CN114134185A - Method for producing L-serine by fermentation - Google Patents

Abstract

The invention discloses a method for producing L-serine by fermentation, which comprises the following steps: (1) inoculating the seed liquid of L-serine producing bacteria to a fermentation mediumThe fermentation culture is carried out, the temperature of the fermentation culture is 28-32 ℃, the pH value is 6.8-7.2, the dissolved oxygen is 20-40 percent, and the stirring speed is 150-250 rpm; performing fermentation culture until the OD of the fermentation liquid after being diluted by 100 times₆₀₀When the value is 0.40-0.60, cooling to 27-29 ℃, adding IPTG into the system for induction culture, and performing induction culture for 48-52 h; monitoring the residual sugar content of the system in the culture process, starting to add supplementary materials when the residual sugar content of the system is less than or equal to 1.0g/L, and keeping the glucose concentration in the system at 0.5-1.0g/L by feeding supplementary materials; the supplementary material contains 60-80g/L glucose, 40-60ml/L molasses and 0.3-0.5g/L folic acid; (2) and (3) performing bacterium breaking treatment on the culture after induction culture, separating and collecting supernatant, and thus obtaining the culture solution containing the L-serine. The method can realize the industrial production of the L-serine and obviously improve the yield of the L-serine.

Description

Method for producing L-serine by fermentation

Technical Field

The invention relates to the technical field of bioengineering, in particular to a method for producing L-serine by fermentation.

Background

L-serine is a non-essential amino acid that can be involved in the metabolism of numerous important active substances in the cell. In addition, L-serine, an important industrial product, has been widely used in the fields of food, fine chemicals and medicines. At present, the synthesis of L-serine mainly depends on direct extraction and chemical synthesis, and although the yield is high, both methods cause certain harm to the environment. With the development of metabolic engineering and synthetic biology, microbial reactors are utilized to systematically regulate microbial metabolic pathways so that a large amount of certain metabolic products are accumulated, and the microbial reactors are gradually and widely applied. As a model organism, Escherichia coli has the advantages of high growth speed, simple culture method and the like, and is often used as a host bacterium for microbial fermentation. However, L-serine is accumulated in a low amount in wild-type E.coli as a metabolic intermediate.

In order to improve the yield of L-serine, the genetic engineering modification of wild-type escherichia coli has been studied, but the modified escherichia coli is easy to generate growth inhibition phenomenon in the fermentation process, and the fermentation production effect is influenced. Therefore, the existing methods for producing L-serine by fermentation still need to be further improved.

Disclosure of Invention

In view of the above prior art, it is an object of the present invention to provide a process for the fermentative production of L-serine. The method can realize the industrial production of the L-serine and obviously improve the yield of the L-serine.

In order to achieve the purpose, the invention adopts the following technical scheme:

a method for producing L-serine by fermentation, comprising the steps of:

(1) inoculating the seed liquid of the L-serine production bacteria into a fermentation culture medium for fermentation culture, wherein the temperature of the fermentation culture is 28-32 ℃, the pH value is 6.8-7.2, the Dissolved Oxygen (DO) is 20-40%, and the stirring speed is 150-250 rpm; performing fermentation culture until the OD of the fermentation liquid after being diluted by 100 times₆₀₀When the value is 0.40-0.60, cooling to 27-29 ℃, adding IPTG into the system for induction culture, and performing induction culture for 48-52 h;

monitoring the residual sugar content of the system in the culture process, starting to add supplementary materials when the residual sugar content of the system is less than or equal to 1.0g/L, and keeping the glucose concentration in the system at 0.5-1.0g/L by feeding supplementary materials; the supplementary material contains 60-80g/L glucose, 40-60ml/L molasses and 0.3-0.5g/L folic acid;

(2) and (3) performing bacterium breaking treatment on the culture after induction culture, separating and collecting supernatant, and thus obtaining the culture solution containing the L-serine.

Preferably, in the step (1), the L-serine producing strain is constructed by the following method:

knocking out gpmA, sdaA, mtfA, pta, glyA, sdaC, serA, sstT, tdcC, aceA and cycA genes in escherichia coli to obtain escherichia coli engineering bacteria;

carrying out enzyme digestion treatment on the serB gene by sphI and AaaI, carrying out enzyme digestion treatment on the serC gene by Nco I and Bgl II, and integrating the serB gene and the serC gene subjected to the enzyme digestion treatment onto a plasmid PQE-N to obtain a first recombinant expression vector (pQE-serB & C);

carrying out double enzyme digestion on pGEX-kan plasmid by ecoNI and Zra I, and integrating serA delta 197 gene to the plasmid pGEX-kan subjected to double enzyme digestion to obtain a second recombinant expression vector (pGEX-serA);

and introducing the obtained first recombinant expression vector and the second recombinant expression vector into the escherichia coli engineering bacteria to construct the L-serine producing bacteria.

More preferably, the nucleotide sequence of serB gene is shown in SEQ ID NO. 1; the nucleotide sequence of the serC gene is shown as SEQ ID NO. 2; the nucleotide sequence of the plasmid PQE-N is shown as SEQ ID NO. 3; the nucleotide sequence of the first recombinant expression vector is shown as SEQ ID NO. 4; the nucleotide sequence of the pGEX-kan plasmid is shown as SEQ ID NO. 5; the nucleotide sequence of the serA delta 197 gene is shown as SEQ ID NO. 7; the nucleotide sequence of the second recombinant expression vector is shown as SEQ ID NO. 8.

Preferably, in step (1), the seed solution of the L-serine-producing bacterium is inoculated in an amount of 10 to 15% by weight based on the fermentation medium.

Preferably, in step (1), the composition of the fermentation medium is: 40ml/L of molasses, 30g/L of glucose, 30g/L of corn steep liquor dry powder, 2g/L of monopotassium phosphate, 0.5g/L of citric acid, (NH)₄)₂SO₄ 5g/L、MgSO₄·7H₂O 0.5g/L、MnSO₄0.08g/L、FeSO₄0.06g/L, vitamin B₁0.025g/L, biotin (VH)3mg/L, kanamycin 50 ppm.

Preferably, in step (1), IPTG is added so that the final concentration of IPTG in the system is 0.5 mmol/L.

Preferably, in the step (1), the feed comprises 70g/L of glucose, 50ml/L of molasses and 0.4g/L of folic acid.

The invention has the beneficial effects that:

(1) in order to improve the yield of L-serine produced by fermentation, the invention firstly constructs a production strain capable of producing L-serine with high yield, and comprehensively analyzes various factors influencing the expression of the L-serine to remove the feedback inhibition of key enzymes in a synthetic route, knock out a decomposition route, over-expression synthetic route and other technical means for combined use, so that more carbon sources flow to the L-serine, thereby obviously improving the yield of the L-serine.

(2) In the process of constructing the production bacteria for high-yield L-serine, a plurality of genes of the escherichia coli are knocked out, so that the fermentation culture medium, the fermentation culture conditions and the like of the L-serine are optimized in order to avoid the inhibition of the growth of thalli of the escherichia coli in the fermentation process. The fermentation medium and the feed supplement of the invention are added with beet molasses as a carbon source, which can provide nutrients such as crude protein, organic alkali, mineral substances and the like for the growth of thalli and can reduce the cost. Folic acid is added in the feed supplement to ensure the normal metabolism of amino acids such as methionine

After fermentation culture, when the bacterial quantity is increased to the target quantity, the culture temperature is reduced to 27-29 ℃ so as to reduce other irrelevant metabolism and further improve the expression of the target product.

In conclusion, the invention realizes the industrial production of the L-serine and obviously improves the yield of the L-serine by constructing the production bacteria and optimizing the fermentation process.

Drawings

FIG. 1: PQE-60 plasmid and its modified structure diagram; wherein, A is a structural schematic diagram of PQE-60 plasmid; b is a structural schematic diagram of the modified plasmid PQE-N.

FIG. 2: pGEX-4T-1 plasmid and the schematic diagram of the modified structure thereof; wherein A is a structural schematic diagram of pGEX-4T-1 plasmid; b is a structural schematic diagram of the modified pGEX-kan plasmid.

FIG. 3: verifying the strain subjected to gene knockout; wherein, 1-11 are knock-out verification results of gpmA, sdaA, mtfA, pta, glyA, sdaC, serA, sstT, tdcC, aceA and cycA genes respectively; in each electrophoretogram, lanes from left to right are: after knocking out the resistance gene, after knocking out the pKD3 gene, the gene needing to be knocked out, and Marker.

FIG. 4: the first recombinant expression vector (pQE-serB & C) constructed by the invention has a structural schematic diagram.

FIG. 5: electrophoretic verification of a first recombinant expression vector (pQE-serB & C) constructed by the invention; the lanes are Marker, PQE-60, PQE-N, pQE-serB & C from left to right.

FIG. 6: the structural diagram of the second recombinant expression vector (pGEX-serA) constructed by the invention is shown.

FIG. 7: the electrophoresis verification of the second recombinant expression vector (pGEX-serA) constructed by the invention; the lane is sequentially Marker, pGEX-4T-1, pGEX-kan and pGEX-serA from left to right.

FIG. 8: the colony PCR verification result of the L-serine producing strain constructed by the invention; in the figure, the left lane is Marker.

FIG. 9: and (3) secondary mass spectrum of L-serine detection.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

In order to make the technical solutions of the present application more clearly understood by those skilled in the art, the technical solutions of the present application will be described in detail below with reference to specific embodiments.

The test materials used in the examples and comparative examples of the present invention are those conventional in the art and, unless otherwise specified, are commercially available. Wherein:

escherichia coli strain K-12substr.MG1655, a stock purchased from ATCC in the United states, was used in the present examples and comparative examples.

The PQE-N plasmid (figure 1B) is obtained by genetic engineering based on PQE-60 plasmid (figure 1A), and the sequence of PQE-N plasmid is shown in SEQ ID NO. 3.

The pGEX-kan plasmid (FIG. 2B) is genetically engineered based on the pGEX-4T-1 plasmid (FIG. 2A), and the ampicillin resistance marker in the pGEX-4T-1 plasmid is replaced with a kanamycin resistance marker. The sequence of the modified pGEX-kan plasmid is shown in SEQ ID NO. 5.

The PQE-N plasmid and pGEX-kan plasmid were modified by conventional genetic engineering means, and the PQE-N plasmid and pGEX-kan plasmid were also publicly available for duplication experiments from the applicant within 20 years from the filing date of this patent.

Example 1: construction of L-serine-producing bacterium

1. Constructing engineering bacteria of escherichia coli:

knocking out gpMA, sdaA, mtfA, pta, glyA, sdaC, serA, sstT, tdcC, aceA and cycA genes in Escherichia coli by adopting a Red homologous recombination technology to obtain Escherichia coli engineering bacteria (Escherichia coli delta sstT delta sdaC delta tdcC delta cycA delta mtfA delta glyA delta pta delta sdaA delta aceA delta gpmA delta serA); the specific process is as follows:

1) construction of a linear targeting box:

the knock-out plasmid is selected from pKD3 plasmid and chloramphenicol resistance; the homologous arm primers corresponding to the knocked-out different genes are as follows:

PKD-gpmA-F：GCAGTCGGCTTTCTCATTTTAAACGAATGAC；(SEQ ID NO.9)

PKD-gpmA-R：TTACTCCTCAAATCATCTTTTAATGATAATA。(SEQ ID NO.10)

PKD-sdaA-F：GGAAGTCCAGTCACCTTGTCAGGAGTATTAT；(SEQ ID NO.11)

PKD-sdaA-R：TTCTTACTCGCCCATCTGCAACGGATGGGCG。(SEQ ID NO.12)

PKD-mrfA-F：GGGATAGCTTGACTGTGAAAATCACAGGAGC；(SEQ ID NO.13)

PKD-mrfA-R:TAACAACTTTGCAGATTAATTAACCAATTGA。(SEQ ID NO.14)

PKD-pta-F:AACCCGCCAAATCGGCGGTAACGAAAGAGGA；(SEQ ID NO.15)

PKD-pta-R:TCATCCGCAGCTTTGCGCTGCGGATATCTGA。(SEQ ID NO.16)

PKD-glyA-F:CAACGAGCACATTGACAGCAAATCACCGTTT；(SEQ ID NO.17)

PKD-glyA-R:GCATCTCCTGACTCAGCTAACAATAAAATTT。(SEQ ID NO.18)

PKD-sdaC-F：CTAAAAGCTGAATTATTTGCATTCCTCCAGG；(SEQ ID NO.19)

PKD-sdaC-R：ATTGCAATCTCCGCAATCTTCTACTCTCTGT。(SEQ ID NO.20)

PKD-serA-F：AGTCAGTGACCTGCCCGTTGATTTTCAGAGA；(SEQ ID NO.21)

PKD-serA-R：CCTGTCTTTTGAAATGTTGTGTGCGGATTTG。(SEQ ID NO.22)

PKD-sstT-F：GGGATGTGCGACAACACAATGAAAGGATCGA；(SEQ ID NO.23)

PKD-sst–R：TGTTTAACCCCTTTCGTCTACGGCGGAAGGG。(SEQ ID NO.24)

PKD-tdcC–F：AATTCATTCATCTCTTTTCTCATCCTGAGTT；(SEQ ID NO.25)

PKD-tdcC–R：CCTATCCTCAACGAATTAATTAAGCGTCAAC。(SEQ ID NO.26)

PKD-aceA-F：GTTAGCGTAAACCACCACATAACTATGGAGC；(SEQ ID NO.27)

PKD-aceA-R：ACAACCGTTGCTGACTGTAGGCCGGATAAGG。(SEQ ID NO.28)

PKD-cycA-F：TGAACAACACAGACAGGTACAGGAAGAAAAA；(SEQ ID NO.29)

PKD-cycA-R：CATTATCATGCTGGATGGCGCAATGCCATCC。(SEQ ID NO.30)

the sequence of gene knockouts was: firstly knocking out sstT, sdaC, tdcC and cycA genes, then knocking out mtfA, glyA, pta and sdaA genes, then knocking out aceA and gpmA genes, and finally knocking out serA genes.

The Test primers used after knocking out the different genes were as follows:

Test-gpmA-F：AATGTGCTCCATTGTTAGCAACAAAAAAGCC；(SEQ ID NO.31)

Test-gpmA-R:ATATTGCCGCGACGAAGCAACAGCAATGCTT。(SEQ ID NO.32)

Test-sdaA-F:TACACTATGCGCTGTTATTAGTTCGTTACTG；(SEQ ID NO.33)

Test-sdaA-R:GAATTTATACCCGCTTTCTCGTCTGCTGTAA。(SEQ ID NO.34)

Test-mrfA-F:ACATCTGTATAAGGAATTTTTAAGGTTCGTG；(SEQ ID NO.35)

Test-mrfA-R:AAATGACTTATGAAATTTAGTGTTGACAGAC。(SEQ ID NO.36)

Test-pta-F:CCGCCAGCTCAGCTGGCGGTGCTGTTTTGTA；(SEQ ID NO.37)

Test-pta-R:AACCGGAAATAATCACTATTTCCGGTTTTTT。(SEQ ID NO.38)

Test-glyA-F:ATAAGGCGTTCACGCCGCATCCGGCATGAAC；(SEQ ID NO.39)

Test-glyA-R:TTTGGCCTTTATAGGCGGTCCTGTTGGACAA。(SEQ ID NO.40)

Test-sdaC-F:ACGGTCAGGCACCTTCCCGGGCTGAACTGGC；(SEQ ID NO.41)

Test-sdaC-R:TTCAGCTAAGTCCTTTCGCGCCGCTTTCGGG。(SEQ ID NO.42)

Test-serA-F:CGGTGTGGAGAAGGGATAAAAAAACGGGCAA；(SEQ ID NO.43)

Test-serA-R:GCATCCGCCTTTCAACATATCAAAAAATAAT。(SEQ ID NO.44)

Test-sstT-F:TCCTGAAAGATGCGTCGACAGAACGCACCAG；(SEQ ID NO.45)

Test-sstT-R:GGTTTTCTCAACTTTAAACGGATCAATTCCC。(SEQ ID NO.46)

Test-tdcC-F:GAACCACAGTTAATAACCAAAACAACCGGAA；(SEQ ID NO.47)

Test-tdcC-R:CGAAACCGGTGATTTGAGAGACGCGAGAAAG。(SEQ ID NO.48)

Test-aceA-F:TGATTTCCTGACCCTGCCAGGCTACCGCCTG；(SEQ ID NO.49)

Test-aceA-R:GCGTTCACGCCGCATCCGGCAATCGGTGCAC。(SEQ ID NO.50)

Test-cycA-F:TATCATAGACTGACTAAAGGCCGTAGAGCCT；(SEQ ID NO.51)

Test-cycA-R:CAGCTTTTAGATCACTCACCCGCCAGCGCGC。(SEQ ID NO.52)

2) preparation of an electrically receptive state:

after shaking the cells overnight in a test tube, the cells were inoculated into LB medium in an amount of 1% (by volume) the next day, and cultured at 30 ℃ for 1 hour, 0.3% (by mass) of L-arabinose was added thereto, and the cells were induced at 30 ℃ for 2 hours. Cooling in ice bath. Washed twice with 10% (volume fraction) glycerol, finally concentrated to 200. mu.l, resuspended with 10% glycerol.

3) Electric shock conversion:

the 2mm electric rotor was taken out from 70% (volume fraction) ethanol, washed 2 times with sterilized ultrapure water, and irradiated with an ultraviolet lamp for 30 minutes. And (4) precooling. Take 100. mu.l of the finally resuspended cells, move to a pre-cooled centrifuge tube, add 5. mu.l of a linear targeting box, and mix by gentle pipetting with a gun. Ice-bath for 2 min.

Electric transfer parameters: 2500V, 200 ohm, 25 μ F; after the electric shock, the electric shock time is 4.8 ms.

4) Recovering and coating:

1ml of LB was added at 30 ℃ and 200rpm for 1 hour. Centrifugation was performed prior to plating, and a portion of the supernatant was removed and resuspended, and plated onto AMP plates. And (5) coating and drying. Incubated at 30 ℃ for 24 hours. And screening the recombinants.

5) Removal of resistance genes:

the plasmid pCP20 was transferred to a strain in which the gene was successfully knocked out, and cultured at 30 ℃ for 8 hours and then at 42 ℃ overnight. pCP20 induced expression of FLP endonuclease at 42 ℃ to excise the resistance gene from the genome between the FRT sites.

The strain after gene knockout was verified, and the results are shown in fig. 3. The results show that: the gpmA, sdaA, mtfA, pta, glyA, sdaC, serA, sstT, tdcC, aceA and cycA genes in E.coli were successfully knocked out, and E.coli engineering bacteria (Escherichia coli. DELTA. sstT. DELTA. sdaC. tdcC. DELTA. cycA. mtfA. DELTA. glyA. DELTA. pta. DELTA. sdaA. DELTA. aceA. gpmA. DELTA. serA) were obtained.

2. Construction of the first recombinant expression vector:

(1) extracting the genome DNA of the escherichia coli, using the genome DNA as a template, and performing PCR amplification by using the following primers to obtain a serB gene, wherein the nucleotide sequence of the serB gene is shown as SEQ ID NO. 1.

A forward primer: 5' -CCATGCCTAACATTACCTGGTG-3’；(SEQ ID NO.53)

Reverse primer: 5' -AGCCTGAATCAGAAGTAAGATCT-3’。(SEQ ID NO.54)

The genome DNA of the Escherichia coli is used as a template, and the following primers are utilized to carry out PCR amplification to obtain the serC gene, wherein the nucleotide sequence of the serC gene is shown as SEQ ID NO. 2.

A forward primer: 5' -CCATGGCTCAAATCTTCAATTTTA-3’；(SEQ ID NO.55)

Reverse primer: 5'-TGAGTTCGAACGCCGTCACGGT-3' are provided. (SEQ ID NO.56)

(2) The serB gene is subjected to double enzyme digestion treatment by sphI and AaaI, the serC gene is subjected to double enzyme digestion treatment by NcoI and BglII, the serB gene and the serC gene subjected to enzyme digestion treatment are integrated on the PQE-N plasmid subjected to corresponding enzyme digestion treatment, and a first recombinant expression vector (pQE-serB & C) is constructed and obtained, wherein the structural schematic diagram of the first recombinant expression vector is shown in FIG. 4.

The constructed first recombinant expression vector was subjected to electrophoretic verification, and the result is shown in FIG. 5. The results show that: the serB gene and serC gene have been successfully integrated into the PQE-N plasmid.

3. Construction of the second recombinant expression vector:

carrying out codon optimization and enzyme cutting site adding treatment on a serA delta 197 gene (the nucleotide sequence is shown as SEQ ID NO. 6), wherein the treated nucleotide sequence is shown as SEQ ID NO. 7;

carrying out double enzyme digestion on pGEX-kan plasmid replaced by kanamycin resistance by ecoNI and Zra I, and integrating serA delta 197 gene (shown in SEQ ID NO. 7) subjected to codon optimization and enzyme digestion site addition treatment onto pGEX-kan plasmid subjected to double enzyme digestion treatment to obtain a second recombinant expression vector (pGEX-serA); the schematic structure is shown in fig. 6.

The constructed second recombinant expression vector was subjected to electrophoretic verification, and the result is shown in FIG. 7. The results show that: the serA.DELTA.197 gene (shown in SEQ ID NO. 5) has been successfully integrated into the plasmid pGEX-kan.

4. Construction of L-serine producing bacteria:

the constructed first recombinant expression vector and the second recombinant expression vector are introduced into an Escherichia coli engineering bacterium (Escherichia coli Δ sstT Δ sdaC Δ tdcC Δ cycA Δ mtfA Δ glyA Δ pta Δ sdaA Δ aceA Δ gpmA Δ serA), so as to obtain a transformant.

Transformants were plated on LB plates, and after a single colony had emerged, they were inoculated by photolithography on LB agar plates (kanamycin-resistant, 50. mu.g/ml kanamycin-containing) and AMP plates (LB plates containing 100. mu.g/ml AMP), respectively, and after a single colony had emerged on both resistant plates, a single colony that grew on both LB agar plates (kanamycin-resistant) and AMP plates was picked up by comparing the positions, and was taken as a positive transformant.

Colony PCR verification is carried out on positive transformants, and primers tested by the colony PCR are as follows:

pQE-F:AGCGGATAACAATTTCACACAG；(SEQ ID NO.57)

pQE-R:TTCTGAGGTCATTACTGGATC。(SEQ ID NO.58)

pGEX-F:GGGCTGGCAAGCCACGTTTGGTG；(SEQ ID NO.59)

pGEX-R:CCGGGAGCTGCATGTGTCAGAGG。(SEQ ID NO.60)

the colony PCR validation results are shown in fig. 8, and indicate that: the first recombinant expression vector and the second recombinant expression vector have been introduced into a recipient bacterium.

This proves that: this example has succeeded in constructing a stable L-serine-producing bacterium.

Example 2: fermentative production of L-serine

(1) Activating strains:

the L-serine-producing strain constructed in example 1 was streaked on LB plate containing 50. mu.g/ml kanamycin and cultured at 30 ℃ for 24 hours.

(2) Culturing the first-class strain:

the 1-inoculated mycelia were streaked from the plate and inoculated into a primary seed medium (LB liquid medium supplemented with 50ppm kanamycin) and cultured at 30 ℃ at pH7.0 and 20rpm for 18 hours.

(3) And (3) secondary seed culture:

inoculating the primary seed solution into secondary seed culture medium (LB liquid culture medium containing 50ppm kanamycin) at 1% (volume fraction), culturing at 30 deg.C with Dissolved Oxygen (DO) of 20-40% to OD_600nmValues 0.2-0.4 (100 fold dilution).

(4) Fermentation culture:

inoculating a secondary seed solution of the L-serine producing strain into a fermentation culture medium for fermentation culture, wherein the inoculation amount of the secondary seed solution is 10% of the weight of the fermentation culture medium, the temperature of the fermentation culture is 30 ℃, the pH value is 7.0, the Dissolved Oxygen (DO) is 20-40%, and the stirring speed is 200 rpm; performing fermentation culture until the OD of the fermentation liquid after being diluted by 100 times₆₀₀When the value is 0.50, cooling to 28 ℃, adding IPTG into the system for induction culture to ensure that the final concentration of the IPTG in the system is 0.5mmol/L, and carrying out induction culture for 50 h;

the fermentation medium comprises the following components: beet molasses 40ml/L, glucose 30g/L, corn steep liquor dry powder 30g/L, potassium dihydrogen phosphate 2g/L, citric acid 0.5g/L, (NH)₄)₂SO₄ 5g/L、MgSO₄·7H₂O 0.5g/L、MnSO₄ 0.08g/L、FeSO₄0.06g/L, vitamin B₁0.025g/L, biotin (VH)3mg/L, kanamycin 50 ppm.

Monitoring the residual sugar content of the system in the culture process, starting to add supplementary materials when the residual sugar content of the system is less than or equal to 1.0g/L, and keeping the glucose concentration in the system at 0.5-1.0g/L by feeding supplementary materials; the added feed contains 70g/L glucose, 50ml/L beet molasses and 0.4g/L folic acid.

(5) After the induction culture is finished, putting the tank, and performing bacterium breaking treatment on fermentation liquor after the tank is put by adopting a homogenizer, wherein the conditions of the homogenizing treatment are as follows: homogenizing pressure 12,000PSI, homogenizing flow rate 300L/Hr; homogenizing, centrifuging, and separating supernatant to obtain culture solution containing L-serine.

In the above fermentation process, Dissolved Oxygen (DO) is measured with dissolved oxygen electrode, and the dissolved oxygen is set to 100% with the dissolved oxygen level of the dissolved oxygen electrode in air, and 0 with the dissolved oxygen in saturated sodium sulfite solution. OD600 and pH were determined by sampling.

Comparative example 1:

escherichia coli was used as the L-serine-producing bacterium, and fermentation was carried out in the same manner as in example 2 to obtain culture solution A.

Comparative example 2:

an engineered Escherichia coli bacterium (Escherichia coli. DELTA. sstT. DELTA. sdaC. DELTA. tdcC. DELTA. cycA. mtfA. DELTA. glyA. DELTA. pta. sdaA. DELTA. aceA. DELTA. gpmA. DELTA. serA) constructed in example 1 was used as an L-serine-producing bacterium, and fermentation was carried out in the same manner as in example 2 to produce culture solution B.

Comparative example 3:

a recombinant bacterium obtained by introducing the first recombinant expression vector constructed in example 1 into Escherichia coli was used as an L-serine-producing bacterium, and fermentation was carried out in the same manner as in example 2 to produce a culture solution C.

Comparative example 4:

the recombinant bacterium obtained by introducing the second recombinant expression vector constructed in example 1 into E.coli was used as an L-serine-producing bacterium, and fermentation was carried out in the same manner as in example 2 to produce a culture solution D.

Comparative example 5:

the composition of the fermentation medium in example 2 was adjusted to:

the fermentation medium comprises the following components: 30g/L glucose, 30g/L corn steep liquor dry powder, 2g/L potassium dihydrogen phosphate, 0.5g/L citric acid, (NH)₄)₂SO₄ 5g/L、MgSO₄·7H₂O 0.5g/L、MnSO₄ 0.08g/L、FeSO₄0.06g/L, vitaminB₁0.025g/L, biotin (VH)3mg/L, kanamycin 50 ppm.

The composition of the feed was adjusted to: glucose 70 g/L.

Test example:

l-serine was measured in the culture broth produced in example 2, comparative example 1 to comparative example 5. The measurement method is as follows:

preparing a standard substance stock solution: taking 10mg of L-ser standard substance, dissolving with water and fixing the volume to 10mL to prepare stock solution with the concentration of 1 mg/mL;

preparation of a derivative solution: OPA15mg and NAC100mg were weighed out separately and dissolved in 1mL of methanol, 4mL of 0.1mol/L borax buffer (pH 10.0) was added and mixed well, and stored at 4 ℃ for further use. Before use, 0.1mol/L borax buffer solution (pH 10.0) is added to dilute to the required concentration to be used as a working solution.

90 μ L of culture medium was added with 10uL of internal standard (10 ug/ml-CAN), 20 μ L of derivatizing reagent and 1080 μ L of water, vortexed, reacted for 3min, and then injected.

And (3) derivatization reaction:

chromatographic conditions

A chromatographic column: waters Xbridge BEH C18 column (150 mm. times.3 mm, 2.5 um); mobile phase: solution (A) -methanol (B) of 13mmol/LNH4 Ac. Gradient elution: 0-5 min, 5% -20% of B; 5-8 min, 20% -42.5% B; 8-10 min, 42.5% -90% B; 10-11 min, 90% B; 11-11.5 min, 90% -5% B; 11.5-15 min, 5% B. Volume flow rate: 0.4 mL/min; column temperature: 40 ℃; the temperature of the autosampler is 4 ℃; sample introduction amount: 5 μ L.

Mass spectrometric detection parameters

And (4) calculating a result: area method

The results are shown in Table 1.

Table 1:

group of	L-serine production
		Example 2	105g/L
Comparative example 1	3g/L
		Comparative example 2	0g/L
Comparative example 3	4g/L
		Comparative example 4	5g/L
Comparative example 5	65g/L

The above description is only a preferred embodiment of the present application and is not intended to limit the present application, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, improvement and the like made within the spirit and principle of the present application shall be included in the protection scope of the present application.

SEQUENCE LISTING

<110> Zea Jia He Biotech Co., Ltd, Xintai City

<120> a method for producing L-serine by fermentation

<130> 2021

<160> 60

<170> PatentIn version 3.5

<210> 1

<211> 969

<212> DNA

<213> serB

<400> 1

atgcctaaca ttacctggtg cgacctgcct gaagatgtct ctttatggcc gggtctgcct 60

ctttcattaa gtggtgatga agtgatgcca ctggattacc acgcaggtcg tagcggctgg 120

ctgctgtatg gtcgtgggct ggataaacaa cgtctgaccc aataccagag caaactgggt 180

gcggcgatgg tgattgttgc cgcctggtgc gtggaagatt atcaggtgat tcgtctggca 240

ggttcactca ccgcacgggc tacacgcctg gcccacgaag cgcagctgga tgtcgccccg 300

ctggggaaaa tcccgcacct gcgcacgccg ggtttgctgg tgatggatat ggactccacc 360

gccatccaga ttgaatgtat tgatgaaatt gccaaactgg ccggaacggg cgagatggtg 420

gcggaagtaa ccgaacgggc gatgcgcggc gaactcgatt ttaccgccag cctgcgcagc 480

cgtgtggcga cgctgaaagg cgctgacgcc aatattctgc aacaggtgcg tgaaaatctg 540

ccgctgatgc caggcttaac gcaactggtg ctcaagctgg aaacgctggg ctggaaagtg 600

gcgattgcct ccggcggctt tactttcttt gctgaatacc tgcgcgacaa gctgcgcctg 660

accgccgtgg tagccaatga actggagatc atggacggta aatttaccgg caatgtgatc 720

ggcgacatcg tagacgcgca gtacaaagcg aaaactctga ctcgcctcgc gcaggagtat 780

gaaatcccgc tggcgcagac cgtggcgatt ggcgatggag ccaatgacct gccgatgatc 840

aaagcggcag ggctggggat tgcctaccat gccaagccaa aagtgaatga aaaggcggaa 900

gtcaccatcc gtcacgctga cctgatgggg gtattctgca tcctctcagg cagcctgaat 960

cagaagtaa 969

<210> 2

<211> 1089

<212> DNA

<213> serC

<400> 2

atggctcaaa tcttcaattt tagttctggt ccggcaatgc taccggcaga ggtgcttaaa 60

caggctcaac aggaactgcg cgactggaac ggtcttggta cgtcggtgat ggaagtgagt 120

caccgtggca aagagttcat tcaggttgca gaggaagccg agaaggattt tcgcgatctt 180

cttaatgtcc cctccaacta caaggtatta ttctgccatg gcggtggtcg cggtcagttt 240

gctgcggtac cgctgaatat tctcggtgat aaaaccaccg cagattatgt tgatgccggt 300

tactgggcgg caagtgccat taaagaagcg aaaaaatact gcacgcctaa tgtctttgac 360

gccaaagtga ctgttgatgg tctgcgcgcg gttaagccaa tgcgtgaatg gcaactctct 420

gataatgctg cttatatgca ttattgcccg aatgaaacca tcgatggtat cgccatcgac 480

gaaacgccag acttcggcgc agatgtggtg gtcgccgctg acttctcttc aaccattctt 540

tcccgtccga ttgacgtcag ccgttatggt gtaatttacg ctggcgcgca gaaaaatatc 600

ggcccggctg gcctgacaat cgtcatcgtt cgtgaagatt tgctgggcaa agcgaatatc 660

gcgtgtccgt cgattctgga ttattccatc ctcaacgata acggctccat gtttaacacg 720

ccgccgacat ttgcctggta tctatctggt ctggtcttta aatggctgaa agcgaacggc 780

ggtgtagctg aaatggataa aatcaatcag caaaaagcag aactgctata tggggtgatt 840

gataacagcg atttctaccg caatgacgtg gcgaaagcta accgttcgcg gatgaacgtg 900

ccgttccagt tggcggacag tgcgcttgac aaattgttcc ttgaagagtc ttttgctgct 960

ggccttcatg cactgaaagg tcaccgtgtg gtcggcggaa tgcgcgcttc tatttataac 1020

gccatgccgc tggaaggcgt taaagcgctg acagacttca tggttgagtt cgaacgccgt 1080

cacggttaa 1089

<210> 3

<211> 2529

<212> DNA

<213> plasmid PQE-N

<400> 3

ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca 60

attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aaccatggga 120

ggatccagat cttaatagta attagctgag cttggactcc tgttgataga tccagtaatg 180

acctcagaac tccatctgga tttgttcaga acgctcggtt gccgccgggc gttttttatt 240

ggtgagaatc caagctagct tggcgagatt ttcaggagct aaggaagcta aaatggagaa 300

aaaaatcact ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga 360

ggcatttcag tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc 420

ctttttaaag accgtaaaga aaaataagca caagttttat ccggccttta ttcacattct 480

tgcccgcctg atgaatgctc atccggactc gagaaatcat aaaaaattta tttgctttgt 540

gagcggataa caattataat agattcaatt gtgagcggat aacaatttca cacagaattc 600

attaaagagg agaaattaag catgccggcc gtaatagtaa ttaacatgtg agcaaaaggc 660

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 720

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 780

ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 840

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 900

agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 960

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 1020

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 1080

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 1140

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 1200

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 1260

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 1320

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag attatcaaaa 1380

aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat ctaaagtata 1440

tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc tatctcagcg 1500

atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat aactacgata 1560

cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc acgctcaccg 1620

gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag aagtggtcct 1680

gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag agtaagtagt 1740

tcgccagtta atagtttgcg caacgttgtt gccattgcta caggcatcgt ggtgtcacgc 1800

tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 1860

tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 1920

aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 1980

atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 2040

tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa tacgggataa taccgcgcca 2100

catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 2160

aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 2220

tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 2280

gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 2340

tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 2400

tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc 2460

taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt 2520

cgtcttcac 2529

<210> 4

<211> 4570

<212> DNA

<213> pQE-serB&C

<400> 4

ctcgagaaat cataaaaaat ttatttgctt tgtgagcgga taacaattat aatagattca 60

attgtgagcg gataacaatt tcacacagaa ttcattaaag aggagaaatt aaccatggct 120

caaatcttca attttagttc tggtccggca atgctaccgg cagaggtgct taaacaggct 180

caacaggaac tgcgcgactg gaacggtctt ggtacgtcgg tgatggaagt gagtcaccgt 240

ggcaaagagt tcattcaggt tgcagaggaa gccgagaagg attttcgcga tcttcttaat 300

gtcccctcca actacaaggt attattctgc catggcggtg gtcgcggtca gtttgctgcg 360

gtaccgctga atattctcgg tgataaaacc accgcagatt atgttgatgc cggttactgg 420

gcggcaagtg ccattaaaga agcgaaaaaa tactgcacgc ctaatgtctt tgacgccaaa 480

gtgactgttg atggtctgcg cgcggttaag ccaatgcgtg aatggcaact ctctgataat 540

gctgcttata tgcattattg cccgaatgaa accatcgatg gtatcgccat cgacgaaacg 600

ccagacttcg gcgcagatgt ggtggtcgcc gctgacttct cttcaaccat tctttcccgt 660

ccgattgacg tcagccgtta tggtgtaatt tacgctggcg cgcagaaaaa tatcggcccg 720

gctggcctga caatcgtcat cgttcgtgaa gatttgctgg gcaaagcgaa tatcgcgtgt 780

ccgtcgattc tggattattc catcctcaac gataacggct ccatgtttaa cacgccgccg 840

acatttgcct ggtatctatc tggtctggtc tttaaatggc tgaaagcgaa cggcggtgta 900

gctgaaatgg ataaaatcaa tcagcaaaaa gcagaactgc tatatggggt gattgataac 960

agcgatttct accgcaatga cgtggcgaaa gctaaccgtt cgcggatgaa cgtgccgttc 1020

cagttggcgg acagtgcgct tgacaaattg ttccttgaag agtcttttgc tgctggcctt 1080

catgcactga aaggtcaccg tgtggtcggc ggaatgcgcg cttctattta taacgccatg 1140

ccgctggaag gcgttaaagc gctgacagac ttcatggttg agttcgaacg ccgtcacggt 1200

taagatctta atagtaatta gctgagcttg gactcctgtt gatagatcca gtaatgacct 1260

cagaactcca tctggatttg ttcagaacgc tcggttgccg ccgggcgttt tttattggtg 1320

agaatccaag ctagcttggc gagattttca ggagctaagg aagctaaaat ggagaaaaaa 1380

atcactggat ataccaccgt tgatatatcc caatggcatc gtaaagaaca ttttgaggca 1440

tttcagtcag ttgctcaatg tacctataac cagaccgttc agctggatat tacggccttt 1500

ttaaagaccg taaagaaaaa taagcacaag ttttatccgg cctttattca cattcttgcc 1560

cgcctgatga atgctcatcc ggactcgaga aatcataaaa aatttatttg ctttgtgagc 1620

ggataacaat tataatagat tcaattgtga gcggataaca atttcacaca gaattcatta 1680

aagaggagaa attaagcatg cctaacatta cctggtgcga cctgcctgaa gatgtctctt 1740

tatggccggg tctgcctctt tcattaagtg gtgatgaagt gatgccactg gattaccacg 1800

caggtcgtag cggctggctg ctgtatggtc gtgggctgga taaacaacgt ctgacccaat 1860

accagagcaa actgggtgcg gcgatggtga ttgttgccgc ctggtgcgtg gaagattatc 1920

aggtgattcg tctggcaggt tcactcaccg cacgggctac acgcctggcc cacgaagcgc 1980

agctggatgt cgccccgctg gggaaaatcc cgcacctgcg cacgccgggt ttgctggtga 2040

tggatatgga ctccaccgcc atccagattg aatgtattga tgaaattgcc aaactggccg 2100

gaacgggcga gatggtggcg gaagtaaccg aacgggcgat gcgcggcgaa ctcgatttta 2160

ccgccagcct gcgcagccgt gtggcgacgc tgaaaggcgc tgacgccaat attctgcaac 2220

aggtgcgtga aaatctgccg ctgatgccag gcttaacgca actggtgctc aagctggaaa 2280

cgctgggctg gaaagtggcg attgcctccg gcggctttac tttctttgct gaatacctgc 2340

gcgacaagct gcgcctgacc gccgtggtag ccaatgaact ggagatcatg gacggtaaat 2400

ttaccggcaa tgtgatcggc gacatcgtag acgcgcagta caaagcgaaa actctgactc 2460

gcctcgcgca ggagtatgaa atcccgctgg cgcagaccgt ggcgattggc gatggagcca 2520

atgacctgcc gatgatcaaa gcggcagggc tggggattgc ctaccatgcc aagccaaaag 2580

tgaatgaaaa ggcggaagtc accatccgtc acgctgacct gatgggggta ttctgcatcc 2640

tctcaggcag cctgaatcag aagtaacggc cgtaatagta attaacatgt gagcaaaagg 2700

ccagcaaaag gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg 2760

cccccctgac gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg 2820

actataaaga taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac 2880

cctgccgctt accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca 2940

tagctcacgc tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt 3000

gcacgaaccc cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc 3060

caacccggta agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag 3120

agcgaggtat gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac 3180

tagaaggaca gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt 3240

tggtagctct tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa 3300

gcagcagatt acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg 3360

gtctgacgct cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa 3420

aaggatcttc acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat 3480

atatgagtaa acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc 3540

gatctgtcta tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat 3600

acgggagggc ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc 3660

ggctccagat ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc 3720

tgcaacttta tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag 3780

ttcgccagtt aatagtttgc gcaacgttgt tgccattgct acaggcatcg tggtgtcacg 3840

ctcgtcgttt ggtatggctt cattcagctc cggttcccaa cgatcaaggc gagttacatg 3900

atcccccatg ttgtgcaaaa aagcggttag ctccttcggt cctccgatcg ttgtcagaag 3960

taagttggcc gcagtgttat cactcatggt tatggcagca ctgcataatt ctcttactgt 4020

catgccatcc gtaagatgct tttctgtgac tggtgagtac tcaaccaagt cattctgaga 4080

atagtgtatg cggcgaccga gttgctcttg cccggcgtca atacgggata ataccgcgcc 4140

acatagcaga actttaaaag tgctcatcat tggaaaacgt tcttcggggc gaaaactctc 4200

aaggatctta ccgctgttga gatccagttc gatgtaaccc actcgtgcac ccaactgatc 4260

ttcagcatct tttactttca ccagcgtttc tgggtgagca aaaacaggaa ggcaaaatgc 4320

cgcaaaaaag ggaataaggg cgacacggaa atgttgaata ctcatactct tcctttttca 4380

atattattga agcatttatc agggttattg tctcatgagc ggatacatat ttgaatgtat 4440

ttagaaaaat aaacaaatag gggttccgcg cacatttccc cgaaaagtgc cacctgacgt 4500

ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt 4560

tcgtcttcac 4570

<210> 5

<211> 4945

<212> DNA

<213> pGEX-kan plasmid

<400> 5

acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg 60

gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt 120

tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc 180

tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca 240

cacaggaaac agtattcatg tcccctatac taggttattg gaaaattaag ggccttgtgc 300

aacccactcg acttcttttg gaatatcttg aagaaaaata tgaagagcat ttgtatgagc 360

gcgatgaagg tgataaatgg cgaaacaaaa agtttgaatt gggtttggag tttcccaatc 420

ttccttatta tattgatggt gatgttaaat taacacagtc tatggccatc atacgttata 480

tagctgacaa gcacaacatg ttgggtggtt gtccaaaaga gcgtgcagag atttcaatgc 540

ttgaaggagc ggttttggat attagatacg gtgtttcgag aattgcatat agtaaagact 600

ttgaaactct caaagttgat tttcttagca agctacctga aatgctgaaa atgttcgaag 660

atcgtttatg tcataaaaca tatttaaatg gtgatcatgt aacccatcct gacttcatgt 720

tgtatgacgc tcttgatgtt gttttataca tggacccaat gtgcctggat gcgttcccaa 780

aattagtttg ttttaaaaaa cgtattgaag ctatcccaca aattgataag tacttgaaat 840

ccagcaagta tatagcatgg cctttgcagg gctggcaagc cacgtttggt ggtggcgacc 900

atcctccaaa atcggatctg gttccgcgtg gatccccgga attcccgggt cgactcgagc 960

ggccgcatcg tgactgactg acgatctgcc tcgcgcgttt cggtgatgac ggtgaaaacc 1020

tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat gccgggagca 1080

gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca gccatgaccc 1140

agtcacgtag cgatagcgga gtgtataatt cttgaagacg aaagggcctc gtgatacgcc 1200

tatttttata ggttaatgtc atgataataa tggtttctta gacgtcaggt ggactcacgt 1260

taagggattt tggtcatgaa caataaaact gtctgcttac ataaacagta atacaagggg 1320

tgttatgagc catattcaac gggaaacgtc ttgctctagg ccgcgattaa attccaacat 1380

ggatgctgat ttatatgggt ataaatgggc tcgcgataat gtcgggcaat caggtgcgac 1440

aatctatcga ttgtatggga agcccgatgc gccagagttg tttctgaaac atggcaaagg 1500

tagcgttgcc aatgatgtta cagatgagat ggtcagacta aactggctga cggaatttat 1560

gcctcttccg accatcaagc attttatccg tactcctgat gatgcatggt tactcaccac 1620

tgcgatcccc gggaaaacag cattccaggt attagaagaa tatcctgatt caggtgaaaa 1680

tattgttgat gcgctggcag tgttcctgcg ccggttgcat tcgattcctg tttgtaattg 1740

tccttttaac agcgatcgcg tatttcgtct cgctcaggcg caatcacgaa tgaataacgg 1800

tttggttgat gcgagtgatt ttgatgacga gcgtaatggc tggcctgttg aacaagtctg 1860

gaaagaaatg cataaacttt tgccattctc accggattca gtcgtcactc atggtgattt 1920

ctcacttgat aaccttattt ttgacgaggg gaaattaata ggttgtattg atgttggacg 1980

agtcggaatc gcagaccgat accaggatct tgccatccta tggaactgcc tcggtgagtt 2040

ttctccttca ttacagaaac ggctttttca aaaatatggt attgataatc ctgatatgaa 2100

taaattgcag tttcatttga tgctcgatga gtttttctaa gagtcaggca actatggatg 2160

aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg taactgtcag 2220

accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa tttaaaagga 2280

tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt gagttttcgt 2340

tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc 2400

tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc 2460

cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac 2520

caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac 2580

cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt 2640

cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct 2700

gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat 2760

acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt 2820

atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg 2880

cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt 2940

gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt 3000

tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc cctgattctg 3060

tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg 3120

agcgcagcga gtcagtgagc gaggaagcgg aagagcgcct gatgcggtat tttctcctta 3180

cgcatctgtg cggtatttca caccgcataa attccgacac catcgaatgg tgcaaaacct 3240

ttcgcggtat ggcatgatag cgcccggaag agagtcaatt cagggtggtg aatgtgaaac 3300

cagtaacgtt atacgatgtc gcagagtatg ccggtgtctc ttatcagacc gtttcccgcg 3360

tggtgaacca ggccagccac gtttctgcga aaacgcggga aaaagtggaa gcggcgatgg 3420

cggagctgaa ttacattccc aaccgcgtgg cacaacaact ggcgggcaaa cagtcgttgc 3480

tgattggcgt tgccacctcc agtctggccc tgcacgcgcc gtcgcaaatt gtcgcggcga 3540

ttaaatctcg cgccgatcaa ctgggtgcca gcgtggtggt gtcgatggta gaacgaagcg 3600

gcgtcgaagc ctgtaaagcg gcggtgcaca atcttctcgc gcaacgcgtc agtgggctga 3660

tcattaacta tccgctggat gaccaggatg ccattgctgt ggaagctgcc tgcactaatg 3720

ttccggcgtt atttcttgat gtctctgacc agacacccat caacagtatt attttctccc 3780

atgaagacgg tacgcgactg ggcgtggagc atctggtcgc attgggtcac cagcaaatcg 3840

cgctgttagc gggcccatta agttctgtct cggcgcgtct gcgtctggct ggctggcata 3900

aatatctcac tcgcaatcaa attcagccga tagcggaacg ggaaggcgac tggagtgcca 3960

tgtccggttt tcaacaaacc atgcaaatgc tgaatgaggg catcgttccc actgcgatgc 4020

tggttgccaa cgatcagatg gcgctgggcg caatgcgcgc cattaccgag tccgggctgc 4080

gcgttggtgc ggatatctcg gtagtgggat acgacgatac cgaagacagc tcatgttata 4140

tcccgccgtt aaccaccatc aaacaggatt ttcgcctgct ggggcaaacc agcgtggacc 4200

gcttgctgca actctctcag ggccaggcgg tgaagggcaa tcagctgttg cccgtctcac 4260

tggtgaaaag aaaaaccacc ctggcgccca atacgcaaac cgcctctccc cgcgcgttgg 4320

ccgattcatt aatgcagctg gcacgacagg tttcccgact ggaaagcggg cagtgagcgc 4380

aacgcaatta atgtgagtta gctcactcat taggcacccc aggctttaca ctttatgctt 4440

ccggctcgta tgttgtgtgg aattgtgagc ggataacaat ttcacacagg aaacagctat 4500

gaccatgatt acggattcac tggccgtcgt tttacaacgt cgtgactggg aaaaccctgg 4560

cgttacccaa cttaatcgcc ttgcagcaca tccccctttc gccagctggc gtaatagcga 4620

agaggcccgc accgatcgcc cttcccaaca gttgcgcagc ctgaatggcg aatggcgctt 4680

tgcctggttt ccggcaccag aagcggtgcc ggaaagctgg ctggagtgcg atcttcctga 4740

ggccgatact gtcgtcgtcc cctcaaactg gcagatgcac ggttacgatg cgcccatcta 4800

caccaacgta acctatccca ttacggtcaa tccgccgttt gttcccacgg agaatccgac 4860

gggttgttac tcgctcacat ttaatgttga tgaaagctgg ctacaggaag gccagacgcg 4920

aattattttt gatggcgttg gaatt 4945

<210> 6

<211> 999

<212> DNA

<213> serAΔ197

<400> 6

gtgagccaga atggccgtcc ggtagtcctc atcgccgata agcttgcgca gtccactgtt 60

gacgcgcttg gagatgcagt agaagtccgt tgggttgacg gacctaaccg cccagaactg 120

cttgatgcag ttaaggaagc ggacgcactg ctcgtgcgtt ctgctaccac tgtcgatgct 180

gaagtcatcg ccgctgcccc taacttgaag atcgtcggtc gtgccggcgt gggcttggac 240

aacgttgaca tccctgctgc cactgaagct ggcgtcatgg ttgctaacgc accgacctct 300

aatattcact ctgcttgtga gcacgcaatt tctttgctgc tgtctactgc tcgccagatc 360

cctgctgctg atgcgacgct gcgtgagggc gagtggaagc ggtcttcttt caacggtgtg 420

gaaattttcg gaaaaactgt cggtatcgtc ggttttggcc acattggtca gttgtttgct 480

cagcgtcttg ctgcgtttga gaccaccatt gttgcttacg atccttacgc caaccctgct 540

cgtgcagctc agctgaacgt tgagttggtt gagttggatg agctgatgag ccgttctgac 600

tttgtcacca ttcaccttcc taagaccaag gaaactgctg gcatgtttga tgcgcagctc 660

cttgctaagt ccaagaaggg tcagatcatc atcaacgctg ctcgtggcgg tcttgttgat 720

gagcaggctt tggctgatgc gattgagtcc ggtcacattc gtggcgctgg tttcgatgtg 780

tactccaccg agccttgcac tgattctcct ttgttcaagt tgcctcaggt tgttgtgact 840

cctcacttgg gtgcttctac tgaagaggct caggatcgtg cgggtactga tgttgctgat 900

tccgtgctca aggcgctggc tggcgagttc gtggcggatg ctgtgaacgt ttccggtggt 960

cgcgtgggcg aagaggttgc tgtgtggatg gatctggct 999

<210> 7

<211> 1019

<212> DNA

<213> Artificial sequence

<400> 7

tactagggtg tctcagaacg gtcgtccggt tgttctgatc gctgacaaac tggctcagtc 60

taccgttgac gctctgggtg acgctgttga agttcgttgg gttgacggtc cgaaccgtcc 120

ggaactgctg gacgctgtta aagaagctga cgctctgctg gttcgttctg ctaccaccgt 180

tgacgctgaa gttatcgctg ctgctccgaa cctgaaaatc gttggtcgtg ctggtgttgg 240

tctggacaac gttgacatcc cggctgctac cgaagctggt gttatggttg ctaacgctcc 300

gacctctaac atccactctg cttgcgaaca cgctatctct ctgctgctgt ctaccgctcg 360

tcagatcccg gctgctgacg ctaccctgcg tgaaggtgaa tggaaacgtt cttctttcaa 420

cggtgttgaa atcttcggta aaaccgttgg tatcgttggt ttcggtcaca tcggtcagct 480

gttcgctcag cgtctggctg ctttcgaaac caccatcgtt gcttacgacc cgtacgctaa 540

cccggctcgt gctgctcagc tgaacgttga actggttgaa ctggacgaac tgatgtctcg 600

ttctgacttc gttaccatcc acctgccgaa aaccaaagaa accgctggta tgttcgacgc 660

tcagctgctg gctaaatcta aaaaaggtca gatcatcatc aacgctgctc gtggtggtct 720

ggttgacgaa caggctctgg ctgacgctat cgaatctggt cacatccgtg gtgctggttt 780

cgacgtttac tctaccgaac cgtgcaccga ctctccgctg ttcaaactgc cgcaggttgt 840

tgttaccccg cacctgggtg cttctaccga agaagctcag gaccgtgctg gtaccgacgt 900

tgctgactct gttctgaaag ctctggctgg tgaattcgtt gctgacgctg ttaacgtttc 960

tggtggtcgt gttggtgaag aagttgctgt ttggatggac ctggcttaat agcaggtgg 1019

<210> 8

<211> 5037

<212> DNA

<213> pGEX-serA

<400> 8

acgttatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc ggaagctgtg 60

gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc gcactcccgt 120

tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc tgaaatgagc 180

tgttgacaat taatcatcgg ctcgtataat gtgtggaatt gtgagcggat aacaatttca 240

cacaggaaac agtattcatg tcccctatac tagggtgtct cagaacggtc gtccggttgt 300

tctgatcgct gacaaactgg ctcagtctac cgttgacgct ctgggtgacg ctgttgaagt 360

tcgttgggtt gacggtccga accgtccgga actgctggac gctgttaaag aagctgacgc 420

tctgctggtt cgttctgcta ccaccgttga cgctgaagtt atcgctgctg ctccgaacct 480

gaaaatcgtt ggtcgtgctg gtgttggtct ggacaacgtt gacatcccgg ctgctaccga 540

agctggtgtt atggttgcta acgctccgac ctctaacatc cactctgctt gcgaacacgc 600

tatctctctg ctgctgtcta ccgctcgtca gatcccggct gctgacgcta ccctgcgtga 660

aggtgaatgg aaacgttctt ctttcaacgg tgttgaaatc ttcggtaaaa ccgttggtat 720

cgttggtttc ggtcacatcg gtcagctgtt cgctcagcgt ctggctgctt tcgaaaccac 780

catcgttgct tacgacccgt acgctaaccc ggctcgtgct gctcagctga acgttgaact 840

ggttgaactg gacgaactga tgtctcgttc tgacttcgtt accatccacc tgccgaaaac 900

caaagaaacc gctggtatgt tcgacgctca gctgctggct aaatctaaaa aaggtcagat 960

catcatcaac gctgctcgtg gtggtctggt tgacgaacag gctctggctg acgctatcga 1020

atctggtcac atccgtggtg ctggtttcga cgtttactct accgaaccgt gcaccgactc 1080

tccgctgttc aaactgccgc aggttgttgt taccccgcac ctgggtgctt ctaccgaaga 1140

agctcaggac cgtgctggta ccgacgttgc tgactctgtt ctgaaagctc tggctggtga 1200

attcgttgct gacgctgtta acgtttctgg tggtcgtgtt ggtgaagaag ttgctgtttg 1260

gatggacctg gcttaatagc aggtggaaga agatcctttg atcttttcta cggggtctga 1320

cgctcagtgg aacgaaaact cacgttaagg gattttggtc atgaacaata aaactgtctg 1380

cttacataaa cagtaataca aggggtgtta tgagccatat tcaacgggaa acgtcttgct 1440

ctaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg 1500

ataatgtcgg gcaatcaggt gcgacaatct atcgattgta tgggaagccc gatgcgccag 1560

agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca 1620

gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc 1680

ctgatgatgc atggttactc accactgcga tccccgggaa aacagcattc caggtattag 1740

aagaatatcc tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc ctgcgccggt 1800

tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc 1860

aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta 1920

atggctggcc tgttgaacaa gtctggaaag aaatgcataa acttttgcca ttctcaccgg 1980

attcagtcgt cactcatggt gatttctcac ttgataacct tatttttgac gaggggaaat 2040

taataggttg tattgatgtt ggacgagtcg gaatcgcaga ccgataccag gatcttgcca 2100

tcctatggaa ctgcctcggt gagttttctc cttcattaca gaaacggctt tttcaaaaat 2160

atggtattga taatcctgat atgaataaat tgcagtttca tttgatgctc gatgagtttt 2220

tctaacgacg gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg 2280

tgcctcactg attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat 2340

tgatttaaaa cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct 2400

catgaccaaa atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa 2460

gatcaaagga tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa 2520

aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc 2580

gaaggtaact ggcttcagca gagcgcagat accaaatact gtccttctag tgtagccgta 2640

gttaggccac cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct 2700

gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg 2760

atagttaccg gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag 2820

cttggagcga acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc 2880

cacgcttccc gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg 2940

agagcgcacg agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt 3000

tcgccacctc tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg 3060

gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca 3120

catgttcttt cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg 3180

agctgatacc gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc 3240

ggaagagcgc ctgatgcggt attttctcct tacgcatctg tgcggtattt cacaccgcat 3300

aaattccgac accatcgaat ggtgcaaaac ctttcgcggt atggcatgat agcgcccgga 3360

agagagtcaa ttcagggtgg tgaatgtgaa accagtaacg ttatacgatg tcgcagagta 3420

tgccggtgtc tcttatcaga ccgtttcccg cgtggtgaac caggccagcc acgtttctgc 3480

gaaaacgcgg gaaaaagtgg aagcggcgat ggcggagctg aattacattc ccaaccgcgt 3540

ggcacaacaa ctggcgggca aacagtcgtt gctgattggc gttgccacct ccagtctggc 3600

cctgcacgcg ccgtcgcaaa ttgtcgcggc gattaaatct cgcgccgatc aactgggtgc 3660

cagcgtggtg gtgtcgatgg tagaacgaag cggcgtcgaa gcctgtaaag cggcggtgca 3720

caatcttctc gcgcaacgcg tcagtgggct gatcattaac tatccgctgg atgaccagga 3780

tgccattgct gtggaagctg cctgcactaa tgttccggcg ttatttcttg atgtctctga 3840

ccagacaccc atcaacagta ttattttctc ccatgaagac ggtacgcgac tgggcgtgga 3900

gcatctggtc gcattgggtc accagcaaat cgcgctgtta gcgggcccat taagttctgt 3960

ctcggcgcgt ctgcgtctgg ctggctggca taaatatctc actcgcaatc aaattcagcc 4020

gatagcggaa cgggaaggcg actggagtgc catgtccggt tttcaacaaa ccatgcaaat 4080

gctgaatgag ggcatcgttc ccactgcgat gctggttgcc aacgatcaga tggcgctggg 4140

cgcaatgcgc gccattaccg agtccgggct gcgcgttggt gcggatatct cggtagtggg 4200

atacgacgat accgaagaca gctcatgtta tatcccgccg ttaaccacca tcaaacagga 4260

ttttcgcctg ctggggcaaa ccagcgtgga ccgcttgctg caactctctc agggccaggc 4320

ggtgaagggc aatcagctgt tgcccgtctc actggtgaaa agaaaaacca ccctggcgcc 4380

caatacgcaa accgcctctc cccgcgcgtt ggccgattca ttaatgcagc tggcacgaca 4440

ggtttcccga ctggaaagcg ggcagtgagc gcaacgcaat taatgtgagt tagctcactc 4500

attaggcacc ccaggcttta cactttatgc ttccggctcg tatgttgtgt ggaattgtga 4560

gcggataaca atttcacaca ggaaacagct atgaccatga ttacggattc actggccgtc 4620

gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc aacttaatcg ccttgcagca 4680

catccccctt tcgccagctg gcgtaatagc gaagaggccc gcaccgatcg cccttcccaa 4740

cagttgcgca gcctgaatgg cgaatggcgc tttgcctggt ttccggcacc agaagcggtg 4800

ccggaaagct ggctggagtg cgatcttcct gaggccgata ctgtcgtcgt cccctcaaac 4860

tggcagatgc acggttacga tgcgcccatc tacaccaacg taacctatcc cattacggtc 4920

aatccgccgt ttgttcccac ggagaatccg acgggttgtt actcgctcac atttaatgtt 4980

gatgaaagct ggctacagga aggccagacg cgaattattt ttgatggcgt tggaatt 5037

<210> 9

<211> 31

<212> DNA

<213> PKD-gpmA-F

<400> 9

gcagtcggct ttctcatttt aaacgaatga c 31

<210> 10

<211> 31

<212> DNA

<213> PKD-gpmA-R

<400> 10

ttactcctca aatcatcttt taatgataat a 31

<210> 11

<211> 31

<212> DNA

<213> PKD-sdaA -F

<400> 11

ggaagtccag tcaccttgtc aggagtatta t 31

<210> 12

<211> 31

<212> DNA

<213> PKD-sdaA -R

<400> 12

ttcttactcg cccatctgca acggatgggc g 31

<210> 13

<211> 31

<212> DNA

<213> PKD-mrfA -F

<400> 13

gggatagctt gactgtgaaa atcacaggag c 31

<210> 14

<211> 31

<212> DNA

<213> PKD-mrfA -R

<400> 14

taacaacttt gcagattaat taaccaattg a 31

<210> 15

<211> 31

<212> DNA

<213> PKD-pta -F

<400> 15

aacccgccaa atcggcggta acgaaagagg a 31

<210> 16

<211> 31

<212> DNA

<213> PKD-pta -R

<400> 16

tcatccgcag ctttgcgctg cggatatctg a 31

<210> 17

<211> 31

<212> DNA

<213> PKD-glyA -F

<400> 17

caacgagcac attgacagca aatcaccgtt t 31

<210> 18

<211> 31

<212> DNA

<213> PKD-glyA -R

<400> 18

gcatctcctg actcagctaa caataaaatt t 31

<210> 19

<211> 31

<212> DNA

<213> PKD-sdaC -F

<400> 19

ctaaaagctg aattatttgc attcctccag g 31

<210> 20

<211> 31

<212> DNA

<213> PKD-sdaC -R

<400> 20

attgcaatct ccgcaatctt ctactctctg t 31

<210> 21

<211> 31

<212> DNA

<213> PKD-serA -F

<400> 21

agtcagtgac ctgcccgttg attttcagag a 31

<210> 22

<211> 31

<212> DNA

<213> PKD-serA -R

<400> 22

cctgtctttt gaaatgttgt gtgcggattt g 31

<210> 23

<211> 31

<212> DNA

<213> PKD-sstT-F

<400> 23

gggatgtgcg acaacacaat gaaaggatcg a 31

<210> 24

<211> 31

<212> DNA

<213> PKD-sst -R

<400> 24

tgtttaaccc ctttcgtcta cggcggaagg g 31

<210> 25

<211> 31

<212> DNA

<213> PKD-tdcC -F

<400> 25

aattcattca tctcttttct catcctgagt t 31

<210> 26

<211> 31

<212> DNA

<213> PKD-tdcC -R

<400> 26

cctatcctca acgaattaat taagcgtcaa c 31

<210> 27

<211> 31

<212> DNA

<213> PKD-aceA-F

<400> 27

gttagcgtaa accaccacat aactatggag c 31

<210> 28

<211> 31

<212> DNA

<213> PKD-aceA-R

<400> 28

acaaccgttg ctgactgtag gccggataag g 31

<210> 29

<211> 31

<212> DNA

<213> PKD-cycA-F

<400> 29

tgaacaacac agacaggtac aggaagaaaa a 31

<210> 30

<211> 31

<212> DNA

<213> PKD-cycA-R

<400> 30

cattatcatg ctggatggcg caatgccatc c 31

<210> 31

<211> 31

<212> DNA

<213> Test- gpmA-F

<400> 31

aatgtgctcc attgttagca acaaaaaagc c 31

<210> 32

<211> 31

<212> DNA

<213> Test- gpmA-R

<400> 32

atattgccgc gacgaagcaa cagcaatgct t 31

<210> 33

<211> 31

<212> DNA

<213> Test- sdaA -F

<400> 33

tacactatgc gctgttatta gttcgttact g 31

<210> 34

<211> 31

<212> DNA

<213> Test- sdaA -R

<400> 34

gaatttatac ccgctttctc gtctgctgta a 31

<210> 35

<211> 31

<212> DNA

<213> Test- mrfA -F

<400> 35

acatctgtat aaggaatttt taaggttcgt g 31

<210> 36

<211> 31

<212> DNA

<213> Test- mrfA -R

<400> 36

aaatgactta tgaaatttag tgttgacaga c 31

<210> 37

<211> 31

<212> DNA

<213> Test- pta -F

<400> 37

ccgccagctc agctggcggt gctgttttgt a 31

<210> 38

<211> 31

<212> DNA

<213> Test- pta -R

<400> 38

aaccggaaat aatcactatt tccggttttt t 31

<210> 39

<211> 31

<212> DNA

<213> Test- glyA -F

<400> 39

ataaggcgtt cacgccgcat ccggcatgaa c 31

<210> 40

<211> 31

<212> DNA

<213> Test- glyA -R

<400> 40

tttggccttt ataggcggtc ctgttggaca a 31

<210> 41

<211> 31

<212> DNA

<213> Test- sdaC -F

<400> 41

acggtcaggc accttcccgg gctgaactgg c 31

<210> 42

<211> 31

<212> DNA

<213> Test- sdaC -R

<400> 42

ttcagctaag tcctttcgcg ccgctttcgg g 31

<210> 43

<211> 31

<212> DNA

<213> Test- serA -F

<400> 43

cggtgtggag aagggataaa aaaacgggca a 31

<210> 44

<211> 31

<212> DNA

<213> Test- serA -R

<400> 44

gcatccgcct ttcaacatat caaaaaataa t 31

<210> 45

<211> 31

<212> DNA

<213> Test- sstT -F

<400> 45

tcctgaaaga tgcgtcgaca gaacgcacca g 31

<210> 46

<211> 31

<212> DNA

<213> Test- sstT -R

<400> 46

ggttttctca actttaaacg gatcaattcc c 31

<210> 47

<211> 31

<212> DNA

<213> Test- tdcC -F

<400> 47

gaaccacagt taataaccaa aacaaccgga a 31

<210> 48

<211> 31

<212> DNA

<213> Test- tdcC -R

<400> 48

cgaaaccggt gatttgagag acgcgagaaa g 31

<210> 49

<211> 31

<212> DNA

<213> Test- aceA -F

<400> 49

tgatttcctg accctgccag gctaccgcct g 31

<210> 50

<211> 31

<212> DNA

<213> Test- aceA -R

<400> 50

gcgttcacgc cgcatccggc aatcggtgca c 31

<210> 51

<211> 31

<212> DNA

<213> Test- cycA -F

<400> 51

tatcatagac tgactaaagg ccgtagagcc t 31

<210> 52

<211> 31

<212> DNA

<213> Test- cycA -R

<400> 52

cagcttttag atcactcacc cgccagcgcg c 31

<210> 53

<211> 22

<212> DNA

<213> Artificial sequence

<400> 53

ccatgcctaa cattacctgg tg 22

<210> 54

<211> 23

<212> DNA

<213> Artificial sequence

<400> 54

agcctgaatc agaagtaaga tct 23

<210> 55

<211> 24

<212> DNA

<213> Artificial sequence

<400> 55

ccatggctca aatcttcaat ttta 24

<210> 56

<211> 22

<212> DNA

<213> Artificial sequence

<400> 56

tgagttcgaa cgccgtcacg gt 22

<210> 57

<211> 22

<212> DNA

<213> Artificial sequence

<400> 57

agcggataac aatttcacac ag 22

<210> 58

<211> 21

<212> DNA

<213> Artificial sequence

<400> 58

ttctgaggtc attactggat c 21

<210> 59

<211> 23

<212> DNA

<213> Artificial sequence

<400> 59

gggctggcaa gccacgtttg gtg 23

<210> 60

<211> 23

<212> DNA

<213> Artificial sequence

<400> 60

ccgggagctg catgtgtcag agg 23

Claims (7)

1. A method for producing L-serine by fermentation, which is characterized by comprising the following steps:

(1) inoculating the seed liquid of the L-serine production bacteria into a fermentation culture medium for fermentation culture, wherein the temperature of the fermentation culture is 28-32 ℃, the pH value is 6.8-7.2, the dissolved oxygen is 20-40%, and the stirring speed is 150-250 rpm; performing fermentation culture until the OD of the fermentation liquid after being diluted by 100 times₆₀₀When the value is 0.40-0.60, cooling to 27-29 ℃, adding IPTG into the system for induction culture, and performing induction culture for 48-52 h;

monitoring the residual sugar content of the system in the culture process, starting to add supplementary materials when the residual sugar content of the system is less than or equal to 1.0g/L, and keeping the glucose concentration in the system at 0.5-1.0g/L by feeding supplementary materials; the supplementary material contains 60-80g/L glucose, 40-60ml/L molasses and 0.3-0.5g/L folic acid;

(2) and (3) performing bacterium breaking treatment on the culture after induction culture, separating and collecting supernatant, and thus obtaining the culture solution containing the L-serine.

2. The method according to claim 1, wherein the L-serine-producing bacterium is constructed by the following method in step (1):

knocking out gpmA, sdaA, mtfA, pta, glyA, sdaC, serA, sstT, tdcC, aceA and cycA genes in escherichia coli to obtain escherichia coli engineering bacteria;

carrying out enzyme digestion treatment on the serB gene by sphI and AaaI, carrying out enzyme digestion treatment on the serC gene by Nco I and Bgl II, and integrating the serB gene and the serC gene subjected to enzyme digestion treatment onto a plasmid PQE-N to obtain a first recombinant expression vector;

carrying out double enzyme digestion on the pGEX-kan plasmid by ecoNI and Zra I, and integrating the serA delta 197 gene into the plasmid pGEX-kan subjected to double enzyme digestion to obtain a second recombinant expression vector;

and introducing the obtained first recombinant expression vector and the second recombinant expression vector into the escherichia coli engineering bacteria to construct the L-serine producing bacteria.

3. The method according to claim 2, wherein the serB gene has the nucleotide sequence shown in SEQ ID No. 1; the nucleotide sequence of the serC gene is shown as SEQ ID NO. 2; the nucleotide sequence of the plasmid PQE-N is shown as SEQ ID NO. 3; the nucleotide sequence of the first recombinant expression vector is shown as SEQ ID NO. 4; the nucleotide sequence of the pGEX-kan plasmid is shown as SEQ ID NO. 5; the nucleotide sequence of the serA delta 197 gene is shown as SEQ ID NO. 7; the nucleotide sequence of the second recombinant expression vector is shown as SEQ ID NO. 8.

4. The method according to claim 1, wherein the seed solution of the L-serine-producing bacterium is inoculated in an amount of 10 to 15% by weight based on the fermentation medium.

5. The method according to claim 1, wherein in step (1), the composition of the fermentation medium is: 40ml/L of molasses, 30g/L of glucose, 30g/L of corn steep liquor dry powder, 2g/L of monopotassium phosphate, 0.5g/L of citric acid, (NH)₄)₂SO₄ 5g/L、MgSO₄·7H₂O 0.5g/L、MnSO₄ 0.08g/L、FeSO₄0.06g/L, vitamin B₁0.025g/L, biotin 3mg/L, kanamycin 50 ppm.

6. The method of claim 1, wherein in step (1), IPTG is added to give a final concentration of 0.5mmol/L of IPTG in the system.

7. The method according to claim 1, wherein in step (1), the feed comprises 70g/L glucose, 50ml/L molasses and 0.4g/L folic acid.

Images