacttgttt attatgtaca aatagattct tataatatta tttaaatgac tgcattttta  1500

aatacaaggc tttatatttt taactttaag atgtttttat gtgctctcca aatttttttt  1560

actgtttctg attgtatgga aatataaaag taaatatgaa acatttaaaa tataatttgt  1620

tgtcaaagt                                                          1629

<210>2

<211>3356

<212>DNA

<213>people

<400>2

gtccaggaac tcctcagcag cgcctccttc agctccacag ccagacgccc tcagacagca    60

aagcctaccc ccgcgccgcg ccctgcccgc cgctgcgatg ctcgcccgcg ccctgctgct    120

gtgcgcggtc ctggcgctca gccatacagc aaatccttgc tgttcccacc catgtcaaaa    180

ccgaggtgta tgtatgagtg tgggatttga ccagtataag tgcgattgta cccggacagg    240

attctatgga gaaaactgct caacaccgga atttttgaca agaataaaat tatttctgaa    300

acccactcca aacacagtgc actacatact tacccacttc aagggatttt ggaacgttgt    360

gaataacatt cccttccttc gaaatgcaat tatgagttat gtgttgacat ccagatcaca    420

tttgattgac agtccaccaa cttacaatgc tgactatggc tacaaaagct gggaagcctt    480

ctctaacctc tcctattata ctagagccct tcctcctgtg cctgatgatt gcccgactcc    540

cttgggtgtc aaaggtaaaa agcagcttcc tgattcaaat gagattgtgg aaaaattgct    600

tctaagaaga aagttcatcc ctgatcccca gggctcaaac atgatgtttg cattctttgc    660

ccagcacttc acgcatcagt ttttcaagac agatcataag cgagggccag ctttcaccaa    720

cgggctgggc catggggtgg acttaaatca tatttacggt gaaactctgg ctagacagcg    780

taaactgcgc cttttcaagg atggaaaaat gaaatatcag ataattgatg gagagatgta    840

tcctcccaca gtcaaagata ctcaggcaga gatgatctac cctcctcaag tccctgagca    900

tctacggttt gctgtggggc aggaggtctt tggtctggtg cctggtctga tgatgtatgc    960

cacaatctgg ctgcgggaac acaacagagt atgcgatgtg cttaaacagg agcatcctga    1020

atggggtgat gagcagttgt tccagacaag caggctaata ctgataggag agactattaa    1080

gattgtgatt gaagattatg tgcaacactt gagtggctat cacttcaaac tgaaatttga    1140

cccagaacta cttttcaaca aacaattcca gtaccaaaat cgtattgctg ctgaatttaa    1200

caccctctat cactggcatc cccttctgcc tgacaccttt caaattcatg accagaaata    1260

caactatcaa cagtttatct acaacaactc tatattgctg gaacatggaa ttacccagtt    1320

tgttgaatca ttcaccaggc aaattgctgg cagggttgct ggtggtagga atgttccacc    1380

cgcagtacag aaagtatcac aggcttccat tgaccagagc aggcagatga aataccagtc    1440

ttttaatgag taccgcaaac gctttatgct gaagccctat gaatcatttg aagaacttac    1500

aggagaaaag gaaatgtctg cagagttgga agcactctat ggtgacatcg atgctgtgga    1560

gctgtatcct gcccttctgg tagaaaagcc tcggccagat gccatctttg gtgaaaccat    1620

ggtagaagtt ggagcaccat tctccttgaa aggacttatg ggtaatgtta tatgttctcc    1680

tgcctactgg aagccaagca cttttggtgg agaagtgggt tttcaaatca tcaacactgc    1740

ctcaattcag tctctcatct gcaataacgt gaagggctgt ccctttactt cattcagtgt    1800

tccagatcca gagctcatta aaacagtcac catcaatgca agttcttccc gctccggact    1860

agatgatatc aatcccacag tactactaaa agaacgttcg actgaactgt agaagtctaa    1920

tgatcatatt tatttattta tatgaaccat gtctattaat ttaattattt aataatattt    1980

atattaaact ccttatgtta cttaacatct tctgtaacag aagtcagtac tcctgttgcg    2040

gagaaaggag tcatacttgt gaagactttt atgtcactac tctaaagatt ttgctgttgc    2100

tgttaagttt ggaaaacagt ttttattctg ttttataaac cagagagaaa tgagttttga    2160

cgtcttttta cttgaatttc aacttatatt ataagaacga aagtaaagat gtttgaatac    2220

ttaaacactg tcacaagatg gcaaaatgct gaaagttttt acactgtcga tgtttccaat    2280

gcatcttcca tgatgcatta gaagtaacta atgtttgaaa ttttaaagta cttttggtta    2340

tttttctgtc atcaaacaaa aacaggtatc agtgcattat taaatgaata tttaaattag    2400

acattaccag taatttcatg tctacttttt aaaatcagca atgaaacaat aatttgaaat    2460

ttctaaattc atagggtaga atcacctgta aaagcttgtt tgatttctta aagttattaa    2520

acttgtacat ataccaaaaa gaagctgtct tggatttaaa tctgtaaaat cagtagaaat    2580

tttactacaa ttgcttgtta aaatatttta taagtgatgt tcctttttca ccaagagtat    2640

aaaccttttt agtgtgactg ttaaaacttc cttttaaatc aaaatgccaa atttattaag    2700

gtggtggagc cactgcagtg ttatcttaaa ataagaatat tttgttgaga tattccagaa    2760

tttgtttata tggctggtaa catgtaaaat ctatatcagc aaaagggtct acctttaaaa    2820

taagcaataa caaagaagaa aaccaaatta ttgttcaaat ttaggtttaa acttttgaag    2880

caaacttttt tttatccttg tgcactgcag gcctggtact cagattttgc tatgaggtta    2940

atgaagtacc aagctgtgct tgaataatga tatgttttct cagattttct gttgtacagt    3000

ttaatttagc agtccatatc acattgcaaa agtagcaatg acctcataaa atacctcttc    3060

aaaatgctta aattcatttc acacattaat tttatctcag tcttgaagcc aattcagtag    3120

gtgcattgga atcaagcctg gctacctgca tgctgttcct tttcttttct tcttttagcc    3180

attttgctaa gagacacagt cttctcatca cttcgtttct cctattttgt tttactagtt    3240

ttaagatcag agttcacttt ctttggactc tgcctatatt ttcttacctg aacttttgca    3300

agttttcagg taaacctcag ctcaggactg ctatttagct cctcttaaga agatta        3356

<210>3

<211>1750

<212>DNA

<213>people

<400>3

cctacaggtg aaaagcccag cgacccagtc aggatttaag tttacctcaa aaatggaaga    60

ttttaacatg gagagtgaca gctttgaaga tttctggaaa ggtgaagatc ttagtaatta    120

cagttacagc tctaccctgc ccccttttct actagatgcc gccccatgtg aaccagaatc    180

cctggaaatc aacaagtatt ttgtggtcat tatctatgcc ctggtattcc tgctgagcct    240

gctgggaaac tccctcgtga tgctggtcat cttatacagc agggtcggcc gctccgtcac    300

tgatgtctac ctgctgaacc tagccttggc cgacctactc tttgccctga ccttgcccat    360

ctgggccgcc tccaaggtga atggctggat ttttggcaca ttcctgtgca aggtggtctc    420

actcctgaag gaagtcaact tctatagtgg catcctgcta ctggcctgca tcagtgtgga    480

ccgttacctg gccattgtcc atgccacacg cacactgacc cagaagcgct acttggtcaa    540

attcatatgt ctcagcatct ggggtctgtc cttgctcctg gccctgcctg tcttactttt    600

ccgaaggacc gtctactcat ccaatgttag cccagcctgc tatgaggaca tgggcaacaa    660

tacagcaaac tggcggatgc tgttacggat cctgccccag tcctttggct tcatcgtgcc    720

actgctgatc atgctgttct gctacggatt caccctgcgt acgctgttta aggcccacat    780

ggggcagaag caccgggcca tgcgggtcat ctttgctgtc gtcctcatct tcctgctttg    840

ctggctgccc tacaacctgg tcctgctggc agacaccctc atgaggaccc aggtgatcca    900

ggagacctgt gagcgccgca atcacatcga ccgggctctg gatgccaccg agattctggg    960

catccttcac agctgcctca accccctcat ctacgccttc attggccaga agtttcgcca    1020

tggactcctc aagattctag ctatacatgg cttgatcagc aaggactccc tgcccaaaga    1080

cagcaggcct tcctttgttg gctcttcttc agggcacact tccactactc tctaagacct    1140

cctgcctaag tgcagccccg tggggttcct cccttctctt cacagtcaca ttccaagcct    1200

catgtccact ggttcttctt ggtctcagtg tcaatgcagc ccccattgtg gtcacaggaa    1260

gcagaggagg ccacgttctt actagtttcc cttgcatggt ttagaaagct tgccctggtg    1320

cctcacccct tgccataatt actatgtcat ttgctggagc tctgcccatc ctgcccctga    1380

gcccatggca ctctatgttc taagaagtga aaatctacac tccagtgaga cagctctgca    1440

tactcattag gatggctagt atcaaaagaa agaaaatcag gctggccaac gggatgaaac    1500

cctgtctcta ctaaaaatac aaaaaaaaaa aaaaaaatta gccgggcgtg gtggtgagtg    1560

cctgtaatca cagctacttg ggaggctgag atgggagaat cacttgaacc cgggaggcag    1620

aggttgcagt gagccgagat tgtgcccctg cactccagcc tgagcgacag tgagactctg    1680

tctcagtcca tgaagatgta gaggagaaac tggaactctc gagcgttgct gggggggatt    1740

gtaaaatggt                                                           1750

<210>4

<211>3939

<212>DNA

<213>people

<400>4

cctgggtcct ctcggcgcca gagccgctct ccgcatccca ggacagcggt gcggccctcg    60

gccggggcgc ccactccgca gcagccagcg agccagctgc cccgtatgac cgcgccgggc    120

gccgccgggc gctgccctcc cacgacatgg ctgggctccc tgctgttgtt ggtctgtctc    180

ctggcgagca ggagtatcac cgaggaggtg tcggagtact gtagccacat gattgggagt    240

ggacacctgc agtctctgca gcggctgatt gacagtcaga tggagacctc gtgccaaatt    300

acatttgagt ttgtagacca ggaacagttg aaagatccag tgtgctacct taagaaggca    360

tttctcctgg tacaagacat aatggaggac accatgcgct tcagagataa caccgccaat    420

cccatcgcca ttgtgcagct gcaggaactc tctttgaggc tgaagagctg cttcaccaag    480

gattatgaag agcatgacaa ggcctgcgtc cgaactttct atgagacacc tctccagttg    540

ctggagaagg tcaagaatgt ctttaatgaa acaaagaatc tccttgacaa ggactggaat    600

attttcagca agaactgcaa caacagcttt gctgaatgct ccagccaaga tgtggtgacc    660

aagcctgatt gcaactgcct gtaccccaaa gccatcccta gcagtgaccc ggcctctgtc    720

tcccctcatc agcccctcgc cccctccatg gcccctgtgg ctggcttgac ctgggaggac    780

tctgagggaa ctgagggcag ctccctcttg cctggtgagc agcccctgca cacagtggat    840

ccaggcagtg ccaagcagcg gccacccagg agcacctgcc agagctttga gccgccagag    900

accccagttg tcaaggacag caccatcggt ggctcaccac agcctcgccc ctctgtcggg    960

gccttcaacc ccgggatgga ggatattctt gactctgcaa tgggcactaa ttgggtccca    1020

gaagaagcct ctggagaggc cagtgagatt cccgtacccc aagggacaga gctttccccc    1080

tccaggccag gagggggcag catgcagaca gagcccgcca gacccagcaa cttcctctca    1140

gcatcttctc cactccctgc atcagcaaag ggccaacagc cggcagatgt aactgctaca    1200

gccttgccca gggtgggccc cgtgatgccc actggccagg actggaatca caccccccag    1260

aagacagacc atccatctgc cctgctcaga gaccccccgg agccaggctc tcccaggatc    1320

tcatcactgc gcccccaggc cctcagcaac ccctccaccc tctctgctca gccacagctt    1380

tccagaagcc actcctcggg cagcgtgctg ccccttgggg agctggaggg caggaggagc    1440

accagggatc ggacgagccc cgcagagcca gaagcagcac cagcaagtga aggggcagcc    1500

aggcccctgc cccgttttaa ctccgttcct ttgactgaca caggccatga gaggcagtcc    1560

gagggatcct ccagcccgca gctccaggag tctgtcttcc acctgctggt gcccagtgtc    1620

atcctggtct tgctggctgt cggaggcctc ttgttctaca ggtggaggcg gcggagccat    1680

caagagcctc agagagcgga ttctcccttg gagcaaccag agggcagccc cctgactcag    1740

gatgacagac aggtggaact gccagtgtag agggaattct aagctggacg cacagaacag    1800

tctcttcgtg ggaggagaca ttatggggcg tccaccacca cccctccctg gccatcctcc    1860

tggaatgtgg tctgccctcc accagagctc ctgcctgcca ggactggacc agagcagcca    1920

ggctggggcc cctctgtctc aacccgcaga cccttgactg aatgagagag gccagaggat    1980

gctccccatg ctgccactat ttattgtgag ccctggaggc tcccatgtgc ttgaggaagg    2040

ctggtgagcc cggctcagga ccctcttccc tcaggggctg cagcctcctc tcactccctt    2100

ccatgccgga acccaggcca gggacccacc ggcctgtggt ttgtgggaaa gcagggtgca    2160

cgctgaggag tgaaacaacc ctgcacccag agggcctgcc tggtgccaag gtatcccagc    2220

ctggacaggc atggacctgt ctccagacag aggagcctga agttcgtggg gcgggacagc    2280

ctcggcctga tttcccgtaa aggtgtgcag cctgagagac gggaagagga ggcctctgca    2340

cctgctggtc tgcactgaca gcctgaaggg tctacaccct cggctcacct aagtccctgt    2400

gctggttgcc aggcccagag gggaggccag ccctgccctc aggacctgcc tgacctgcca    2460

gtgatgccaa gagggggatc aagcactggc ctctgcccct cctccttcca gcacctgcca    2520

gagcttctcc agcaggccaa gcagaggctc ccctcatgaa ggaagccatt gcactgtgaa    2580

cactgtacct gcctgctgaa cagcctcccc ccgtccatcc atgagccagc atccgtccgt    2640

cctccactct ccagcctctc cccagcctcc tgcactgagc tggcctcacc agtcgactga    2700

gggagcccct cagccctgac cttctcctga cctggccttt gactccccgg agtggagtgg    2760

ggtgggagaa cctcctgggc cgccagccag agccgctctt taggctgtgt tcttcgccca    2820

ggtttctgca tcttccactt tgacattccc aagagggaag ggactagtgg gagagagcaa    2880

gggaggggag ggcacagaca gagagcctac agggcgagct ctgactgaag atgggccttt    2940

gaaatatagg tatgcacctg aggttggggg agggtctgca ctcccaaacc ccagcgcagt    3000

gtcctttccc tgctgccgac aggaacctgg ggctgagcag gttatccctg tcaggagccc    3060

tggactgggc tgcatctcag ccccacctgc atggtatcca gctcccatcc acttctcacc    3120

cttctttcct cctgaccttg gtcagcagtg atgacctcca actctcaccc accccctcta    3180

ccatcacctc taaccaggca agccagggtg ggagagcaat caggagagcc aggcctcagc    3240

ttccaatgcc tggagggcct ccactttgtg gccagcctgt ggtgctggct ctgaggccta    3300

ggcaacgagc gacagggctg ccagttgccc ctgggttcct ttgtgctgct gtgtgcctcc    3360

tctcctgccg ccctttgtcc tccgctaaga gaccctgccc tacctggccg ctgggccccg    3420

tgactttccc ttcctgccca ggaaagtgag ggtcggctgg ccccaccttc cctgtcctga    3480

tgccgacagc ttagggaagg gcactgaact tgcatatggg gcttagcctt ctagtcacag    3540

cctctatatt tgatgctaga aaacacatat ttttaaatgg aagaaaaata aaaaggcatt    3600

cccccttcat ccccctacct taaacatata atattttaaa ggtcaaaaaa gcaatccaac    3660

ccactgcaga agctcttttt gagcacttgg tggcatcaga gcaggaggag ccccagagcc    3720

acctctggtg tcccccaggc tacctgctca ggaacccctt ctgttctctg agaactcaac    3780

agaggacatt ggctcacgca ctgtgagatt ttgtttttat acttgcaact ggtgaattat    3840

tttttataaa gtcatttaaa tatctattta aaagatagga agctgcttat atatttaata    3900

ataaaagaag tgcacaagct gccgttgacg tagctcgag                           3939

<210>5

<211>1024

<212>DNA

<213>people

<400>5

atggcccgcg ctgctctctc cgccgccccc agcaatcccc ggctcctgcg agtggcactg    60

ctgctcctgc tcctggtagc cgctggccgg cgcgcagcag gagcgtccgt ggccactgaa    120

ctgcgctgcc agtgcttgca gaccctgcag ggaattcacc ccaagaacat ccaaagtgtg    180

aacgtgaagt cccccggacc ccactgcgcc caaaccgaag tcatagccac actcaagaat    240

gggcggaaag cttgcctcaa tcctgcatcc cccatagtta agaaaatcat cgaaaagatg    300

ctgaacagtg acaaatccaa ctgaccagaa gggaggagga agctcactgg tggctgttcc    360

tgaaggaggc cctgccctta taggaacaga agaggaaaga gagacacagc tgcagaggcc    420

acctggattg tgcctaatgt gtttgagcat cgcttaggag aagtcttcta tttatttatt    480

tattcattag ttttgaagat tctatgttaa tattttaggt gtaaaataat taagggtatg    540

attaactcta cctgcacact gtcctattat attcattctt tttgaaatgt caaccccaag    600

ttagttcaat ctggattcat atttaatttg aaggtagaat gttttcaaat gttctccagt    660

cattatgtta atatttctga ggagcctgca acatgccagc cactgtgata gaggctggcg    720

gatccaagca aatggccaat gagatcattg tgaaggcagg ggaatgtatg tgcacatctg    780

ttttgtaact gtttagatga atgtcagttg ttatttattg aaatgatttc acagtgtgtg    840

gtcaacattt ctcatgttga aactttaaga actaaaatgt tctaaatatc ccttggacat    900

tttatgtctt tcttgtaagg catactgcct tgtttaatgg tagttttaca gtgtttctgg    960

cttagaacaa aggggcttaa ttattgatgt tttcatagag aatataaaaa taaagcactt    1020

atag                                                                 1024

<210>6

<211>1064

<212>DNA

<213>people

<220>

<221>misc_feature

<222>(27)..(27)

<223>n=a, c, g, t

<220>

<221>misc_feature

<222>(766)..(766)

<223>n=a, c, g, t

<400>6

cacagccggg tcgcaggcac ctccccngcc agctctcccg cattctgcac agcttcccga    60

cgcgtctgct gagccccatg gcccacgcca cgctctccgc cgcccccagc aatccccggc    120

tcctgcgggt ggcgctgctg ctcctgctcc tggtgggcag ccggcgcgca gcaggagcgt    180

ccgtggtcac tgaactgcgc tgccagtgct tgcagacact gcagggaatt cacctcaaga    240

acatccaaag tgtgaatgta aggtcccccg gaccccactg cgcccaaacc gaagtcatag    300

ccacactcaa gaatgggaag aaagcttgtc tcaaccccgc atcccccatg gttcagaaaa    360

tcatcgaaaa gatactgaac aaggggagca ccaactgaca ggagagaagt aagaagctta    420

tcagcgtatc attgacactt cctgcagggt ggtccctgcc cttaccagag ctgaaaatga    480

aaaagagaac agcagctttc tagggacagc tggaaaggga cttaatgtgt ttgactattt    540

cttacgaggg ttctacttat ttatgtattt atttttgaaa gcttgtattt taatatttta    600

catgctgtta tttaaagatg tgagtgtgtt tcatcaaaca tagctcagtc ctgattattt    660

aattggaata tgatgggttt taaatgtgtc attaaactaa tatttagtgg gagaccataa    720

tgtgtcagcc accttgataa atgacagggt ggggaactgg agggtngggg gattgaaatg    780

caagcaatta gtggatcact gttagggtaa gggaatgtat gtacacatct attttttata    840

cttttttttt taaaaaagaa tgtcagttgt tatttattca aattatctca cattatgtgt    900

tcaacatttt tatgctgaag tttcccttag acattttatg tcttgcttgt agggcataat    960

gccttgttta atgtccattc tgcagcgttt ctctttccct tggaaaagag aatttatcat    1020

tactgttaca tttgtacaaa tgacatgata ataaaagttt tatg                     1064

<210>7

<211>1469

<212>DNA

<213>people

<400>7

agcagcagga ggaggcagag cacagcatcg tcgggaccag actcgtctca ggccagttgc    60

agccttctca gccaaacgcc gaccaaggaa aactcactac catgagaatt gcagtgattt    120

gcttttgcct cctaggcatc acctgtgcca taccagttaa acaggctgat tctggaagtt    180

ctgaggaaaa gcagctttac aacaaatacc cagatgctgt ggccacatgg ctaaaccctg    240

acccatctca gaagcagaat ctcctagccc cacagaccct tccaagtaag tccaacgaaa    300

gccatgacca catggatgat atggatgatg aagatgatga tgaccatgtg gacagccagg    360

actccattga ctcgaacgac tctgatgatg tagatgacac tgatgattct caccagtctg    420

atgagtctca ccattctgat gaatctgatg aactggtcac tgattttccc acggacctgc    480

cagcaaccga agttttcact ccagttgtcc ccacagtaga cacatatgat ggccgaggtg    540

atagtgtggt ttatggactg aggtcaaaat ctaagaagtt tcgcagacct gacatccagt    600

accctgatgc tacagacgag gacatcacct cacacatgga aagcgaggag ttgaatggtg    660

catacaaggc catccccgtt gcccaggacc tgaacgcgcc ttctgattgg gacagccgtg    720

ggaaggacag ttatgaaacg agtcagctgg atgaccagag tgctgaaacc cacagccaca    780

agcagtccag attatataag cggaaagcca atgatgagag caatgagcat tccgatgtga    840

ttgatagtca ggaactttcc aaagtcagcc gtgaattcca cagccatgaa tttcacagcc    900

atgaagatat gctggttgta gaccccaaaa gtaaggaaga agataaacac ctgaaatttc    960

gtatttctca tgaattagat agtgcatctt ctgaggtcaa ttaaaaggag aaaaaataca    1020

atttctcact ttgcatttag tcaaaagaaa aaatgcttta tagcaaaatg aaagagaaca    1080

tgaaatgctt ctttctcagt ttattggttg aatgtgtatc tatttgagtc tggaaataac    1140

taatgtgttt gataattagt ttagtttgtg gcttcatgga aactccctgt aaactaaaag    1200

cttcagggtt atgtctatgt tcattctata gaagaaatgc aaactatcac tgtattttaa    1260

tatttgttat tctctcatga atagaaattt atgtagaagc aaacaaaata cttttaccca    1320

cttaaaaaga gaatataaca ttttatgtca ctataatctt ttgtttttta agttagtgta    1380

tattttgttg tgattatctt tttgtggtgt gaataaatct tttatcttga atgtaataag    1440

aaaaaaaaaa aaaaaacaaa aaaaaaaaa                                      1469

<210>8

<211>1256

<212>DNA

<213>people

<400>8

gcagtagcag cgagcagcag agtccgcacg ctccggcgag gggcagaaga gcgcgaggga    60

gcgcggggca gcagaagcga gagccgagcg cggacccagc caggacccac agccctcccc    120

agctgcccag gaagagcccc agccatggaa caccagctcc tgtgctgcga agtggaaacc    180

atccgccgcg cgtaccccga tgccaacctc ctcaacgacc gggtgctgcg ggccatgctg    240

aaggcggagg agacctgcgc gccctcggtg tcctacttca aatgtgtgca gaaggaggtc    300

ctgccgtcca tgcggaagat cgtcgccacc tggatgctgg aggtctgcga ggaacagaag    360

tgcgaggagg aggtcttccc gctggccatg aactacctgg accgcttcct gtcgctggag    420

cccgtgaaaa agagccgcct gcagctgctg ggggccactt gcatgttcgt ggcctctaag    480

atgaaggaga ccatccccct gacggccgag aagctgtgca tctacaccga cggctccatc    540

cggcccgagg agctgctgca aatggagctg ctcctggtga acaagctcaa gtggaacctg    600

gccgcaatga ccccgcacga tttcattgaa cacttcctct ccaaaatgcc agaggcggag    660

gagaacaaac agatcatccg caaacacgcg cagaccttcg ttgcctcttg tgccacagat    720

gtgaagttca tttccaatcc gccctccatg gtggcagcgg ggagcgtggt ggccgcagtg    780

caaggcctga acctgaggag ccccaacaac ttcctgtcct actaccgcct cacacgcttc    840

ctctccagag tgatcaagtg tgacccagac tgcctccggg cctgccagga gcagatcgaa    900

gccctgctgg agtcaagcct gcgccaggcc cagcagaaca tggaccccaa ggccgccgag    960

gaggaggaag aggaggagga ggaggtggac ctggcttgca cacccaccga cgtgcgggac    1020

gtggacatct gaggggccca ggcaggcggg cgccaccgcc acccgcagcg agggcggagc    1080

cggccccagg tgctccacat gacagtccct cctctccgga gcattttgat accagaaggg    1140

aaagcttcat tctccttgtt gttggttgtt ttttcctttg ctctttcccc cttccatctc    1200

tgacttaagc aaaagaaaaa gattacccaa aaactgtctt taaaagagag agagag        1256

<210>9

<211>2121

<212>DNA

<213>people

<400>9

ctgctcgcgg ccgccaccgc cgggccccgg ccgtccctgg ctcccctcct gcctcgagaa    60

gggcagggct tctcagaggc ttggcgggaa aaaagaacgg agggagggat cgcgctgagt    120

ataaaagccg gttttcgggg ctttatctaa ctcgctgtag taattccagc gagaggcaga    180

gggagcgagc gggcggccgg ctagggtgga agagccgggc gagcagagct gcgctgcggg    240

cgtcctggga agggagatcc ggagcgaata gggggcttcg cctctggccc agccctcccg    300

cttgatcccc caggccagcg gtccgcaacc cttgccgcat ccacgaaact ttgcccatag    360

cagcgggcgg gcactttgca ctggaactta caacacccga gcaaggacgc gactctcccg    420

acgcggggag gctattctgc ccatttgggg acacttcccc gccgctgcca ggacccgctt    480

ctctgaaagg ctctccttgc agctgcttag acgctggatt tttttcgggt agtggaaaac    540

cagcagcctc ccgcgacgat gcccctcaac gttagcttca ccaacaggaa ctatgacctc    600

gactacgact cggtgcagcc gtatttctac tgcgacgagg aggagaactt ctaccagcag    660

cagcagcaga gcgagctgca gcccccggcg cccagcgagg atatctggaa gaaattcgag    720

ctgctgccca ccccgcccct gtcccctagc cgccgctccg ggctctgctc gccctcctac    780

gttgcggtca cacccttctc ccttcgggga gacaacgacg gcggtggcgg gagcttctcc    840

acggccgacc agctggagat ggtgaccgag ctgctgggag gagacatggt gaaccagagt    900

ttcatctgcg acccggacga cgagaccttc atcaaaaaca tcatcatcca ggactgtatg    960

tggagcggct tctcggccgc cgccaagctc gtctcagaga agctggcctc ctaccaggct    1020

gcgcgcaaag acagcggcag cccgaacccc gcccgcggcc acagcgtctg ctccacctcc    1080

agcttgtacc tgcaggatct gagcgccgcc gcctcagagt gcatcgaccc ctcggtggtc    1140

ttcccctacc ctctcaacga cagcagctcg cccaagtcct gcgcctcgca agactccagc    1200

gccttctctc cgtcctcgga ttctctgctc tcctcgacgg agtcctcccc gcagggcagc    1260

cccgagcccc tggtgctcca tgaggagaca ccgcccacca ccagcagcga ctctgaggag    1320

gaacaagaag atgaggaaga aatcgatgtt gtttctgtgg aaaagaggca ggctcctggc    1380

aaaaggtcag agtctggatc accttctgct ggaggccaca gcaaacctcc tcacagccca    1440

ctggtcctca agaggtgcca cgtctccaca catcagcaca actacgcagc gcctccctcc    1500

actcggaagg actatcctgc tgccaagagg gtcaagttgg acagtgtcag agtcctgaga    1560

cagatcagca acaaccgaaa atgcaccagc cccaggtcct cggacaccga ggagaatgtc    1620

aagaggcgaa cacacaacgt cttggagcgc cagaggagga acgagctaaa acggagcttt    1680

tttgccctgc gtgaccagat cccggagttg gaaaacaatg aaaaggcccc caaggtagtt    1740

atccttaaaa aagccacagc atacatcctg tccgtccaag cagaggagca aaagctcatt    1800

tctgaagagg acttgttgcg gaaacgacga gaacagttga aacacaaact tgaacagcta    1860

cggaactctt gtgcgtaagg aaaagtaagg aaaacgattc cttctaacag aaatgtcctg    1920

agcaatcacc tatgaacttg tttcaaatgc atgatcaaat gcaacctcac aaccttggct    1980

gagtcttgag actgaaagat ttagccataa tgtaaactgc ctcaaattgg actttgggca    2040

taaaagaact tttttatgct taccatcttt tttttttctt taacagattt gtatttaaga    2100

attgttttta aaaaatttta a                                              2121

<210>10

<211>2098

<212>DNA

<213>people

<400>10

cctgccgaag tcagttcctt gtggagccgg agctgggcgc ggattcgccg aggcaccgag    60

gcactcagag gaggcgccat gtcagaaccg gctggggatg tccgtcagaa cccatgcggc    120

agcaaggcct gccgccgcct cttcggccca gtggacagcg agcagctgag ccgcgactgt    180

gatgcgctaa tggcgggctg catccaggag gcccgtgagc gatggaactt cgactttgtc    240

accgagacac cactggaggg tgacttcgcc tgggagcgtg tgcggggcct tggcctgccc    300

aagctctacc ttcccacggg gccccggcga ggccgggatg agttgggagg aggcaggcgg    360

cctggcacct cacctgctct gctgcagggg acagcagagg aagaccatgt ggacctgtca    420

ctgtcttgta cccttgtgcc tcgctcaggg gagcaggctg aagggtcccc aggtggacct    480

ggagactctc agggtcgaaa acggcggcag accagcatga cagatttcta ccactccaaa    540

cgccggctga tcttctccaa gaggaagccc taatccgccc acaggaagcc tgcagtcctg    600

gaagcgcgag ggcctcaaag gcccgctcta catcttctgc cttagtctca gtttgtgtgt    660

cttaattatt atttgtgttt taatttaaac acctcctcat gtacataccc tggccgcccc    720

ctgcccccca gcctctggca ttagaattat ttaaacaaaa actaggcggt tgaatgagag    780

gttcctaaga gtgctgggca tttttatttt atgaaatact atttaaagcc tcctcatccc    840

gtgttctcct tttcctctct cccggaggtt gggtgggccg gcttcatgcc agctacttcc    900

tcctccccac ttgtccgctg ggtggtaccc tctggagggg tgtggctcct tcccatcgct    960

gtcacaggcg gttatgaaat tcaccccctt tcctggacac tcagacctga attctttttc    1020

atttgagaag taaacagatg gcactttgaa ggggcctcac cgagtggggg catcatcaaa    1080

aactttggag tcccctcacc tcctctaagg ttgggcaggg tgaccctgaa gtgagcacag    1140

cctagggctg agctggggac ctggtaccct cctggctctt gatacccccc tctgtcttgt    1200

gaaggcaggg ggaaggtggg gtcctggagc agaccacccc gcctgccctc atggcccctc    1260

tgacctgcac tggggagccc gtctcagtgt tgagcctttt ccctctttgg ctcccctgta    1320

ccttttgagg agccccagct acccttcttc tccagctggg ctctgcaatt cccctctgct    1380

gctgtccctc ccccttgtcc tttcccttca gtaccctctc agctccaggt ggctctgagg    1440

tgcctgtccc acccccaccc ccagctcaat ggactggaag gggaagggac acacaagaag    1500

aagggcaccc tagttctacc tcaggcagct caagcagcga ccgccccctc ctctagctgt    1560

gggggtgagg gtcccatgtg gtggcacagg cccccttgag tggggttatc tctgtgttag    1620

gggtatatga tgggggagta gatctttcta ggagggagac actggcccct caaatcgtcc    1680

agcgaccttc ctcatccacc ccatccctcc ccagttcatt gcactttgat tagcagcgga    1740

acaaggagtc agacatttta agatggtggc agtagaggct atggacaggg catgccacgt    1800

gggctcatat ggggctggga gtagttgtct ttcctggcac taacgttgag cccctggagg    1860

cactgaagtg cttagtgtac ttggagtatt ggggtctgac cccaaacacc ttccagctcc    1920

tgtaacatac tggcctggac tgttttctct cggctcccca tgtgtcctgg ttcccgtttc    1980

tccacctaga ctgtaaacct ctcgagggca gggaccacac cctgtactgt tctgtgtctt    2040

tcacagctcc tcccacaatg ctgatataca gcaggtgctc aataaacgat tcttagtg      2098

<210>11

<211>1850

<212>DNA

<213>people

<400>11

ggcccaggct gaagctcagg gccctgtctg ctctgtggac tcaacagttt gtggcaagac    60

aagctcagaa ctgagaagct gtcaccacag ttctggaggc tgggaagttc aagatcaaag    120

tgccagcaga ttcagtgtca tgtgaggacg tgcttcctgc ttcatagata agagcttgga    180

gctcggcgca caaccagcac catctggtcg cgatggtgga cacggaaagc ccactctgcc    240

ccctctcccc actcgaggcc ggcgatctag agagcccgtt atctgaagag ttcctgcaag    300

aaatgggaaa catccaagag atttcgcaat ccatcggcga ggatagttct ggaagctttg    360

gctttacgga ataccagtat ttaggaagct gtcctggctc agatggctcg gtcatcacgg    420

acacgctttc accagcttcg agcccctcct cggtgactta tcctgtggtc cccggcagcg    480

tggacgagtc tcccagtgga gcattgaaca tcgaatgtag aatctgcggg gacaaggcct    540

caggctatca ttacggagtc cacgcgtgtg aaggctgcaa gggcttcttt cggcgaacga    600

ttcgactcaa gctggtgtat gacaagtgcg accgcagctg caagatccag aaaaagaaca    660

gaaacaaatg ccagtattgt cgatttcaca agtgcctttc tgtcgggatg tcacacaacg    720

cgattcgttt tggacgaatg ccaagatctg agaaagcaaa actgaaagca gaaattctta    780

cctgtgaaca tgacatagaa gattctgaaa ctgcagatct caaatctctg gccaagagaa    840

tctacgaggc ctacttgaag aacttcaaca tgaacaaggt caaagcccgg gtcatcctct    900

caggaaaggc cagtaacaat ccaccttttg tcatacatga tatggagaca ctgtgtatgg    960

ctgagaagac gctggtggcc aagctggtgg ccaatggcat ccagaacaag gaggcggagg    1020

tccgcatctt tcactgctgc cagtgcacgt cagtggagac cgtcacggag ctcacggaat    1080

tcgccaaggc catcccaggc ttcgcaaact tggacctgaa cgatcaagtg acattgctaa    1140

aatacggagt ttatgaggcc atattcgcca tgctgtcttc tgtgatgaac aaagacggga    1200

tgctggtagc gtatggaaat gggtttataa ctcgtgaatt cctaaaaagc ctaaggaaac    1260

cgttctgtga tatcatggaa cccaagtttg attttgccat gaagttcaat gcactggaac  1320

tggatgacag tgatatctcc ctttttgtgg ctgctatcat ttgctgtgga gatcgtcctg  1380

gccttctaaa cgtaggacac attgaaaaaa tgcaggaggg tattgtacat gtgctcagac  1440

tccacctgca gagcaaccac ccggacgata tctttctctt cccaaaactt cttcaaaaaa  1500

tggcagacct ccggcagctg gtgacggagc atgcgcagct ggtgcagatc atcaagaaga  1560

cggagtcgga tgctgcgctg cacccgctac tgcaggagat ctacagggac atgtactgag  1620

ttccttcaga tcagccacac cttttccagg agttctgaag ctgacagcac tacaaaggag  1680

acgggggagc agcacgattt tgcacaaata tccaccactt taaccttaga gcttggacag  1740

tctgagctgt aggtaaccgg catattattc catatctttg ttttaaccag tacttctaag  1800

agcatagaac tcaaatgctg ggggaggtgg ctaatctcag gactgggaag             1850

<210>12

<211>1609

<212>DNA

<213>people

<400>12

ttcaagtctt tttcttttaa cggattgatc ttttgctaga tagagacaaa atatcagtgt    60

gaattacagc aaacccctat tccatgctgt tatgggtgaa actctgggag attctcctat    120

tgacccagaa agcgattcct tcactgatac actgtctgca aacatatcacaagaaatgac     180

catggttgac acagagatgc cattctggcc caccaacttt gggatcagct ccgtggatct    240

ctccgtaatg gaagaccact cccactcctt tgatatcaag cccttcacta ctgttgactt    300

ctccagcatt tctactccac attacgaaga cattccattc acaagaacag atccagtggt    360

tgcagattac aagtatgacc tgaaacttca agagtaccaa agtgcaatca aagtggagcc    420

tgcatctcca ccttattatt ctgagaagac tcagctctac aataagcctc atgaagagcc    480

ttccaactcc ctcatggcaa ttgaatgtcg tgtctgtgga gataaagctt ctggatttca    540

ctatggagtt catgcttgtg aaggatgcaa gggtttcttc cggagaacaa tcagattgaa    600

gcttatctat gacagatgtg atcttaactg tcggatccac aaaaaaagta gaaataaatg    660

tcagtactgt cggtttcaga aatgccttgc agtggggatg tctcataatg ccatcaggtt    720

tgggcggatg ccacaggccg agaaggagaa gctgttggcg gagatctcca gtgatatcga    780

ccagctgaat ccagagtccg ctgacctccg ggccctggca aaacatttgt atgactcata    840

cataaagtcc ttcccgctga ccaaagcaaa ggcgagggcg atcttgacag gaaagacaac    900

agacaaatca ccattcgtta tctatgacat gaattcctta atgatgggag aagataaaat    960

caagttcaaa cacatcaccc ccctgcagga gcagagcaaa gaggtggcca tccgcatctt    1020

tcagggctgc cagtttcgct ccgtggaggc tgtgcaggag atcacagagt atgccaaaag    1080

cattcctggt tttgtaaatc ttgacttgaa cgaccaagta actctcctca aatatggagt    1140

ccacgagatc atttacacaa tgctggcctc cttgatgaat aaagatgggg ttctcatatc    1200

cgagggccaa ggcttcatga caagggagtt tctaaagagc ctgcgaaagc cttttggtga    1260

ctttatggag cccaagtttg agtttgctgt gaagttcaat gcactggaat tagatgacag    1320

cgacttggca atatttattg ctgtcattat tctcagtgga gaccgcccag gtttgctgaa    1380

tgtgaagccc attgaagaca ttcaagacaa cctgctacaa gccctggagc tccagctgaa    1440

gctgaaccac cctgagtcct cacagctgtt tgccaagctg ctccagaaaa tgacagacct    1500

cagacagatt gtcacggaac acgtgcagct actgcaggtg atcaagaaga cggagacaga    1560

catgagtctt cacccgctcc tgcaggagat ctacaaggac ttgtactag                1609

<210>13

<211>3301

<212>DNA

<213>people

<220>

<221>misc_feature

<222>(2966)..(2973)

<223>n=a, c, g, t

<400>13

gaattctgcg gagcctgcgg gacggcggcg ggttggcccg taggcagccg ggacagtgtt    60

gtacagtgtt ttgggcatgc acgtgatact cacacagtgg cttctgctca ccaacagatg    120

aagacagatg caccaacgag ggtctggaat ggtctggagt ggtctggaaa gcagggtcag    180

atacccctgg aaaactgaag cccgtggagc aatgatctct acaggactgc ttcaaggctg    240

atgggaacca ccctgtagag gtccatctgc gttcagaccc agacgatgcc agagctatga    300

ctgggcctgc aggtgtggcg ccgaggggag atcagccatg gagcagccac aggaggaagc    360

ccctgaggtc cgggaagagg aggagaaaga ggaagtggca gaggcagaag gagccccaga    420

gctcaatggg ggaccacagc atgcacttcc ttccagcagc tacacagacc tctcccggag    480

ctcctcgcca ccctcactgc tggaccaact gcagatgggc tgtgacgggg cctcatgcgg    540

cagcctcaac atggagtgcc gggtgtgcgg ggacaaggca tcgggcttcc actacggtgt    600

tcatgcatgt gaggggtgca agggcttctt ccgtcgtacg atccgcatga agctggagta    660

cgagaagtgt gagcgcagct gcaagattca gaagaagaac cgcaacaagt gccagtactg    720

ccgcttccag aagtgcctgg cactgggcat gtcacacaac gctatccgtt ttggtcggat    780

gccggaggct gagaagagga agctggtggc agggctgact gcaaacgagg ggagccagta    840

caacccacag gtggccgacc tgaaggcctt ctccaagcac atctacaatg cctacctgaa    900

aaacttcaac atgaccaaaa agaaggcccg cagcatcctc accggcaaag ccagccacac    960

ggcgcccttt gtgatccacg acatcgagac attgtggcag gcagagaagg ggctggtgtg    1020

gaagcagttg gtgaatggcc tgcctcccta caaggagatc agcgtgcacg tcttctaccg    1080

ctgccagtgc accacagtgg agaccgtgcg ggagctcact gagttcgcca agagcatccc    1140

cagcttcagc agcctcttcc tcaacgacca ggttaccctt ctcaagtatg gcgtgcacga    1200

ggccatcttc gccatgctgg cctctatcgt caacaaggac gggctgctgg tagccaacgg    1260

cagtggcttt gtcacccgtg agttcctgcg cagcctccgc aaacccttca gtgatatcat    1320

tgagcctaag tttgaatttg ctgtcaagtt caacgccctg gaacttgatg acagtgacct    1380

ggccctattc attgcggcca tcattctgtg tggagaccgg ccaggcctca tgaacgttcc    1440

acgggtggag gctatccagg acaccatcct gcgtgccctc gaattccacc tgcaggccaa    1500

ccaccctgat gcccagtacc tcttccccaa gctgctgcag aagatggctg acctgcggca    1560

actggtcacc gagcacgccc agatgatgca gcggatcaag aagaccgaaa ccgagacctc    1620

gctgcaccct ctgctccagg agatctacaa ggacatgtac taacggcggc acccaggcct    1680

ccctgcagac tccaatgggg ccagcactgg aggggcccac ccacatgact tttccattga    1740

ccagctctct tcctgtcttt gttgtctccc tctttctcag ttcctctttc ttttctaatt    1800

cctgttgctc tgtttcttcc tttctgtagg tttctctctt cccttctccc ttctcccttg    1860

ccctcccttt ctctctccta tccccacgtc tgtcctcctt tcttattctg tgagatgttt    1920

tgtattattt caccagcagc atagaacagg acctctgctt ttgcacacct tttccccagg    1980

agcagaagag agtgggcctg ccctctgccc catcattgca cctgcaggct taggtcctca    2040

cttctgtctc ctgtcttcag agcaaaagac ttgagccatc caaagaaaca ctaagctctc    2100

tgggcctggg ttccagggaa ggctaagcat ggcctggact gactgcagcc ccctatagtc    2160

atggggtccc tgctgcaaag gacagtggca gaccccggca gtagagccga gatgcctccc    2220

caagactgtc attgcccctc cgatcgtgag gccacccact gacccaatga tcctctccag    2280

cagcacacct cagccccact gacacccagt gtccttccat cttcacactg gtttgccagg    2340

ccaatgttgc tgatggcccc tccagcacac acacataagc actgaaatca ctttacctgc    2400

aggcaccatg cacctccctt ccctccctga ggcaggtgag aacccagaga gaggggcctg    2460

caggtgagca ggcagggctg ggccaggtct ccggggaggc aggggtcctg caggtcctgg    2520

tgggtcagcc cagcacctcg cccagtggga gcttcccggg ataaactgag cctgttcatt    2580

ctgatgtcca tttgtcccaa tagctctact gccctcccct tcccctttac tcagcccagc    2640

tggccaccta gaagtctccc tgcacagcct ctagtgtccg gggaccttgt gggaccagtc    2700

ccacaccgct ggtccctgcc ctcccctgct cccaggttga ggtgcgctca cctcagagca    2760

gggccaaagc acagctgggc atgccatgtc tgagcggcgc agagccctcc aggcctgcag    2820

gggcaagggg ctggctggag tctcagagca cagaggtagg agaactgggg ttcaagccca    2880

ggcttcctgg gtcctgcctg gtcctccctc ccaaggagcc attctatgtg actctgggtg    2940

gaagtgccca gcccctgcct gacggnnnnn nngatcactc tctgctggca ggattcttcc    3000

cgctccccac ctacccagct gatgggggtt ggggtgcttc tttcagccaa ggctatgaag    3060

ggacagctgc tgggacccac ctcccccctt ccccggccac atgccgcgtc cctgccccca    3120

cccgggtctg gtgctgagga tacagctctt ctcagtgtct gaacaatctc caaaattgaa    3180

atgtatattt ttgctaggag ccccagcttc ctgtgttttt aatataaata gtgtacacag    3240

actgacgaaa ctttaaataa atgggaatta aatatttaaa aaaaaaagcg gccgcgaatt    3300

c                                                                    3301

<210>14

<211>3083

<212>DNA

<213>people

<400>14

aaaaactgca gccaacttcc gaggcagcct cattgcccag cggaccccag cctctgccag    60

gttcggtccg ccatcctcgt cccgtcctcc gccggcccct gccccgcgcc cagggatcct    120

ccagctcctt tcgcccgcgc cctccgttcg ctccggacac catggacaag ttttggtggc    180

acgcagcctg gggactctgc ctcgtgccgc tgagcctggc gcagatcgat ttgaatataa    240

cctgccgctt tgcaggtgta ttccacgtgg agaaaaatgg tcgctacagc atctctcgga    300

cggaggccgc tgacctctgc aaggctttca atagcacctt gcccacaatg gcccagatgg    360

agaaagctct gagcatcgga tttgagacct gcaggtatgg gttcatagaa gggcacgtgg    420

tgattccccg gatccacccc aactccatct gtgcagcaaa caacacaggg gtgtacatcc    480

tcacatccaa cacctcccag tatgacacat attgcttcaa tgcttcagct ccacctgaag    540

aagattgtac atcagtcaca gacctgccca atgcctttga tggaccaatt accataacta    600

ttgttaaccg tgatggcacc cgctatgtcc agaaaggaga atacagaacg aatcctgaag    660

acatctaccc cagcaaccct actgatgatg acgtgagcag cggcttttct actgtacacc    720

ccatcccaga cgaagacagt ccctggatca cctcctccag tgaaaggagc agcacttcag    780

gaggttacat cttttacacc gacagcacag acagaatccc tgctaccact ttgatgagca    840

ctagtgctac agcaactgag acagcaacca agaggcaaga aacctgggat tggttttcat    900

ggttgtttct accatcagag tcaaagaatc atcttcacac aacaacacaa atggctggta    960

cgtcttcaaa taccatctca gcaggctggg agccaaatga agaaaatgaa gatgaaagag    1020

acagacacct cagtttttct ggatcaggca ttgatgatga tgaagatttt atctccagca    1080

ccatttcaac cacaccacgg gcttttgacc acacaaaaca gaaccaggac tggacccagt    1140

ggaacccaag ccattcaaat ccggaagtgc tacttcagac aaccacaagg atgactgatg    1200

tagacagaaa tggcaccact gcttatgaag gaaactggaa cccagaagca caccctcccc    1260

tcattcacca tgagcatcat gaggaagaag agaccccaca ttctacaagc acaatccagg    1320

caactcctag tagtacaacg gaagaaacag ctacccagaa ggaacagtgg tttggcaaca    1380

gatggcatga gggatatcgc caaacaccca aagaagactc ccatttcaac ccaatctcac    1440

accccatggg acgaggtcat caagcaggaa gatcgacaac agggacagct gcagcctcag    1500

ctcataccag ccatccaatg caaggaagga caacaccaag cccagaggac agttcctgga    1560

ctgatttcag gatggatatg gactccagtc atagtataac gcttcagcct actgcaaatc    1620

caaacacagg tttggtggaa gatttggaca ggacaggacc tctttcaatg acaacgcagc    1680

agagtaattc tcagagcttc tctacatcac atgaaggctt ggaagaagat aaagaccatc    1740

caacaacttc tactctgaca tcaagcaata ggaatgatgt cacaggtgga agaagagacc    1800

caaatcattc tgaaggctca actactttac tggaaggtta tacctctcat tacccacaca    1860

cgaaggaaag caggaccttc atcccagtga cctcagctaa gactgtcaat cgttccttat    1920

caggagacca agacacattc caccccagtg gggggtcctt tggagttact gcagttactg    1980

ttggagattc caactctaat gggtcccata ccactcatgg atctgaatca gatggacact    2040

cacatgggag tcaagaaggt ggagcaaaca caacctctgg tcctataagg acaccccaaa    2100

ttccagaatg gctgatcatc ttggcatccc tcttggcctt ggctttgatt cttgcagttt    2160

gcattgcagt caacagtcga agaaggtgtg ggcagaagaa aaagctagtg atcaacagtg    2220

gcaatggagc tgtggaggac agaaagccaa gtggactcaa cggagaggcc agcaagtctc    2280

aggaaatggt gcatttggtg aacaaggagt cgtcagaaac tccagaccag tttatgacag    2340

ctgatgagac aaggaacctg cagaatgtgg acatgaagat tggggtgtaa cacctacacc    2400

attatcttgg aaagaaacaa ccgttggaaa cataaccatt acagggagct gggacactta    2460

acagatgcaa tgtgctactg attgtttcat tgcgaatctt ttttagcata aaattttcta    2520

ctctttttgt tttttgtgtt ttgttcttta aagtcaggtc caatttgtaa aaacagcatt    2580

gctttctgaa attagggccc aattaataat cagcaagaat ttgatcgttc cagttcccac    2640

ttggaggcct ttcatccctc gggtgtgcta tggatggctt ctaacaaaaa ctacacatat    2700

gtattcctga tcgccaacct ttcccccacc agctaaggac atttcccagg gttaataggg    2760

cctggtccct gggaggaaat ttgaatgggt ccattttgcc cttccatagc ctaatccctg    2820

ggcattgctt tccactgagg ttgggggttg gggtgtacta gttacacatc ttcaacagac    2880

cccctctaga aatttttcag atgcttctgg gagacaccca aagggtgaag ctatttatct    2940

gtagtaaact atttatctgt gtttttgaaa tattaaaccc tggatcagtc ctttgatcag    3000

tataattttt taaagttact ttgtcagagg cacaaaaggg tttaaactga ttcataataa    3060

atatctgtac ttcttcgatc ttc                                            3083

<210>15

<211>2539

<212>DNA

<213>people

<400>15

ggagtctctt gctctggttc ttgctgttcc tgctcctgct cccgccgctc cccgtcctgc    60

tcgcggaccc aggggcgccc acgccagtga atccctgttg ttactatcca tgccagcacc    120

agggcatctg tgtccgcttc ggccttgacc gctaccagtg tgactgcacc cgcacgggct    180

attccggccc caactgcacc atccctggcc tgtggacctg gctccggaat tcactgcggc    240

ccagcccctc tttcacccac ttcctgctca ctcacgggcg ctggttctgg gagtttgtca    300

atgccacctt catccgagag atgctcatgc gcctggtact cacagtgcgc tccaacctta    360

tccccagtcc ccccacctac aactcagcac atgactacat cagctgggag tctttctcca    420

acgtgagcta ttacactcgt attctgccct ctgtgcctaa agattgcccc acacccatgg    480

gaaccaaagg gaagaagcag ttgccagatg cccagctcct ggcccgccgc ttcctgctca    540

ggaggaagtt catacctgac ccccaaggca ccaacctcat gtttgccttc tttgcacaac    600

acttcaccca ccagttcttc aaaacttctg gcaagatggg tcctggcttc accaaggcct    660

tgggccatgg ggtagacctc ggccacattt atggagacaa tctggagcgt cagtatcaac    720

tgcggctctt taaggatggg aaactcaagt accaggtgct ggatggagaa atgtacccgc    780

cctcggtaga agaggcgcct gtgttgatgc actacccccg aggcatcccg ccccagagcc    840

agatggctgt gggccaggag gtgtttgggc tgcttcctgg gctcatgctg tatgccacgc    900

tctggctacg tgagcacaac cgtgtgtgtg acctgctgaa ggctgagcac cccacctggg    960

gcgatgagca gcttttccag acgacccgcc tcatcctcat aggggagacc atcaagattg    1020

tcatcgagga gtacgtgcag cagctgagtg gctatttcct gcagctgaaa tttgacccag    1080

agctgctgtt cggtgtccag ttccaatacc gcaaccgcat tgccatggag ttcaaccatc    1140

tctaccactg gcaccccctc atgcctgact ccttcaaggt gggctcccag gagtacagct    1200

acgagcagtt cttgttcaac acctccatgt tggtggacta tggggttgag gccctggtgg    1260

atgccttctc tcgccagatt gctggccgga tcggtggggg caggaacatg gaccaccaca    1320

tcctgcatgt ggctgtggat gtcatcaggg agtctcggga gatgcggctg cagcccttca    1380

atgagtaccg caagaggttt ggcatgaaac cctacacctc cttccaggag ctcgtaggag    1440

agaaggagat ggcagcagag ttggaggaat tgtatggaga cattgatgcg ttggagttct    1500

accctggact gcttcttgaa aagtgccatc caaactctat ctttggggag agtatgatag    1560

agattggggc tcccttttcc ctcaagggtc tcctagggaa tcccatctgt tctccggagt    1620

actggaagcc gagcacattt ggcggcgagg tgggctttaa cattgtcaag acggccacac    1680

tgaagaagct ggtctgcctc aacaccaaga cctgtcccta cgtttccttc cgtgtgccgg    1740

atgccagtca ggatgatggg cctgctgtgg agcgaccatc cacagagctc tgaggggcag    1800

gaaagcagca ttctggaggg gagagctttg tgcttgtcat tccagagtgc tgaggccagg    1860

gctgatggtc ttaaatgctc attttctggt ttggcatggt gagtgttggg gttgacattt    1920

agaactttaa gtctcaccca ttatctggaa tattgtgatt ctgtttattc ttccagaatg    1980

ctgaactcct tgttagccct tcagattgtt aggagtggtt ctcatttggt ctgccagaat    2040

actgggttct tagttgacaa cctagaatgt cagatttctg gttgatttgt aacacagtca    2100

ttctaggatg tggagctact gatgaaatct gctagaaagt tagggggttc ttattttgca    2160

ttccagaatc ttgactttct gattggtgat tcaaagtgtt gtgttcctgg ctgatgatcc    2220

agaacagtgg ctcgtatccc aaatctgtca gcatctggct gtctagaatg tggatttgat    2280

tcattttcct gttcagtgag atatcataga gacggagatc ctaaggtcca acaagaatgc    2340

attccctgaa tctgtgcctg cactgagagg gcaaggaagt ggggtgttct tcttgggacc    2400

cccactaaga ccctggtctg aggatgtaga gagaacaggt gggctgtatt cacgccattg    2460

gttggaagct accagagctc tatccccatc caggtcttga ctcatggcag ctgtttctca    2520

tgaagctaat aaaattcgc                                                 2539

<210>16

<211>369

<212>DNA

<213>people

<400>16

atgaagcttc tcacgggcct ggttttctgc tccttggtcc tgggtgtcag cagccgaagc    60

ttcttttcgt tccttggcga ggcttttgat ggggctcggg acatgtggag agcctactct    120

gacatgagag aagccaatta catcggctca gacaaatact tccatgctcg ggggaactat    180

gatgctgcca aaaggggacc tgggggtgtc tgggctgcag aagcgatcag cgatgccaga    240

gagaatatcc agagattctt tggccatggt gcggaggact cgctggctga tcaggctgcc    300

aatgaatggg gcaggagtgg caaagacccc aatcacttcc gacctgctgg cctgcctgag    360

aaatactga                                                            369

<210>17

<211>67

<212>PRT

<213>people

<400>17

Met Thr Ser Lys Leu Ala Val Ala Leu Leu Ala Ala Phe Leu Ile Ser

1               5                   10                  15

Ala Ala Leu Cys Glu Gly Ala Val Leu Pro Arg Ser Ala Lys Glu Leu

            20                  25                  30

Arg Cys Gln Cys Ile Lys Thr Tyr Ser Lys Pro Phe His Pro Lys Phe

        35                  40                  45

Ile Lys Glu Leu Arg Val Ile Glu Ser Gly Pro His Cys Ala Asn Thr

    50                  55                  60

Glu Ile Met

65

<210>18

<211>604

<212>PRT

<213>people

<400>18

Met Leu Ala Arg Ala Leu Leu Leu Cys Ala Val Leu Ala Leu Ser His

1               5                   10                  15

Thr Ala Asn Pro Cys Cys Ser His Pro Cys Gln Asn Arg Gly Val Cys

            20                  25                  30

Met Ser Val Gly Phe Asp Gln Tyr Lys Cys Asp Cys Thr Arg Thr Gly

        35                  40                  45

Phe Tyr Gly Glu Asn Cys Ser Thr Pro Glu Phe Leu Thr Arg Ile Lys

    50                  55                  60

Leu Phe Leu Lys Pro Thr Pro Asn Thr Val His Tyr Ile Leu Thr His

65                  70                  75                  80

Phe Lys Gly Phe Trp Asn Val Val Asn Asn Ile Pro Phe Leu Arg Asn

                85                  90                  95

Ala Ile Met Ser Tyr Val Leu Thr Ser Arg Ser His Leu Ile Asp Ser

            100                 105                 110

Pro Pro Thr Tyr Asn Ala Asp Tyr Gly Tyr Lys Ser Trp Glu Ala Phe

        115                 120                 125

Ser Asn Leu Ser Tyr Tyr Thr Arg Ala Leu Pro Pro Val Pro Asp Asp

    130                 135                 140

Cys Pro Thr Pro Leu Gly Val Lys Gly Lys Lys Gln Leu Pro Asp Ser

145                 150                 155                 160

Asn Glu Ile Val Glu Lys Leu Leu Leu Arg Arg Lys Phe Ile Pro Asp

                165                 170                 175

Pro Gln Gly Ser Asn Met Met Phe Ala Phe Phe Ala Gln His Phe Thr

            180                 185                 190

His Gln Phe Phe Lys Thr Asp His Lys Arg Gly Pro Ala Phe Thr Asn

        195                 200                 205

Gly Leu Gly His Gly Val Asp Leu Asn His Ile Tyr Gly Glu Thr Leu

    210                 215                 220

Ala Arg Gln Arg Lys Leu Arg Leu Phe Lys Asp Gly Lys Met Lys Tyr

225                 230                 235                 240

Gln Ile Ile Asp Gly Glu Met Tyr Pro Pro Thr Val Lys Asp Thr Gln

                245                 250                 255

Ala Glu Met Ile Tyr Pro Pro Gln Val Pro Glu His Leu Arg Phe Ala

            260                 265                 270

Val Gly Gln Glu Val Phe Gly Leu Val Pro Gly Leu Met Met Tyr Ala

        275                 280                 285

Thr Ile Trp Leu Arg Glu His Asn Arg Val Cys Asp Val Leu Lys Gln

    290                 295                 300

Glu His Pro Glu Trp Gly Asp Glu Gln Leu Phe Gln Thr Ser Arg Leu

305                 310                 315                 320

Ile Leu Ile Gly Glu Thr Ile Lys Ile Val Ile Glu Asp Tyr Val Gln

                325                 330                 335

His Leu Ser Gly Tyr His Phe Lys Leu Lys Phe Asp Pro Glu Leu Leu

            340                 345                 350

Phe Asn Lys Gln Phe Gln Tyr Gln Asn Arg Ile Ala Ala Glu Phe Asn

        355                 360                 365

Thr Leu Tyr His Trp His Pro Leu Leu Pro Asp Thr Phe Gln Ile His

    370                 375                 380

Asp Gln Lys Tyr Asn Tyr Gln Gln Phe Ile Tyr Asn Asn Ser Ile Leu

385                 390                 395                 400

Leu Glu His Gly Ile Thr Gln Phe Val Glu Ser Phe Thr Arg Gln Ile

                405                 410                 415

Ala Gly Arg Val Ala Gly Gly Arg Asn Val Pro Pro Ala Val Gln Lys

            420                 425                 430

Val Ser Gln Ala Ser Ile Asp Gln Ser Arg Gln Met Lys Tyr Gln Ser

        435                 440                 445

Phe Asn Glu Tyr Arg Lys Arg Phe Met Leu Lys Pro Tyr Glu Ser Phe

    450                 455                 460

Glu Glu Leu Thr Gly Glu Lys Glu Met Ser Ala Glu Leu Glu Ala Leu

465                 470                 475                 480

Tyr Gly Asp Ile Asp Ala Val Glu Leu Tyr Pro Ala Leu Leu Val Glu

                485                 490                 495

Lys Pro Arg Pro Asp Ala Ile Phe Gly Glu Thr Met Val Glu Val Gly

            500                 505                 510

Ala Pro Phe Ser Leu Lys Gly Leu Met Gly Asn Val Ile Cys Ser Pro

        515                 520                 525

Ala Tyr Trp Lys Pro Ser Thr Phe Gly Gly Glu Val Gly Phe Gln Ile

    530                 535                 540

Ile Asn Thr Ala Ser Ile Gln Ser Leu Ile Cys Asn Asn Val Lys Gly

545                 550                 555                 560

Cys Pro Phe Thr Ser Phe Ser Val Pro Asp Pro Glu Leu Ile Lys Thr

                565                 570                 575

Val Thr Ile Asn Ala Ser Ser Ser Arg Ser Gly Leu Asp Asp Ile Asn

            580                 585                 590

Pro Thr Val Leu Leu Lys Glu Arg Ser Thr Glu Leu

        595                 600

<210>19

<211>360

<212>PRT

<213>people

<400>19

Met Glu Asp Phe Asn Met Glu Ser Asp Ser Phe Glu Asp Phe Trp Lys

1               5                   10                  15

Gly Glu Asp Leu Ser Asn Tyr Ser Tyr Ser Ser Thr Leu Pro Pro Phe

            20                  25                  30

Leu Leu Asp Ala Ala Pro Cys Glu Pro Glu Ser Leu Glu Ile Asn Lys

        35                  40                  45

Tyr Phe Val Val Ile Ile Tyr Ala Leu Val Phe Leu Leu Ser Leu Leu

    50                  55                  60

Gly Asn Ser Leu Val Met Leu Val Ile Leu Tyr Ser Arg Val Gly Arg

65                  70                  75                  80

Ser Val Thr Asp Val Tyr Leu Leu Asn Leu Ala Leu Ala Asp Leu Leu

                85                  90                  95

Phe Ala Leu Thr Leu Pro Ile Trp Ala Ala Ser Lys Val Asn Gly Trp

            100                 105                 110

Ile Phe Gly Thr Phe Leu Cys Lys Val Val Ser Leu Leu Lys Glu Val

        115                 120                 125

Asn Phe Tyr Ser Gly Ile Leu Leu Leu Ala Cys Ile Ser Val Asp Arg

    130                 135                 140

Tyr Leu Ala Ile Val His Ala Thr Arg Thr Leu Thr Gln Lys Arg Tyr

145                 150                 155                 160

Leu Val Lys Phe Ile Cys Leu Ser Ile Trp Gly Leu Ser Leu Leu Leu

                165                 170                 175

Ala Leu Pro Val Leu Leu Phe Arg Arg Thr Val Tyr Ser Ser Asn Val

            180                 185                 190

Ser Pro Ala Cys Tyr Glu Asp Met Gly Asn Asn Thr Ala Asn Trp Arg

        195                 200                 205

Met Leu Leu Arg Ile Leu Pro Gln Ser Phe Gly Phe Ile Val Pro Leu

    210                 215                 220

Leu Ile Met Leu Phe Cys Tyr Gly Phe Thr Leu Arg Thr Leu Phe Lys

225                 230                 235                 240

Ala His Met Gly Gln Lys His Arg Ala Met Arg Val Ile Phe Ala Val

                245                 250                 255

Val Leu Ile Phe Leu Leu Cys Trp Leu Pro Tyr Asn Leu Val Leu Leu

            260                 265                 270

Ala Asp Thr Leu Met Arg Thr Gln Val Ile Gln Glu Thr Cys Glu Arg

        275                 280                 285

Arg Asn His Ile Asp Arg Ala Leu Asp Ala Thr Glu Ile Leu Gly Ile

    290                 295                 300

Leu His Ser Cys Leu Asn Pro Leu Ile Tyr Ala Phe Ile Gly Gln Lys

305                 310                 315                 320

Phe Arg His Gly Leu Leu Lys Ile Leu Ala Ile His Gly Leu Ile Ser

                325                 330                 335

Lys Asp Ser Leu Pro Lys Asp Ser Arg Pro Ser Phe Val Gly Ser Ser

            340                 345                 350

Ser Gly His Thr Ser Thr Thr Leu

        355                 360

<210>20

<211>554

<212>PRT

<213>people

<400>20

Met Thr Ala Pro Gly Ala Ala Gly Arg Cys Pro Pro Thr Thr Trp Leu

1               5                   10                  15

Gly Ser Leu Leu Leu Leu Val Cys Leu Leu Ala Ser Arg Ser Ile Thr

            20                  25                  30

Glu Glu Val Ser Glu Tyr Cys Ser His Met Ile Gly Ser Gly His Leu

        35                  40                  45

Gln Ser Leu Gln Arg Leu Ile Asp Ser Gln Met Glu Thr Ser Cys Gln

    50                  55                  60

Ile Thr Phe Glu Phe Val Asp Gln Glu Gln Leu Lys Asp Pro Val Cys

65                  70                  75                  80

Tyr Leu Lys Lys Ala Phe Leu Leu Val Gln Asp Ile Met Glu Asp Thr

                85                  90                  95

Met Arg Phe Arg Asp Asn Thr Ala Asn Pro Ile Ala Ile Val Gln Leu

            100                 105                 110

Gln Glu Leu Ser Leu Arg Leu Lys Ser Cys Phe Thr Lys Asp Tyr Glu

        115                 120                 125

Glu His Asp Lys Ala Cys Val Arg Thr Phe Tyr Glu Thr Pro Leu Gln

    130                 135                 140

Leu Leu Glu Lys Val Lys Asn Val Phe Asn Glu Thr Lys Asn Leu Leu

145                 150                 155                 160

Asp Lys Asp Trp Asn Ile Phe Ser Lys Asn Cys Asn Asn Ser Phe Ala

                165                 170                 175

Glu Cys Ser Ser Gln Asp Val Val Thr Lys Pro Asp Cys Asn Cys Leu

            180                 185                 190

Tyr Pro Lys Ala Ile Pro Ser Ser Asp Pro Ala Ser Val Ser Pro His

        195                 200                 205

Gln Pro Leu Ala Pro Ser Met Ala Pro Val Ala Gly Leu Thr Trp Glu

    210                 215                 220

Asp Ser Glu Gly Thr Glu Gly Ser Ser Leu Leu Pro Gly Glu Gln Pro

225                 230                 235                 240

Leu His Thr Val Asp Pro Gly Ser Ala Lys Gln Arg Pro Pro Arg Ser

                245                 250                 255

Thr Cys Gln Ser Phe Glu Pro Pro Glu Thr Pro Val Val Lys Asp Ser

            260                 265                 270

Thr Ile Gly Gly Ser Pro Gln Pro Arg Pro Ser Val Gly Ala Phe Asn

        275                 280                 285

Pro Gly Met Glu Asp Ile Leu Asp Ser Ala Met Gly Thr Asn Trp Val

    290                 295                 300

Pro Glu Glu Ala Ser Gly Glu Ala Ser Glu Ile Pro Val Pro Gln Gly

305                 310                 315                 320

Thr Glu Leu Ser Pro Ser Arg Pro Gly Gly Gly Ser Met Gln Thr Glu

                325                 330                 335

Pro Ala Arg Pro Ser Asn Phe Leu Ser Ala Ser Ser Pro Leu Pro Ala

            340                 345                 350

Ser Ala Lys Gly Gln Gln Pro Ala Asp Val Thr Ala Thr Ala Leu Pro

        355                 360                 365

Arg Val Gly Pro Val Met Pro Thr Gly Gln Asp Trp Asn His Thr Pro

    370                 375                 380

Gln Lys Thr Asp His Pro Ser Ala Leu Leu Arg Asp Pro Pro Glu Pro

385                 390                 395                 400

Gly Ser Pro Arg Ile Ser Ser Leu Arg Pro Gln Ala Leu Ser Asn Pro

                405                 410                 415

Ser Thr Leu Ser Ala Gln Pro Gln Leu Ser Arg Ser His Ser Ser Gly

            420                 425                 430

Ser Val Leu Pro Leu Gly Glu Leu Glu Gly Arg Arg Ser Thr Arg Asp

        435                 440                 445

Arg Thr Ser Pro Ala Glu Pro Glu Ala Ala Pro Ala Ser Glu Gly Ala

    450                 455                 460

Ala Arg Pro Leu Pro Arg Phe Asn Ser Val Pro Leu Thr Asp Thr Gly

465                 470                 475                 480

His Glu Arg Gln Ser Glu Gly Ser Ser Ser Pro Gln Leu Gln Glu Ser

                485                 490                 495

Val Phe His Leu Leu Val Pro Ser Val Ile Leu Val Leu Leu Ala Val

            500                 505                 510

Gly Gly Leu Leu Phe Tyr Arg Trp Arg Arg Arg Ser His Gln Glu Pro

        515                 520                 525

Gln Arg Ala Asp Ser Pro Leu Glu Gln Pro Glu Gly Ser Pro Leu Thr

    530                 535                 540

Gln Asp Asp Arg Gln Val Glu Leu Pro Val

545                 550

<210>21

<211>107

<212>PRT

<213>people

<400>21

Met Ala Arg Ala Ala Leu Ser Ala Ala Pro Ser Asn Pro Arg Leu Leu

1               5                   10                  15

Arg Val Ala Leu Leu Leu Leu Leu Leu Val Ala Ala Gly Arg Arg Ala

            20                  25                  30

Ala Gly Ala Ser Val Ala Thr Glu Leu Arg Cys Gln Cys Leu Gln Thr

        35                  40                  45

Leu Gln Gly Ile His Pro Lys Asn Ile Gln Ser Val Asn Val Lys Ser

    50                  55                  60

Pro Gly Pro His Cys Ala Gln Thr Glu Val Ile Ala Thr Leu Lys Asn

65                  70                  75                  80

Gly Arg Lys Ala Cys Leu Asn Pro Ala Ser Pro Ile Val Lys Lys Ile

                85                  90                  95

Ile Glu Lys Met Leu Asn Ser Asp Lys Ser Asn

            100                 105

<210>22

<211>106

<212>PRT

<213>people

<400>22

Met Ala His Ala Thr Leu Ser Ala Ala Pro Ser Asn Pro Arg Leu Leu

1               5                   10                  15

Arg Val Ala Leu Leu Leu Leu Leu Leu Val Gly Ser Arg Arg Ala Ala

            20                  25                  30

Gly Ala Ser Val Val Thr Glu Leu Arg Cys Gln Cys Leu Gln Thr Leu

        35                  40                  45

Gln Gly Ile His Leu Lys Asn Ile Gln Ser Val Asn Val Arg Ser Pro

    50                  55                  60

Gly Pro His Cys Ala Gln Thr Glu Val Ile Ala Thr Leu Lys Asn Gly

65                  70                  75                  80

Lys Lys Ala Cys Leu Asn Pro Ala Ser Pro Met Val Gln Lys Ile Ile

                85                  90                  95

Glu Lys Ile Leu Asn Lys Gly Ser Thr Asn

            100                 105

<210>23

<211>300

<212>PRT

<213>people

<400>23

Met Arg Ile Ala Val Ile Cys Phe Cys Leu Leu Gly Ile Thr Cys Ala

1               5                   10                  15

Ile Pro Val Lys Gln Ala Asp Ser Gly Ser Ser Glu Glu Lys Gln Leu

            20                  25                  30

Tyr Asn Lys Tyr Pro Asp Ala Val Ala Thr Trp Leu Asn Pro Asp Pro

        35                  40                  45

Ser Gln Lys Gln Asn Leu Leu Ala Pro Gln Thr Leu Pro Ser Lys Ser

    50                  55                  60

Asn Glu Ser His Asp His Met Asp Asp Met Asp Asp Glu Asp Asp Asp

65                  70                  75                  80

Asp His Val Asp Ser Gln Asp Ser Ile Asp Ser Asn Asp Ser Asp Asp

                85                  90                  95

Val Asp Asp Thr Asp Asp Ser His Gln Ser Asp Glu Ser His His Ser

            100                 105                 110

Asp Glu Ser Asp Glu Leu Val Thr Asp Phe Pro Thr Asp Leu Pro Ala

        115                 120                 125

Thr Glu Val Phe Thr Pro Val Val Pro Thr Val Asp Thr Tyr Asp Gly

    130                 135                 140

Arg Gly Asp Ser Val Val Tyr Gly Leu Arg Ser Lys Ser Lys Lys Phe

145                 150                 155                 160

Arg Arg Pro Asp Ile Gln Tyr Pro Asp Ala Thr Asp Glu Asp Ile Thr

                165                 170                 175

Ser His Met Glu Ser Glu Glu Leu Asn Gly Ala Tyr Lys Ala Ile Pro

            180                 185                 190

Val Ala Gln Asp Leu Asn Ala Pro Ser Asp Trp Asp Ser Arg Gly Lys

        195                 200                 205

Asp Ser Tyr Glu Thr Ser Gln Leu Asp Asp Gln Ser Ala Glu Thr His

    210                 215                 220

Ser His Lys Gln Ser Arg Leu Tyr Lys Arg Lys Ala Asn Asp Glu Ser

225                 230                 235                 240

Asn Glu His Ser Asp Val Ile Asp Ser Gln Glu Leu Ser Lys Val Ser

                245                 250                 255

Arg Glu Phe His Ser His Glu Phe His Ser His Glu Asp Met Leu Val

            260                 265                 270

Val Asp Pro Lys Ser Lys Glu Glu Asp Lys His Leu Lys Phe Arg Ile

        275                 280                 285

Ser His Glu Leu Asp Ser Ala Ser Ser Glu Val Asn

    290                 295                 300

<210>24

<211>295

<212>PRT

<213>people

<400>24

Met Glu His Gln Leu Leu Cys Cys Glu Val Glu Thr Ile Arg Arg Ala

1               5                   10                  15

Tyr Pro Asp Ala Asn Leu Leu Asn Asp Arg Val Leu Arg Ala Met Leu

            20                  25                  30

Lys Ala Glu Glu Thr Cys Ala Pro Ser Val Ser Tyr Phe Lys Cys Val

        35                  40                  45

Gln Lys Glu Val Leu Pro Ser Met Arg Lys Ile Val Ala Thr Trp Met

    50                  55                  60

Leu Glu Val Cys Glu Glu Gln Lys Cys Glu Glu Glu Val Phe Pro Leu

65                  70                  75                  80

Ala Met Asn Tyr Leu Asp Arg Phe Leu Ser Leu Glu Pro Val Lys Lys

                85                  90                  95

Ser Arg Leu Gln Leu Leu Gly Ala Thr Cys Met Phe Val Ala Ser Lys

            100                 105                 110

Met Lys Glu Thr Ile Pro Leu Thr Ala Glu Lys Leu Cys Ile Tyr Thr

        115                 120                 125

Asp Gly Ser Ile Arg Pro Glu Glu Leu Leu Gln Met Glu Leu Leu Leu

    130                 135                 140

Val Asn Lys Leu Lys Trp Asn Leu Ala Ala Met Thr Pro His Asp Phe

145                 150                 155                 160

Ile Glu His Phe Leu Ser Lys Met Pro Glu Ala Glu Glu Asn Lys Gln

                165                 170                 175

Ile Ile Arg Lys His Ala Gln Thr Phe Val Ala Ser Cys Ala Thr Asp

            180                 185                 190

Val Lys Phe Ile Ser Asn Pro Pro Ser Met Val Ala Ala Gly Ser Val

        195                 200                 205

Val Ala Ala Val Gln Gly Leu Asn Leu Arg Ser Pro Asn Asn Phe Leu

    210                 215                 220

Ser Tyr Tyr Arg Leu Thr Arg Phe Leu Ser Arg Val Ile Lys Cys Asp

225                 230                 235                 240

Pro Asp Cys Leu Arg Ala Cys Gln Glu Gln Ile Glu Ala Leu Leu Glu

                245                 250                 255

Ser Ser Leu Arg Gln Ala Gln Gln Asn Met Asp Pro Lys Ala Ala Glu

            260                 265                 270

Glu Glu Glu Glu Glu Glu Glu Glu Val Asp Leu Ala Cys Thr Pro Thr

        275                 280                 285

Asp Val Arg Asp Val Asp Ile

    290                 295

<210>25

<211>439

<212>PRT

<213>people

<400>25

Met Pro Leu Asn Val Ser Phe Thr Asn Arg Asn Tyr Asp Leu Asp Tyr

1               5                   10                  15

Asp Ser Val Gln Pro Tyr Phe Tyr Cys Asp Glu Glu Glu Asn Phe Tyr

            20                  25                  30

Gln Gln Gln Gln Gln Ser Glu Leu Gln Pro Pro Ala Pro Ser Glu Asp

        35                  40                  45

Ile Trp Lys Lys Phe Glu Leu Leu Pro Thr Pro Pro Leu Ser Pro Ser

    50                  55                  60

Arg Arg Ser Gly Leu Cys Ser Pro Ser Tyr Val Ala Val Thr Pro Phe

65                  70                  75                  80

Ser Leu Arg Gly Asp Asn Asp Gly Gly Gly Gly Ser Phe Ser Thr Ala

                85                  90                  95

Asp Gln Leu Glu Met Val Thr Glu Leu Leu Gly Gly Asp Met Val Asn

            100                 105                 110

Gln Ser Phe Ile Cys Asp Pro Asp Asp Glu Thr Phe Ile Lys Asn Ile

        115                 120                 125

Ile Ile Gln Asp Cys Met Trp Ser Gly Phe Ser Ala Ala Ala Lys Leu

    130                 135                 140

Val Ser Glu Lys Leu Ala Ser Tyr Gln Ala Ala Arg Lys Asp Ser Gly

145                 150                 155                 160

Ser Pro Asn Pro Ala Arg Gly His Ser Val Cys Ser Thr Ser Ser Leu

                165                 170                 175

Tyr Leu Gln Asp Leu Ser Ala Ala Ala Ser Glu Cys Ile Asp Pro Ser

            180                 185                 190

Val Val Phe Pro Tyr Pro Leu Asn Asp Ser Ser Ser Pro Lys Ser Cys

        195                 200                 205

Ala Ser Gln Asp Ser Ser Ala Phe Ser Pro Ser Ser Asp Ser Leu Leu

    210                 215                 220

Ser Ser Thr Glu Ser Ser Pro Gln Gly Ser Pro Glu Pro Leu Val Leu

225                 230                 235                 240

His Glu Glu Thr Pro Pro Thr Thr Ser Ser Asp Ser Glu Glu Glu Gln

                245                 250                 255

Glu Asp Glu Glu Glu Ile Asp Val Val Ser Val Glu Lys Arg Gln Ala

            260                 265                 270

Pro Gly Lys Arg Ser Glu Ser Gly Ser Pro Ser Ala Gly Gly His Ser

        275                 280                 285

Lys Pro Pro His Ser Pro Leu Val Leu Lys Arg Cys His Val Ser Thr

    290                 295                 300

His Gln His Asn Tyr Ala Ala Pro Pro Ser Thr Arg Lys Asp Tyr Pro

305                 310                 315                 320

Ala Ala Lys Arg Val Lys Leu Asp Ser Val Arg Val Leu Arg Gln Ile

                325                 330                 335

Ser Asn Asn Arg Lys Cys Thr Ser Pro Arg Ser Ser Asp Thr Glu Glu

            340                 345                 350

Asn Val Lys Arg Arg Thr His Asn Val Leu Glu Arg Gln Arg Arg Asn

        355                 360                 365

Glu Leu Lys Arg Ser Phe Phe Ala Leu Arg Asp Gln Ile Pro Glu Leu

    370                 375                 380

Glu Asn Asn Glu Lys Ala Pro Lys Val Val Ile Leu Lys Lys Ala Thr

385                 390                 395                 400

Ala Tyr Ile Leu Ser Val Gln Ala Glu Glu Gln Lys Leu Ile Ser Glu

                405                 410                 415

Glu Asp Leu Leu Arg Lys Arg Arg Glu Gln Leu Lys His Lys Leu Glu

            420                 425                 430

Gln Leu Arg Asn Ser Cys Ala

        435

<210>26

<211>164

<212>PRT

<213>people

<400>26

Met Ser Glu Pro Ala Gly Asp Val Arg Gln Asn Pro Cys Gly Ser Lys

1               5                   10                  15

Ala Cys Arg Arg Leu Phe Gly Pro Val Asp Ser Glu Gln Leu Ser Arg

            20                  25                  30

Asp Cys Asp Ala Leu Met Ala Gly Cys Ile Gln Glu Ala Arg Glu Arg

        35                  40                  45

Trp Asn Phe Asp Phe Val Thr Glu Thr Pro Leu Glu Gly Asp Phe Ala

    50                  55                  60

Trp Glu Arg Val Arg Gly Leu Gly Leu Pro Lys Leu Tyr Leu Pro Thr

65                  70                  75                  80

Gly Pro Arg Arg Gly Arg Asp Glu Leu Gly Gly Gly Arg Arg Pro Gly

                85                  90                  95

Thr Ser Pro Ala Leu Leu Gln Gly Thr Ala Glu Glu Asp His Val Asp

            100                 105                 110

Leu Ser Leu Ser Cys Thr Leu Val Pro Arg Ser Gly Glu Gln Ala Glu

        115                 120                 125

Gly Ser Pro Gly Gly Pro Gly Asp Ser Gln Gly Arg Lys Arg Arg Gln

    130                 135                 140

Thr Ser Met Thr Asp Phe Tyr His Ser Lys Arg Arg Leu Ile Phe Ser

145                 150                 155                 160

Lys Arg Lys Pro

<210>27

<211>468

<212>PRT

<213>people

<400>27

Met Val Asp Thr Glu Ser Pro Leu Cys Pro Leu Ser Pro Leu Glu Ala

1               5                   10                  15

Gly Asp Leu Glu Ser Pro Leu Ser Glu Glu Phe Leu Gln Glu Met Gly

            20                  25                  30

Asn Ile Gln Glu Ile Ser Gln Ser Ile Gly Glu Asp Ser Ser Gly Ser

        35                  40                  45

Phe Gly Phe Thr Glu Tyr Gln Tyr Leu Gly Ser Cys Pro Gly Ser Asp

    50                  55                  60

Gly Ser Val Ile Thr Asp Thr Leu Ser Pro Ala Ser Ser Pro Ser Ser

65                  70                  75                  80

Val Thr Tyr Pro Val Val Pro Gly Ser Val Asp Glu Ser Pro Ser Gly

                85                  90                  95

Ala Leu Asn Ile Glu Cys Arg Ile Cys Gly Asp Lys Ala Ser Gly Tyr

            100                 105                 110

His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg

        115                 120                 125

Thr Ile Arg Leu Lys Leu Val Tyr Asp Lys Cys Asp Arg Ser Cys Lys

    130                 135                 140

Ile Gln Lys Lys Asn Arg Asn Lys Cys Gln Tyr Cys Arg Phe His Lys

145                 150                 155                 160

Cys Leu Ser Val Gly Met Ser His Asn Ala Ile Arg Phe Gly Arg Met

                165                 170                 175

Pro Arg Ser Glu Lys Ala Lys Leu Lys Ala Glu Ile Leu Thr Cys Glu

            180                 185                 190

His Asp Ile Glu Asp Ser Glu Thr Ala Asp Leu Lys Ser Leu Ala Lys

        195                 200                 205

Arg Ile Tyr Glu Ala Tyr Leu Lys Asn Phe Asn Met Asn Lys Val Lys

    210                 215                 220

Ala Arg Val Ile Leu Ser Gly Lys Ala Ser Asn Asn Pro Pro Phe Val

225                 230                 235                 240

Ile His Asp Met Glu Thr Leu Cys Met Ala Glu Lys Thr Leu Val Ala

                245                 250                 255

Lys Leu Val Ala Asn Gly Ile Gln Asn Lys Glu Ala Glu Val Arg Ile

            260                 265                 270

Phe His Cys Cys Gln Cys Thr Ser Val Glu Thr Val Thr Glu Leu Thr

        275                 280                 285

Glu Phe Ala Lys Ala Ile Pro Gly Phe Ala Asn Leu Asp Leu Asn Asp

    290                 295                 300

Gln Val Thr Leu Leu Lys Tyr Gly Val Tyr Glu Ala Ile Phe Ala Met

305                 310                 315                 320

Leu Ser Ser Val Met Asn Lys Asp Gly Met Leu Val Ala Tyr Gly Asn

                325                 330                 335

Gly Phe Ile Thr Arg Glu Phe Leu Lys Ser Leu Arg Lys Pro Phe Cys

            340                 345                 350

Asp Ile Met Glu Pro Lys Phe Asp Phe Ala Met Lys Phe Asn Ala Leu

        355                 360                 365

Glu Leu Asp Asp Ser Asp Ile Ser Leu Phe Val Ala Ala Ile Ile Cys

    370                 375                 380

Cys Gly Asp Arg Pro Gly Leu Leu Asn Val Gly His Ile Glu Lys Met

385                 390                 395                 400

Gln Glu Gly Ile Val His Val Leu Arg Leu His Leu Gln Ser Asn His

                405                 410                 415

Pro Asp Asp Ile Phe Leu Phe Pro Lys Leu Leu Gln Lys Met Ala Asp

            420                 425                 430

Leu Arg Gln Leu Val Thr Glu His Ala Gln Leu Val Gln Ile Ile Lys

        435                 440                 445

Lys Thr Glu Ser Asp Ala Ala Leu His Pro Leu Leu Gln Glu Ile Tyr

    450                 455                 460

Arg Asp Met Tyr

465

<210>28

<211>505

<212>PRT

<213>people

<400>28

Met Gly Glu Thr Leu Gly Asp Ser Pro Ile Asp Pro Glu Ser Asp Ser

1               5                   10                  15

Phe Thr Asp Thr Leu Ser Ala Asn Ile Ser Gln Glu Met Thr Met Val

            20                  25                  30

Asp Thr Glu Met Pro Phe Trp Pro Thr Asn Phe Gly Ile Ser Ser Val

        35                  40                  45

Asp Leu Ser Val Met Glu Asp His Ser His Ser Phe Asp Ile Lys Pro

    50                  55                  60

Phe Thr Thr Val Asp Phe Ser Ser Ile Ser Thr Pro His Tyr Glu Asp

65                  70                  75                  80

Ile Pro Phe Thr Arg Thr Asp Pro Val Val Ala Asp Tyr Lys Tyr Asp

                85                  90                  95

Leu Lys Leu Gln Glu Tyr Gln Ser Ala Ile Lys Val Glu Pro Ala Ser

            100                 105                 110

Pro Pro Tyr Tyr Ser Glu Lys Thr Gln Leu Tyr Asn Lys Pro His Glu

        115                 120                 125

Glu Pro Ser Asn Ser Leu Met Ala Ile Glu Cys Arg Val Cys Gly Asp

    130                 135                 140

Lys Ala Ser Gly Phe His Tyr Gly Val His Ala Cys Glu Gly Cys Lys

145                 150                 155                 160

Gly Phe Phe Arg Arg Thr Ile Arg Leu Lys Leu Ile Tyr Asp Arg Cys

                165                 170                 175

Asp Leu Asn Cys Arg Ile His Lys Lys Ser Arg Asn Lys Cys Gln Tyr

            180                 185                 190

Cys Arg Phe Gln Lys Cys Leu Ala Val Gly Met Ser His Asn Ala Ile

        195                 200                 205

Arg Phe Gly Arg Met Pro Gln Ala Glu Lys Glu Lys Leu Leu Ala Glu

    210                 215                 220

Ile Ser Ser Asp Ile Asp Gln Leu Asn Pro Glu Ser Ala Asp Leu Arg

225                 230                 235                 240

Ala Leu Ala Lys His Leu Tyr Asp Ser Tyr Ile Lys Ser Phe Pro Leu

                245                 250                 255

Thr Lys Ala Lys Ala Arg Ala Ile Leu Thr Gly Lys Thr Thr Asp Lys

            260                 265                 270

Ser Pro Phe Val Ile Tyr Asp Met Asn Ser Leu Met Met Gly Glu Asp

        275                 280                 285

Lys Ile Lys Phe Lys His Ile Thr Pro Leu Gln Glu Gln Ser Lys Glu

    290                 295                 300

Val Ala Ile Arg Ile Phe Gln Gly Cys Gln Phe Arg Ser Val Glu Ala

305                 310                 315                 320

Val Gln Glu Ile Thr Glu Tyr Ala Lys Ser Ile Pro Gly Phe Val Asn

                325                 330                 335

Leu Asp Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val His Glu

            340                 345                 350

Ile Ile Tyr Thr Met Leu Ala Ser Leu Met Asn Lys Asp Gly Val Leu

        355                 360                 365

Ile Ser Glu Gly Gln Gly Phe Met Thr Arg Glu Phe Leu Lys Ser Leu

    370                 375                 380

Arg Lys Pro Phe Gly Asp Phe Met Glu Pro Lys Phe Glu Phe Ala Val

385                 390                 395                 400

Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Leu Ala Ile Phe Ile

                405                 410                 415

Ala Val Ile Ile Leu Ser Gly Asp Arg Pro Gly Leu Leu Asn Val Lys

            420                 425                 430

Pro Ile Glu Asp Ile Gln Asp Asn Leu Leu Gln Ala Leu Glu Leu Gln

        435                 440                 445

Leu Lys Leu Asn His Pro Glu Ser Ser Gln Leu Phe Ala Lys Leu Leu

    450                 455                 460

Gln Lys Met Thr Asp Leu Arg Gln Ile Val Thr Glu His Val Gln Leu

465                 470                 475                 480

Leu Gln Val Ile Lys Lys Thr Glu Thr Asp Met Ser Leu His Pro Leu

                485                 490                 495

Leu Gln Glu Ile Tyr Lys Asp Leu Tyr

            500                 505

<210>29

<211>441

<212>PRT

<213>people

<400>29

Met Glu Gln Pro Gln Glu Glu Ala Pro Glu Val Arg Glu Glu Glu Glu

1               5                   10                  15

Lys Glu Glu Val Ala Glu Ala Glu Gly Ala Pro Glu Leu Asn Gly Gly

            20                  25                  30

Pro Gln His Ala Leu Pro Ser Ser Ser Tyr Thr Asp Leu Ser Arg Ser

        35                  40                  45

Ser Ser Pro Pro Ser Leu Leu Asp Gln Leu Gln Met Gly Cys Asp Gly

    50                  55                  60

Ala Ser Cys Gly Ser Leu Asn Met Glu Cys Arg Val Cys Gly Asp Lys

65                  70                  75                  80

Ala Ser Gly Phe His Tyr Gly Val His Ala Cys Glu Gly Cys Lys Gly

                85                  90                  95

Phe Phe Arg Arg Thr Ile Arg Met Lys Leu Glu Tyr Glu Lys Cys Glu

            100                 105                 110

Arg Ser Cys Lys Ile Gln Lys Lys Asn Arg Asn Lys Cys Gln Tyr Cys

        115                 120                 125

Arg Phe Gln Lys Cys Leu Ala Leu Gly Met Ser His Asn Ala Ile Arg

    130                 135                 140

Phe Gly Arg Met Pro Glu Ala Glu Lys Arg Lys Leu Val Ala Gly Leu

145                 150                 155                 160

Thr Ala Asn Glu Gly Ser Gln Tyr Asn Pro Gln Val Ala Asp Leu Lys

                165                 170                 175

Ala Phe Ser Lys His Ile Tyr Asn Ala Tyr Leu Lys Asn Phe Asn Met

            180                 185                 190

Thr Lys Lys Lys Ala Arg Ser Ile Leu Thr Gly Lys Ala Ser His Thr

        195                 200                 205

Ala Pro Phe Val Ile His Asp Ile Glu Thr Leu Trp Gln Ala Glu Lys

    210                 215                 220

Gly Leu Val Trp Lys Gln Leu Val Asn Gly Leu Pro Pro Tyr Lys Glu

225                 230                 235                 240

Ile Ser Val His Val Phe Tyr Arg Cys Gln Cys Thr Thr Val Glu Thr

                245                 250                 255

Val Arg Glu Leu Thr Glu Phe Ala Lys Ser Ile Pro Ser Phe Ser Ser

            260                 265                 270

Leu Phe Leu Asn Asp Gln Val Thr Leu Leu Lys Tyr Gly Val His Glu

        275                 280                 285

Ala Ile Phe Ala Met Leu Ala Ser Ile Val Asn Lys Asp Gly Leu Leu

    290                 295                 300

Val Ala Asn Gly Ser Gly Phe Val Thr Arg Glu Phe Leu Arg Ser Leu

305                 310                 315                 320

Arg Lys Pro Phe Ser Asp Ile Ile Glu Pro Lys Phe Glu Phe Ala Val

                325                 330                 335

Lys Phe Asn Ala Leu Glu Leu Asp Asp Ser Asp Leu Ala Leu Phe Ile

            340                 345                 350

Ala Ala Ile Ile Leu Cys Gly Asp Arg Pro Gly Leu Met Asn Val Pro

        355                 360                 365

Arg Val Glu Ala Ile Gln Asp Thr Ile Leu Arg Ala Leu Glu Phe His

    370                 375                 380

Leu Gln Ala Asn His Pro Asp Ala Gln Tyr Leu Phe Pro Lys Leu Leu

385                 390                 395                 400

Gln Lys Met Ala Asp Leu Arg Gln Leu Val Thr Glu His Ala Gln Met

                405                 410                 415

Met Gln Arg Ile Lys Lys Thr Glu Thr Glu Thr Ser Leu His Pro Leu

            420                 425                 430

Leu Gln Glu Ile Tyr Lys Asp Met Tyr

        435                 440

<210>30

<211>742

<212>PRT

<213>people

<400>30

Met Asp Lys Phe Trp Trp His Ala Ala Trp Gly Leu Cys Leu Val Pro

1               5                   10                  15

Leu Ser Leu Ala Gln Ile Asp Leu Asn Ile Thr Cys Arg Phe Ala Gly

            20                  25                  30

Val Phe His Val Glu Lys Asn Gly Arg Tyr Ser Ile Ser Arg Thr Glu

        35                  40                  45

Ala Ala Asp Leu Cys Lys Ala Phe Asn Ser Thr Leu Pro Thr Met Ala

    50                  55                  60

Gln Met Glu Lys Ala Leu Ser Ile Gly Phe Glu Thr Cys Arg Tyr Gly

65                  70                  75                  80

Phe Ile Glu Gly His Val Val Ile Pro Arg Ile His Pro Asn Ser Ile

                85                  90                  95

Cys Ala Ala Asn Asn Thr Gly Val Tyr Ile Leu Thr Ser Asn Thr Ser

            100                 105                 110

Gln Tyr Asp Thr Tyr Cys Phe Asn Ala Ser Ala Pro Pro Glu Glu Asp

        115                 120                 125

Cys Thr Ser Val Thr Asp Leu Pro Asn Ala Phe Asp Gly Pro Ile Thr

    130                 135                 140

Ile Thr Ile Val Asn Arg Asp Gly Thr Arg Tyr Val Gln Lys Gly Glu

145                 150                 155                 160

Tyr Arg Thr Asn Pro Glu Asp Ile Tyr Pro Ser Asn Pro Thr Asp Asp

                165                 170                 175

Asp Val Ser Ser Gly Ser Ser Ser Glu Arg Ser Ser Thr Ser Gly Gly

            180                 185                 190

Tyr Ile Phe Tyr Thr Phe Ser Thr Val His Pro Ile Pro Asp Glu Asp

        195                 200                 205

Ser Pro Trp Ile Thr Asp Ser Thr Asp Arg Ile Pro Ala Thr Thr Leu

    210                 215                 220

Met Ser Thr Ser Ala Thr Ala Thr Glu Thr Ala Thr Lys Arg Gln Glu

225                 230                 235                 240

Thr Trp Asp Trp Phe Ser Trp Leu Phe Leu Pro Ser Glu Ser Lys Asn

                245                 250                 255

His Leu His Thr Thr Thr Gln Met Ala Gly Thr Ser Ser Asn Thr Ile

            260                 265                 270

Ser Ala Gly Trp Glu Pro Asn Glu Glu Asn Glu Asp Glu Arg Asp Arg

        275                 280                 285

His Leu Ser Phe Ser Gly Ser Gly Ile Asp Asp Asp Glu Asp Phe Ile

    290                 295                 300

Ser Ser Thr Ile Ser Thr Thr Pro Arg Ala Phe Asp His Thr Lys Gln

305                 310                 315                 320

Asn Gln Asp Trp Thr Gln Trp Asn Pro Ser His Ser Asn Pro Glu Val

                325                 330                 335

Leu Leu Gln Thr Thr Thr Arg Met Thr Asp Val Asp Arg Asn Gly Thr

            340                 345                 350

Thr Ala Tyr Glu Gly Asn Trp Asn Pro Glu Ala His Pro Pro Leu Ile

        355                 360                 365

His His Glu His His Glu Glu Glu Glu Thr Pro His Ser Thr Ser Thr

    370                 375                 380

Ile Gln Ala Thr Pro Ser Ser Thr Thr Glu Glu Thr Ala Thr Gln Lys

385                 390                 395                 400

Glu Gln Trp Phe Gly Asn Arg Trp His Glu Gly Tyr Arg Gln Thr Pro

                405                 410                 415

Lys Glu Asp Ser His Ser Thr Thr Gly Thr Ala Ala Ala Ser Ala His

            420                 425                 430

Thr Ser His Pro Met Gln Gly Arg Thr Thr Pro Ser Pro Glu Asp Ser

        435                 440                 445

Ser Trp Thr Asp Phe Phe Asn Pro Ile Ser His Pro Met Gly Arg Gly

    450                 455                 460

His Gln Ala Gly Arg Arg Met Asp Met Asp Ser Ser His Ser Ile Thr

465                 470                 475                 480

Leu Gln Pro Thr Ala Asn Pro Asn Thr Gly Leu Val Glu Asp Leu Asp

                485                 490                 495

Arg Thr Gly Pro Leu Ser Met Thr Thr Gln Gln Ser Asn Ser Gln Ser

            500                 505                 510

Phe Ser Thr Ser His Glu Gly Leu Glu Glu Asp Lys Asp His Pro Thr

        515                 520                 525

Thr Ser Thr Leu Thr Ser Ser Asn Arg Asn Asp Val Thr Gly Gly Arg

    530                 535                 540

Arg Asp Pro Asn His Ser Glu Gly Ser Thr Thr Leu Leu Glu Gly Tyr

545                 550                 555                 560

Thr Ser His Tyr Pro His Thr Lys Glu Ser Arg Thr Phe Ile Pro Val

                565                 570                 575

Thr Ser Ala Lys Thr Gly Ser Phe Gly Val Thr Ala Val Thr Val Gly

            580                 585                 590

Asp Ser Asn Ser Asn Val Asn Arg Ser Leu Ser Gly Asp Gln Asp Thr

        595                 600                 605

Phe His Pro Ser Gly Gly Ser His Thr Thr His Gly Ser Glu Ser Asp

    610                 615                 620

Gly His Ser His Gly Ser Gln Glu Gly Gly Ala Asn Thr Thr Ser Gly

625                 630                 635                 640

Pro Ile Arg Thr Pro Gln Ile Pro Glu Trp Leu Ile Ile Leu Ala Ser

                645                 650                 655

Leu Leu Ala Leu Ala Leu Ile Leu Ala Val Cys Ile Ala Val Asn Ser

            660                 665                 670

Arg Arg Arg Cys Gly Gln Lys Lys Lys Leu Val Ile Asn Ser Gly Asn

        675                 680                 685

Gly Ala Val Glu Asp Arg Lys Pro Ser Gly Leu Asn Gly Glu Ala Ser

    690                 695                 700

Lys Ser Gln Glu Met Val His Leu Val Asn Lys Glu Ser Ser Glu Thr

705                 710                 715                 720

Pro Asp Gln Phe Met Thr Ala Asp Glu Thr Arg Asn Leu Gln Asn Val

                725                 730                 735

Asp Met Lys Ile Gly Val

            740

<210>31

<211>489

<212>PRT

<213>people

<400>31

Met Leu Met Arg Leu Val Leu Thr Val Arg Ser Asn Leu Ile Pro Ser

1               5                   10                  15

Pro Pro Thr Tyr Asn Ser Ala His Asp Tyr Ile Ser Trp Glu Ser Phe

            20                  25                  30

Ser Asn Val Ser Tyr Tyr Thr Arg Ile Leu Pro Ser Val Pro Lys Asp

        35                  40                  45

Cys Pro Thr Pro Met Gly Thr Lys Gly Lys Lys Gln Leu Pro Asp Ala

    50                  55                  60

Gln Leu Leu Ala Arg Arg Phe Leu Leu Arg Arg Lys Phe Ile Pro Asp

65                  70                  75                  80

Pro Gln Gly Thr Asn Leu Met Phe Ala Phe Phe Ala Gln His Phe Thr

                85                  90                  95

His Gln Phe Phe Lys Thr Ser Gly Lys Met Gly Pro Gly Phe Thr Lys

            100                 105                 110

Ala Leu Gly His Gly Val Asp Leu Gly His Ile Tyr Gly Asp Asn Leu

        115                 120                 125

Glu Arg Gln Tyr Gln Leu Arg Leu Phe Lys Asp Gly Lys Leu Lys Tyr

    130                 135                 140

Gln Val Leu Asp Gly Glu Met Tyr Pro Pro Ser Val Glu Glu Ala Pro

145                 150                 155                 160

Val Leu Met His Tyr Pro Arg Gly Ile Pro Pro Gln Ser Gln Met Ala

                165                 170                 175

Val Gly Gln Glu Val Phe Gly Leu Leu Pro Gly Leu Met Leu Tyr Ala

            180                 185                 190

Thr Leu Trp Leu Arg Glu His Asn Arg Val Cys Asp Leu Leu Lys Ala

        195                 200                 205

Glu His Pro Thr Trp Gly Asp Glu Gln Leu Phe Gln Thr Thr Arg Leu

    210                 215                 220

Ile Leu Ile Gly Glu Thr Ile Lys Ile Val Ile Glu Glu Tyr Val Gln

225                 230                 235                 240

Gln Leu Ser Gly Tyr Phe Leu Gln Leu Lys Phe Asp Pro Glu Leu Leu

                245                 250                 255

Phe Gly Val Gln Phe Gln Tyr Arg Asn Arg Ile Ala Met Glu Phe Asn

            260                 265                 270

His Leu Tyr His Trp His Pro Leu Met Pro Asp Ser Phe Lys Val Gly

        275                 280                 285

Ser Gln Glu Tyr Ser Tyr Glu Gln Phe Leu Phe Asn Thr Ser Met Leu

    290                 295                 300

Val Asp Tyr Gly Val Glu Ala Leu Val Asp Ala Phe Ser Arg Gln Ile

305                 310                 315                 320

Ala Gly Arg Ile Gly Gly Gly Arg Asn Met Asp His His Ile Leu His

                325                 330                 335

Val Ala Val Asp Val Ile Arg Glu Ser Arg Glu Met Arg Leu Gln Pro

            340                 345                 350

Phe Asn Glu Tyr Arg Lys Arg Phe Gly Met Lys Pro Tyr Thr Ser Phe

        355                 360                 365

Gln Glu Leu Val Gly Glu Lys Glu Met Ala Ala Glu Leu Glu Glu Leu

    370                 375                 380

Tyr Gly Asp Ile Asp Ala Leu Glu Phe Tyr Pro Gly Leu Leu Leu Glu

385                 390                 395                 400

Lys Cys His Pro Asn Ser Ile Phe Gly Glu Ser Met Ile Glu Ile Gly

                405                 410                 415

Ala Pro Phe Ser Leu Lys Gly Leu Leu Gly Asn Pro Ile Cys Ser Pro

            420                 425                 430

Glu Tyr Trp Lys Pro Ser Thr Phe Gly Gly Glu Val Gly Phe Asn Ile

        435                 440                 445

Val Lys Thr Ala Thr Leu Lys Lys Leu Val Cys Leu Asn Thr Lys Thr

    450                 455                 460

Cys Pro Tyr Val Ser Phe Arg Val Pro Asp Ala Ser Gln Asp Asp Gly

465                 470                 475                 480

Pro Ala Val Glu Arg Pro Ser Thr Glu

                485

<210>32

<211>122

<212>PRT

<213>people

<400>32

Met Lys Leu Leu Thr Gly Leu Val Phe Cys Ser Leu Val Leu Gly Val

1               5                   10                  15

Ser Ser Arg Ser Phe Phe Ser Phe Leu Gly Glu Ala Phe Asp Gly Ala

            20                  25                  30

Arg Asp Met Trp Arg Ala Tyr Ser Asp Met Arg Glu Ala Asn Tyr Ile

        35                  40                  45

Gly Ser Asp Lys Tyr Phe His Ala Arg Gly Asn Tyr Asp Ala Ala Lys

    50                  55                  60

Arg Gly Pro Gly Gly Val Trp Ala Ala Glu Ala Ile Ser Asp Ala Arg

65                  70                  75                  80

Glu Asn Ile Gln Arg Phe Phe Gly His Gly Ala Glu Asp Ser Leu Ala

                85                  90                  95

Asp Gln Ala Ala Asn Glu Trp Gly Arg Ser Gly Lys Asp Pro Asn His

            100                 105                 110

Phe Arg Pro Ala Gly Leu Pro Glu Lys Tyr

        115                 120

<210>33

<211>26

<212>DNA

<213>people

<400>33

agatattgca cgggagaata tacaaa                                   26

<210>34

<211>27

<212>DNA

<213>people

<400>34

tcaattcctg aaattaaagt tcggata                                  27

<210>35

<211>23

<212>DNA

<213>people

<400>35

tctgcagagt tggaagcact cta                                      23

<210>36

<211>21

<212>DNA

<213>people

<400>36

gccgaggctt ttctaccaga a                                        21

<210>37

<211>20

<212>DNA

<213>people

<400>37

catggcttga tcagcaagga                                          20

<210>38

<211>21

<212>DNA

<213>people

<400>38

tggaagtgtg ccctgaagaa g                                        21

<210>39

<211>21

<212>DNA

<213>people

<400>39

aagcagcacc agcaagtgaa g                                        21

<210>40

<211>21

<212>DNA

<213>people

<400>40

tcatggcctg tgtcagtcaa a                                        21

<210>41

<211>22

<212>DNA

<213>people

<400>41

acatgccagc cactgtgata ga                                       22

<210>42

<211>21

<212>DNA

<213>people

<400>42

ccctgccttc acaatgatct c                                        21

<210>43

<211>23

<212>DNA

<213>people

<400>43

ggaattcacc tcaagaacat cca                                      23

<210>44

<211>23

<212>DNA

<213>people

<400>44

agtgtggcta tgacttcggt ttg                                      23

<210>45

<211>22

<212>DNA

<213>people

<400>45

cagccacaag cagtccagat ta                                       22

<210>46

<211>24

<212>DNA

<213>people

<400>46

cctgactatc aatcacatcg gaat                                     24

<210>47

<211>21

<212>DNA

<213>people

<400>47

ccaggtgctc cacatgacag t                                        21

<210>48

<211>24

<212>DNA

<213>people

<400>48

aaacaaccaa caacaaggag aatg                                     24

<210>49

<211>21

<212>DNA

<213>people

<400>49

cgtctccaca catcagcaca a                                        21

<210>50

<211>22

<212>DNA

<213>people

<400>50

tcttggcagc aggatagtcc tt                                       22

<210>51

<211>22

<212>DNA

<213>people

<400>51

gcagaccagc atgacagatt tc                                       22

<210>52

<211>20

<212>DNA

<213>people

<400>52

gcggattagg gcttcctctt                                          20

<210>53

<211>23

<212>DNA

<213>people

<400>53

tgaagttcaa tgcactggaa ctg                                      23

<210>54

<211>20

<212>DNA

<213>people

<400>54

caggacgatc tccacagcaa                                          20

<210>55

<211>23

<212>DNA

<213>people

<400>55

tggagtccac gagatcattt aca                                      23

<210>56

<211>19

<212>DNA

<213>people

<400>56

agccttggcc ctcggatat                                           19

<210>57

<211>21

<212>DNA

<213>people

<400>57

 cactgagttc gccaagagca t                                       21

<210>58

<211>23

<212>DNA

<213>people

<400>58

cacgccatac ttgagaaggg taa                                      23

<210>59

<211>23

<212>DNA

<213>people

<400>59

gctagtgatc aacagtggca atg                                      23

<210>60

<211>18

<212>DNA

<213>people

<400>60

gctggcctct ccgttgag                                            18

<210>61

<211>22

<212>DNA

<213>people

<400>61

tgttcggtgt ccagttccaa ta                                       22

<210>62

<211>22

<212>DNA

<213>people

<400>62

tgccagtggt agagatggtt ga                                       22

<210>63

<211>22

<212>DNA

<213>people

<400>63

gggacatgtg gagagcctac tc                                       22

<210>64

<211>21

<212>DNA

<213>people

<400>64

catcatagtt cccccgagca t                                        21

Claims (17)

1. a kind of method for preparing the reagent composition for early detection colorectal cancer, lung cancer, prostate cancer, breast cancer, Alzheimer disease and ALS, which comprises

Synthesize the primer pair of every kind of polynucleotide pair from SEQ.ID NOs 33-64；

Using diluent, a variety of independent liquid storages of every kind of primer are adjusted to the concentration of at least one needs；

Every part of the every kind of primer liquid storage is distributed in multiple containers；With

The multiple container is saved under long-term storage conditions.

2. the method for claim 1 wherein the method also includes the equal part liquid storage of every kind of primer pair is lyophilized.

3. a kind of for colorectal cancer, lung cancer, prostate cancer, breast cancer, the method for Alzheimer disease and ALS early detection, which comprises

By the method for Noninvasive or minimally-invasive property from generally seeming normally to organize to obtain tissue sample；

RNA is separated from the sample；

The polynucleotide group of SEQ.ID NOs.1-16 is selected from detection from RNA sample amplification cDNA copy using selected from multiple primer pairs by the SEQ.ID NOs 33-64 group formed；

The cDNA copy of quantization amplification；With

It is assessed using the cDNA of the amplification of quantization copy at least one of the progression of disease of at least one disease of colorectal cancer, lung cancer, prostate cancer, breast cancer, Alzheimer disease and ALS and therapeutic efficiency.

4. method for claim 3, wherein the acquisition step further includes sampling rectal mucosal cells.

5. method for claim 3, wherein the step that obtains further includes blood sampling, stool sampling and the one kind for carrying out rectal biopsy.

6. method for claim 3, wherein described use step further include:

The quantization level of analysis tissue sample cDNA is carried out by multi-variables analysis；

The multi-variables analysis of tissue sample cDNA quantization level is compared with a variety of contrasting datas, wherein the relatively more determining significance of difference with contrasting data, to assess the presence of colorectal cancer.

7. method for claim 6, wherein the analytical procedure further includes one kind using ANOVA detection and Mahalanobis distance detection.

8. a kind of method for colorectal cancer early detection and for assessing carcinoma of the colon and rectum therapeutic effect, the method includes the steps:

Tissue sample is obtained by the method for Noninvasive or minimally-invasive property, the tissue sample contains the cell for substantially seeming no cancer；

Generate the Multiple Antibodies with the not homospecificity for the SEQ.ID NOs 17-32 every kind of polypeptide determined；

The polypeptide expression in the polypeptide group that SEQ.ID NOs 17-32 is determined is detected with the Multiple Antibodies, wherein the detecting step allows to quantify the specific binding of the antibody Yu the polypeptide；

It is combined based on the specific antibody that is quantified, quantifies in polypeptide group the level of every kind of not homopolypeptide；With

The quantization level of every kind of not homopolypeptide in polypeptide group is analyzed, wherein the quantization level is used to assess at least one of presence, progress and treatment of colorectal cancer.

9. method for claim 8, wherein the step that obtains further includes sampling blood, sampling excrement, wiping colon cell and the one kind for carrying out rectal biopsy.

10. a kind of method of the data of the early detection and treatment for research and application colorectal cancer, the method includes the following steps:

The quantization level of a variety of cDNA of the polynucleotide selected from SEQ.ID Nos.1-16 is obtained from Patient Sample A, wherein the sample is taken by the method for Noninvasive or the method for minimally-invasive property；

Using multivariate statistical analysis, by the data of Patient Sample A compared with the contrasting data of a variety of storages；With

Based on the comparison, a kind of resolution about the diagnosis of colorectal cancer, the progress of colorectal cancer and the therapeutic effect for patient is made.

11. a kind of machine readable media with the instruction being stored thereon makes system when executing by one or more processors:

The data for obtaining the cDNA level of the quantization for the polynucleotide that SEQ.ID NOs.1-16 is listed, wherein the cDNA level of the quantization is from patient tissue samples and control tissue sample；

Using at least one multivariate statistical analysis, the cDNA level of the quantization of patient tissue samples is compared with the cDNA level of the quantization of control tissue sample；With

Individual of the multivariate statistical analysis for by having received assessment colorectal cancer training is provided to be assessed.

12. a kind of includes the Computer signal in transmission medium comprising:

The coded portion of the instruction of cDNA level including the quantization for obtaining the polynucleotide selected from SEQ.ID NOs.1-16, wherein the cDNA level of the quantization is from patient tissue samples；

Coded portion including the instruction for using multivariate statistical analysis that the cDNA level of the quantization from patient tissue samples compares with a variety of contrasting datas；With

Coded portion including the instruction for based on the comparison patient tissue samples to be made with diagnosing colorectal cancer.

13. a kind of includes the Computer signal in transmission medium comprising:

Coded portion including the quantization level for obtaining the polypeptide selected from SEQ.ID NOs.17-33, wherein the quantization level of the polypeptide is from the Patient Sample A containing colonic mucosal cells；

Coded portion including the instruction for using multivariate statistical analysis that the peptide level of the quantization from Patient Sample A compares with a variety of contrasting datas；With

Coded portion including at least one instruction based on the comparison at least one of diagnosing colorectal cancer, colorectal cancer progress and colorectal cancer effect.

14. a kind of kit for colorectal cancer early detection, the kit include:

The collection vessel of the sample containing rectal mucosal cells obtained by the method for Noninvasive is received, wherein the collection vessel is set to stablize and save the sample；With

For analyzing at least one reagent of polynucleotide expression, wherein the polynucleotide is selected from SEQ.ID Nos.1-16.

15. a kind of for detecting the kit of colorectal cancer, the kit includes:

Wiping sampling and sample transport system, sample rectal mucosal cells with being used for minimally-invasive property, the system comprises:

It is set to acquire the swab of colonic mucosal cells from rectum；With

For receiving the collection vessel of the swab after sampling, wherein the collection vessel is set with stabilization, extraction and saves the sample；With

For analyzing at least one reagent of polynucleotide expression, wherein the polynucleotide is selected from SEQ.ID Nos.1-16.

16. a kind of method for drug screening, the method includes the following steps:

For at least one selection mode biosystem of colorectal cancer, lung cancer, prostate cancer, breast cancer, Alzheimer disease and ALS；

Using model biological system appropriate, at least one promising drug of selection is screened；

At least two kinds of biomarkers of biomarker group selection determined from SEQ.ID 1-32；

Quantitatively give the promising drug of at least one to the model biological system；With

As the function of the dosed administration step, the response of at least two kinds of biomarkers of monitoring pattern biosystem kind.

17. the method for claim 16, further include: it is based on the monitoring step, determines the effect of the promising drug.

Images