CN1981039A

CN1981039A - Methods for assembling multiple expression constructs

Info

Publication number: CN1981039A
Application number: CNA2005800227724A
Authority: CN
Inventors: L·P·洛亚尔
Original assignee: BASF Plant Science GmbH
Current assignee: BASF Plant Science GmbH
Priority date: 2004-05-10
Filing date: 2005-04-28
Publication date: 2007-06-13
Also published as: WO2005108568A1; BRPI0511046A; EP1629096A1; CA2564039A1; AU2005240741A1

Abstract

The present invention relates to methods for assembling constructs with multiple gene expression cassettes by directed recombinational cloning. DNA and vectors having engineered recombination sites are provided for use in a recombinational cloning method that enables efficient and specific assembly of expression cassettes to one multiple expression construct in a single recombinational cloning step.

Description

The method of assembling multiple expression constructs

Background of invention

Invention field

The present invention relates to by the method for direct recombinant clone with multi-gene expression box assembling construct.Have the DNA of recombination site of transformation and the method that carrier is provided for recombinant clone, this method allows to by single recombinant clone step effectively with specifically with a multiple expression constructs of expression cassette assembling becoming.

Correlation technique

Site-specific recombinase is the characteristic that is present in the protein in the multiple biology (as virus and bacterium) and it is characterized in that having simultaneously restriction endonuclease and ligase enzyme.These recombinases (sometimes with bonded protein) are discerned the particular sequence of DNA base and are exchanged the DNA section of those section flanks.This recombinase and bonded protein are called as " recombinant protein " (seeing the A. as Landy, Current Opinion in Biotechnology 3:699-707 (1993)) together.Many recombination systems from multiple biology are described.See as people such as Hoess (1986) Nucleic Acids Res 14 (6): 2287; People such as Abremski (1986) J Biol Chem 261 (1): 391; Campbell (1992) JBacteriol 174 (23): 7495; People such as Qian (1992) J Biol Chem 267 (11): 7794; People such as Araki (1992) J Mol Biol 225 (1): 25; Maeser and Kahnmann (1991) Mol GenGenet 230:170-176); People such as Esposito (1997) Nucl Acids Res 25 (18): 3605).Wherein many intergrase families (people (1986) EMBO such as Argos J.5:433-440) that belong to recombinase.Best research wherein may be from lambda particles phage intergrase/att system (Landy A (1993) Current Opinions in Genetics and Devel 3:699-707), from (Hoess and Abremski (1990) the In Nucleic Acids and MolecularBiology of Cre/LoxP system of phage P1, vol.4. edit: Eckstein and Lilley, Berlin-Heidelberg:Springer-Verlag; The 90-109 page or leaf) with from the FLP/FRT system (people (1982) Cell 29:227-234 such as Broach) of yeast saccharomyces cerevisiae (Saccharomyces cerevisiae) 2 μ m plasmids.

Backman (U.S.Pat.No.4673640) discloses the reorganization of λ recombinase and has produced purposes in the segmental body of protein DNA, and this regrouping process uses wild-type recombination site attB and attP to realize by the reorganization of enzymatic locus specificity.Hasan and Szybalski (Gene 56:145-151 (1987)) disclose λ Int recombinase and have been used for the wild-type attP of promotor flank and the interior purposes of body of the reorganization of the intramolecularly between the attB site.

Boyd (Nucl.Acids Res.21:817-821 (1993)) discloses the effect of using the method that promotes that moleculartie helps clone's flush end DNA to the condition of the dephosphorylation carrier that contains wild-type loxP site, this wild-type loxP site to be subjected to being present in the Cre site-specific recombinase of e. coli host cell.

People such as Waterhouse are at (Nucleic Acids Res.21 (9): 2265 (1993)) disclose between loxP that light chain and heavy chain with specific antibodies be cloned in the different bacteriophages carrier and loxP 511 sites and be used for method in the body of the new Bacillus coli cells of transfection.

Transposase family also has been used to transfer information between replicon.Simple or complicated transposon is a structurally variable, but its flank of encoding usually has the recombinase gene of the dna sequence dna of reverse tissue.The integration of transposon can be at random or high degree of specificity.Representational as highly site-specific Tn7, it has been used to the dna fragmentation between the mobile replicon in body people (1993) J.Virol.67:4566-4579 such as () Lucklow.

Devine and Boeke disclose the structure that is used for the artificial transposon of the external insertion receptor dna of dna fragmentation molecule at Nucl.Acids Res.22:3765-3772 (1994).This system uses the intergrase of yeast TY1 virus-like particle.Use standard method between transposon like TY1 end, to clone target DNA fragment.When having the TY1 intergrase, the element random integration of generation is gone into second target DNA molecule.

US5888732 has described the recombinant clone method that is used to promote complicated clone's step.Wherein said method replaces restriction endonuclease and ligase enzyme combination DNA fragment based on passing through with recombinase.By selecting some recombination site and utilize its combination, exercisable application recombinase obtains expected product in the clone.Wherein said method is used to be derived from the cDNA insertion carrier in library, exchange insertion fragment or combination, for example promotor and encoding sequence between multiple expression vector.

At present, the main experiment in the biotechnology relates to the operation of individual gene.Yet many important characters and complicated pathways metabolism are decided by a plurality of intergenic interactions, so genetically engineered must be carried out the operation of polygenic character, multiple characters and polygene product.Basic and applied research all often need import and express a plurality of transgene expression cassettes.Yet, because the restriction of existing method, present polygene method for transformation be time-consuming, (summary is seen people (2002) PlantScience 163:281-295 such as Francois IEJA to effort; People (2001) Plant Mol Biol 47:295-310 such as Halpin C).Current approach comprises sexual hybridization (people (1995) the Science 268:716-719 such as Ma JK that has between other genetically modified plant of branch; People such as Bizily SP (2000) Nat Biotechnol.18:213-217), Shun Xu heavily conversion people (1999) Plant Physiol 119:153-163 such as () Lapierre C, use cotransformation (people (1998) the Nat Biotechnol 16:1060-1064 such as Chen L of a plurality of plasmids; People (2000) Science 287:303-305 such as Ye X; People such as Hadi MZ (1996) Plant Cell Rep.15:500-505), use internal ribosome entry site (IRES) be combined in one under the promotor control a plurality of mRNA encoding sequences people (2000) Plant J 24:583-589 such as () Urwin P or be connected into a plurality of genetically modified single plasmids (people (2002) Plant Mol Biol 50:17-27 such as Goderis IJ by miscellaneous cloning process thereon; People (1998) Plant J 16:107-116 such as Dasgupta S; People such as HalpinC (1999) Plant J 17:453-459; People (2001) Nat Biotechnol19:71-74 such as Decosa B; People (2001) Plant Physiol 127:852-862 such as DeGray G; People (2002) In Vitro Cell Dev.Biol.-Plant 38:537-542 such as Thompson JM).

People such as Lin L (Proc Natl Acad Sci USA 2003,100 (10): 5962-5967) described based on the effect subsequently of site-specific recombinase with by the carrier framework that the homing endonuclease effect produces and remove and the assembling system of 10 expression cassettes nearly.The shortcoming of this system is that each expression cassette adds transformation construct in must in the integration of independent one recombinase-mediated of taking turns and carrier framework is removed subsequently, and described carrier framework is removed the plasmid that comprises independent step and separated and transform once more.Although use this system to make progress and less erroneous tendancy than standard cloning process, it still needs many in-sequence operational step.

Above-mentioned all technology all take time and effort very much.It is made mistakes easily and need carefully verify each clone's step by order-checking.Therefore, need to provide alternative methods to allow to all two or more expression cassettes for a long time biology is carried out quicker and more effective conversion.

Summary of the invention

The invention provides nucleic acid, carrier and method, it is used for using in external or the body recombinant protein to obtain to contain the DNA construct of at least two expression cassettes.It is high special, rapid and labour-saving that these methods are compared with the standard clone technology.

Therefore, first embodiment of the present invention relates to the method that produces the multiple expression constructs (Multiple Expression Construct) that comprises at least two different expression cassettes, and described method is included in external or the interior combination of body

I) one or more insertion fragment donor (Insert Donor) molecule, described insertion fragment donor molecule comprises at least two altogether and inserts fragment I (n), each inserts fragment and comprises at least one expression cassette, described insertion fragment both sides are two different recombination site A (2n) and A (2n+1), wherein n characterizes each to insert segmental from 1 to m integer, and m be different insert segmental sums and

Ii) comprise insertion sheet receptor seq (InsertAcceptor) molecule of two different recombination site A1 and A (2m+2), wherein m is a step I) difference insert segmental sum,

Wherein all recombination site A (1) are different to A (2m+2), and wherein for concrete i, re-assembly side A (2i-1) can with re-assembly side A (2i) reorganization of same i, but substantially with another recombination site reorganization, described i be from 1 to m+1 integer and

Iii) at least a locus specificity recombinant protein, the described recombination site in its can recombinate described insertion fragment donor molecule and described insertion fragment acceptor molecule and

Being enough to make whole described insertion fragments to be transferred to the described combination of incubation under the condition of described insertion fragment acceptor molecule, produce multiple expression constructs thus.

Can choose wantonly from other molecule, as unreacted insertion fragment acceptor molecule insert the fragment donor molecule or other unplanned by product in select or isolate the multiple expression constructs molecule of generation.

Insert the dna fragmentation that fragment donor dna molecule can also comprise at least a mark of encoding, this mark is selected from one of cloning site, restriction site, promotor, operon, replication origin, functional DNA, sense-rna, PCR fragment, protein and protein fragments.Preferably, at least a mark is comprised at least one insertion fragment.Because the high efficiency definite result that high efficiency recombinant clone method produces, this mark must not be the selective markers of the multiple expression constructs that can isolation and selection produces.

In preferred embodiments, insert the fragment acceptor molecule and comprise the dna fragmentation that flank is described two different recombination site A1 and A (2m+2), this recombination site will be replaced in regrouping process.Preferably, insert the fragment acceptor molecule and comprise at least a selective marker.More preferably, insert the fragment acceptor molecule and also comprise (a) virulent gene and (b) selective marker, wherein said virulent gene is positioned on the different dna fragmentations with described selective marker, and this dna fragmentation is separated from each other by at least two recombination sites.Preferably, virulent gene is owing to recombination method and from inserting fragment acceptor molecule disappearance.

The selective marker (Selectable Marker) of can be contained in and insert fragment, inserting fragment donor, insertion sheet receptor seq or carrier donor molecule can comprise at least one segment DNA fragment, and this dna fragmentation is selected from:

(a) its coded product provides the dna fragmentation at other toxic chemical resistance (" negative selectable marker ") in recipient cell or biology;

(b) dna fragmentation of its coded product toxic in recipient cell or biology (" anti-selective marker ");

(c) its coded product is given the dna fragmentation of recipient cell or biological growth or proliferative advantage (" positive selective marker ");

(d) its coded product can certified dna fragmentation;

(e) its coded product suppresses a kind of dna fragmentation of cell function in recipient cell;

(f) the active dna fragmentation of any dna fragmentation of inhibition above (a)-(e);

(g) with the product bonded dna fragmentation of modifying substrate;

(h) its coding can be by the dna fragmentation of the specificity nucleotide sequence identification of protein, RNA, DNA or chemical identification;

(i) when lacking, it gives dna fragmentation directly or indirectly to the susceptibility of the cell killing that in recipient cell, causes by specific compound;

(j) dna fragmentation of its coded product suppressor gene its lytic activity in host cell;

(k) dna fragmentation that lacks at recipient cell of its coded product and;

(1) can be used to separate or identify the dna fragmentation of the molecule of wanting.

Described selective marker can preferably include at least a mark, this mark be selected from antibiotics resistance gene, herbicide resistance gene, tRNA gene, nutrient defect type mark, virulent gene, phenotypic markers, antisense oligonucleotide, restriction endonuclease, restriction endonuclease cleavage site, enzyme cleavage site, protein binding site and with PCR primer sequence complementary sequence.

In preferred embodiments, inserting the fragment acceptor molecule is the carrier donor molecule that preferably is selected from protokaryon and/or eukaryotic vector.According to the present invention, the carrier donor molecule can be included in the carrier that works in multiple systems or the host cell.Carrier preferred for the present invention comprises maybe can shuttle back and forth carrier (as shuttle vectors) between multiple protokaryon and/or eukaryotic system of prokaryotic vector, eukaryotic vector.Preferred eukaryotic vector is included in the carrier that duplicates in yeast cell, vegetable cell, fry cell, eukaryotic cell, mammalian cell or the insect cell.Preferred prokaryotic vector is included in the carrier that duplicates in Gram-negative and/or the gram positive bacterium, more preferably the carrier that duplicates in the bacterium of Escherichia (Escherichia), salmonella (Salmonella), bacillus (bacillus), streptomyces (Streptomyces), Agrobacterium (Agrobacterium), rhizobium (Rhizobium) or Rhodopseudomonas (Pseudomonas).Most preferred carrier is the carrier that can both duplicate in intestinal bacteria and Agrobacterium.Be used for the carrier that eukaryotic vector of the present invention is included in propagation such as yeast cell, vegetable cell, mammalian cell (particularly people's cell), fungal cell, insect cell, fry cell and/or duplicates.Concrete purpose carrier includes but not limited to cloning vector, sequencing vector, expression vector, fusion vector, double cross carrier, gene therapy vector and reverse double cross carrier.These carriers can be used to protokaryon and/or eukaryotic system by concrete carrier decision.

Inserting fragment donor dna molecule, insertion fragment receptor dna molecule and/or vector donor dna molecule can be made up of linearity or ring-shaped DNA molecule respectively.Insert the dna fragmentation that the fragment donor molecule can comprise carrier or amplification generation.

Method of the present invention can also comprise the step of selecting multiple expression constructs, and this construct contains the whole described insertion fragment of described insertion fragment donor molecule.

Multiple recombination site and corresponding recombinant protein can be used to method of the present invention.Preferably, recombination site is selected from loxP, attB, attP, attL and attR.More preferably, described recombination site contains the dna sequence dna that is selected from one of following sequence and corresponding or complementary DNA or RNA sequence:

(a)RKYCWGCTTTYKTRTACNAASTSGB(m-att) (SEQ ID NO：1)；

(b)AGCCWGCTTTYKTRTACNAACTSGB(m-attB) (SEQ ID NO：2)；

(c)GTTCAGCTTTCKTRTACNAACTSGB(m-attR) (SEQ ID NO：3)；

(d)AGCCWGCTTTCKTRTACNAAGTSGB(m-attL) (SEQ ID NO：4)；

(e)GTTCAGCTTTYKTRTACNAAGTSGB(m-attP1)(SEQ ID NO：5)；

Wherein R=A or G; K=G or T/U; Y=C or T/U; W=A or T/U; N=A, C or G or T/U; S=C or G; With B=C, G or T/U

Most preferably, recombination site contains the dna sequence dna that is selected from one of following sequence and corresponding or complementary DNA or RNA sequence:

(a)AGCCTGCTTTTTTGTACAAACTTGT(attB1) (SEQ ID NO：6)；

(b)AGCCTGCTTTCTTGTACAAACTTGT(attB2) (SEQ ID NO：7)；

(c)ACCCAGCTTTCTTGTACAAACTTGT(attB3) (SEQ ID NO：8)；

(d)GTTCAGCTTTTTTGTACAAACTTGT(attR1) (SEQ ID NO：9)；

(e)GTTCAGCTTTCTTGTACAAACTTGT(attR2) (SEQ ID NO：10)；

(f)GTTCAGCTTTCTTGTACAAAGTTGG(attR3) (SEQ ID NO：11)；

(g)AGCCTGCTTTTTTGTACAAAGTTGG(attL1) (SEQ ID NO：12)；

(h)AGCCTGCTTTCTTGTACAAAGTTGG(attL2) (SEQ ID NO：13)；

(i)ACCCAGCTTTCTTGTACAAAGTTGG(attL3) (SEQ ID NO：14)；

(j)GTTCAGCTTTTTTGTACAAAGTTGG(attP1) (SEQ ID NO：15)；

(k)GTTCAGCTTTCTTGTACAAAGTTGG(attP2，P3)(SEQ ID NO：16)；

(l)AGCCTGCTTTTTTGTACAAACTTGC(attB1 ^*) (SEQ ID NO：52)；

(m)ACCCAGCTTTCTTGTACAAAGTGGC(attB2 ^*) (SEQ ID NO：53)；

(N)CAACTTTATTATACATAGTTG (attB3 ^*) (SEQ ID NO：54)

(O)CAACTTTTCTATACAAAGTTG (attB4 ^*) (SEQ ID NO：55)

(p)GTTCAACTTTTTTGTACAAACTTGC(attR1 ^*) (SEQ ID NO：56)

(q)TTCAACTTTCTTGTACAAAGTGGG (attR2 ^*) (SEQ ID NO：57)

(r)GTTCAACTTTATTATACATAGTTGA(attR3 ^*) (SEQ ID NO：58)

(s)GTTCAACTTTTCTATACAAAGTTGA(attR4 ^*) (SEQ ID NO：59)

(t)AGCCTGCTTTTTTGTACAAAGTTGG(attL1 ^*) (SEQ ID NO：60)

(u)ACCCAGCTTTCTTGTACAAAGTTGG(attL2 ^*) (SEQ ID NO：61)

(v)GGCAACTTTATTATACAAAGTTGG (attL3 ^*) (SEQ ID NO：62)

(w)ACCCAACTTTTCTATACAAAGTTGG(attL4 ^*) (SEQ ID NO：63)

(x)GTTCAACTTTTTTGTACAAAGTTGG(attP1 ^*) (SEQ ID NO：64)

(y)GTTCAGCTTTCTTGTACAAAGTTGG(attP2 ^*) (SEQ ID NO：65)

(z)GTTCAACTTTATTATACAAAGTTGG(attP3 ^*) (SEQ ID NO：66)

(aa)GTTCAACTTTTCTATACAAAGTTGG(attP4 ^*) (SEQ ID NO：67)

Preferably, described recombinant protein is selected from Int, Cre, Flp and Res.

Be included in expression cassette in the insertion fragment of inserting the fragment donor molecule by the purpose nucleotide sequence that is operably connected to promoter sequence and optional, adjusting sequence in addition is compositions such as Transcription Termination subsequence, enhanser for example.According to the biological promotor of selecting of target, plan in described biology, to express from the gained multiple expression constructs.For example, if plan in plant, to express, use in plant, to have the promotor of transcriptional activity.The purpose nucleotide sequence should be understood (as defined above) by generalized.Expression cassette can cause translating or the transcribing of interpretable RNA.The RNA that can not translate can comprise for example antisense or double-stranded RNA, thereby its gene silencing that produces corresponding native gene is given useful proterties.Thereby interpretable RNA can produce protein and give useful proterties.

According to knowledge well known in the art, following accompanying drawing and description and claim of the present invention, other embodiment preferred of the present invention is conspicuous for those skilled in the art.

General Definition

Should be understood that the present invention is not limited to described concrete methodology, scheme, clone, plant species or genus, construct and reagent.Should be understood that also term used herein is a purpose to describe specific embodiments only, and be not that intention limits the scope of the invention that its scope only will be limited by the appended claims.In the following description, used many terms are widely used in recombinant DNA technology.In order to know and as one man to understand this specification sheets and claim, comprise the scope that these terms provide, following definition is provided.

It must be noted that, unless have other clearly to indicate herein, this paper and in claims " " and " this " of used singulative comprise that plural number refers to.Therefore, for example mention that " carrier " is meant one or more carriers and comprises and well known to a person skilled in the art its equivalent or the like.

That term " about " used herein means is about, near schematic, or in this zone.When term " about " was used to numerical range, it modified its scope by the boundary up and down of extending the numerical value that proposes.Usually, term " about " be used in the text with described numerical value about in the of 20% the change of (higher or lower) modify the numerical value that is higher or lower than described numerical value.

As used herein, word " or " mean concrete listed any member and also comprise the member's who lists arbitrary combination.

Term " Nucleotide " refers to base-sugar-phosphoric acid ester combination.Nucleotide is the monomer unit of nucleotide sequence (DNA and RNA).Term Nucleotide comprises ribonucleotide triphosphate ATP, UTP, CTP, GTP and deoxyribonucleoside triphosphate such as dATP, dCTP, dITP, dUTP, dGTP, dTTP or derivatives thereof.These derivatives comprise, for example [α S] dATP, 7-denitrogenation assorted-dGTP and 7-denitrogenation be assorted-dATP.Used term Nucleotide also refers to bi-deoxyribose ribonucleoside triphosphote (ddNTP) and its derivative in the literary composition.The illustrative example of bi-deoxyribose ribonucleoside triphosphote includes but not limited to ddATP, ddCTP, ddGTP, ddITP and ddTTP.According to the present invention, " Nucleotide " can be unlabelled or can detect ground mark by knowing technology.Detectable mark comprises, for example radio isotope, fluorescent mark, chemiluminescent labeling, bioluminescence marker and enzyme labelling.

Term " nucleic acid " refers to strand or two strands, the deoxyribonucleotide of justice or antisense form or ribonucleotide with and polymkeric substance or heterocomplex.

Unless otherwise noted, specific nucleotide sequence also comprises its conservative variant of modifying (substituting as degenerate codon) and complementary sequence and the sequence that spells out undoubtedly.Term " nucleic acid " in this article with " gene ", " cDNA ", " mRNA ", " oligonucleotide " and " polynucleotide " interchangeable use.

Phrase " nucleotide sequence " refers to the continuous sequence of abbreviation, letter, character or the speech of table Nucleotide as used herein.In one embodiment, nucleic acid can be the nucleic acid " probe " that is less than 100 Nucleotide on the normal length of lacking relatively.Usually nucleic acid probe is to about 100 Nucleotide on length from about 50 Nucleotide." target region " of nucleic acid is the part that is accredited as important nucleic acid." coding region " of nucleic acid is when placing proper regulation sequence control to transcribe and translate the part that produces specific polypeptide or proteinic nucleic acid in the sequence-specific mode down.Described coding region encode this class polypeptide or protein.

Term " oligonucleotide " refers to contain the synthetic or natural molecule of the nucleotide sequence that covalency links to each other, and described Nucleotide is connected by phosphodiester bond between 5 ' position of the ribodesose of 3 ' position of the ribodesose of a Nucleotide or ribose and adjacent nucleotide or ribose.

Term " antisense " is understood that to mean the nucleic acid with the sequence that is complementary to target sequence, and for example messenger RNA(mRNA) (mRNA) sequence is attempted by hybridizing the blocking-up that starts its expression with target sequence.

Term " justice " is understood that to mean sequence homology or same as the nucleic acid of target sequence, for example is incorporated into protein and transcribes the sequence of the factor and relate to the sequence that specific gene is expressed.According to embodiment preferred, this nucleic acid comprises goal gene and allows the element of described destination gene expression.

Term " gene " refers to be operably connected to the coding region of proper regulation sequence, and this adjusting sequence can be regulated expression of polypeptides in some mode.Gene is included in coding region (open reading-frame (ORF), ORF) regulatory region (as promotor, enhanser, repressor etc.) and the where applicable of the untranslated of the DNA of front (upstream) and back (downstream), the intervening sequence (being intron) between single encoded district (being exon).

As used herein, term " coding region " refers to the amino acid whose nucleotide sequence of encoding and finding in newborn polypeptide as the translation result of mRNA molecule when being used to structure gene.5 ' the side on border, eukaryote coding region is the coding nucleotide triplet " ATG " of initial methionine and 3 ' side is one of three triplets of specifying terminator codons (being TAA, TAG, TGA).Except containing intron, the genome type of gene can also comprise the sequence that is positioned at rna transcription thing sequence 5 ' and 3 ' end simultaneously.These sequences be called as " flank " sequence or zone (these flanking sequences be positioned at the mRNA transcript non-translated sequence 5 ' or 3 ').Described 5 ' flanking region can comprise regulates sequence as controlling or influence the promotor and the enhanser of genetic transcription.Described 3 ' flanking region can comprise the sequence that instructs Transcription Termination, transcribes back cutting and poly-adenosine effect.

Term " amplification " refers to use polysaccharase to increase any in vitro method of nucleotide sequence copy numbers.Nucleic acid amplification makes Nucleotide mix DNA and/or RNA molecule or primer and forms thus and template complementary recruit.The nucleic acid molecule that forms and its template can be used as the template of synthetic other nucleic acid molecule.As used herein, an amplified reaction can be made up of duplicating of many wheels.Dna amplification reaction comprises, for example polymerase chain reaction (PCR).A PCR reaction can be made up of sex change and dna molecular synthetic 5 to 100 " circulations ".

Term " polypeptide ", " peptide ", " oligopeptides ", " gene product ", " expression product " and " protein " refer to the polymer or the oligomer of continuous amino acid residue, are used interchangeably in this article.

Term used herein " isolating " means material and is removed from its primal environment.For example, the polynucleotide or the polypeptide that are present in the natural generation in the Live Animals are not isolating, and still isolated same polynucleotide or polypeptide are isolating in some or all coexisting substances from natural system.The part that these class polynucleotide can be carriers and/or this class polynucleotide or polypeptide can be the parts of composition, and since this class carrier or composition be not the part of its primal environment thereby be isolating.

Preferably, term " isolating " is when being used to nucleic acid, as being identified in the bonded impurity nucleic acid its natural origin usually and separate from least a at " isolated nucleic acid sequences " middle finger.Isolating nucleic acid is so that naturally occurring multi-form or background exists with it.On the contrary, non-isolating nucleic acid be find with native state exist nucleic acid, as DNA and RNA.For example, specific dna sequence dna (as gene) is found in the host cell chromosome near the contiguous gene place; The RNA sequence, the multiple mRNA that is found in the cell with the coding multiple proteins as the specific mRNA sequence of encode specific protein matter forms mixture.For example, the isolated nucleic acid sequences of coding specific trait comprises (for example) this nucleotide sequence in the cell that contains described nucleotide sequence usually, wherein said nucleotide sequence different on karyomit(e) or in extrachromosomal position and the n cell, or the flank nucleotide sequence is different from the nucleotide sequence of natural discovery.Described isolated nucleic acid sequences can exist with strand or double chain form.When using the isolated nucleic acid sequences marking protein, this nucleotide sequence is with minimum justice or the coding strand part (being that nucleotide sequence can be a strand) of containing at least.Alternatively, it can contain justice and antisense strand (being that nucleotide sequence can be double-stranded) simultaneously.

As used herein, term " purifying " refers to the isolating nucleic acid or the aminoacid sequence molecule that shift out from natural surroundings.Therefore " isolated nucleic acid sequences " is the nucleotide sequence of purifying." basic purifying " molecule at least 60% does not have, and preferably at least 75% does not have and more preferably at least 90% do not have its other component of natural bonded.

As used herein, term " complementary " or " complementation " refer to the nucleotide sequence relevant according to basepairing rule.For example, sequence 5 '-AGT-3 ' is complementary to sequence 5 '-ACT-3 '.Complementation can be " part " or " whole "." part " complementation is that one of them or more nucleic acid base do not match according to basepairing rule." whole " or " completely " complementation is that each and all nucleic acid bases mate with another base under basepairing rule between the nucleic acid.Complementary degree between the nucleic acid chains has remarkably influenced for efficient of hybridizing between the nucleic acid chains and intensity.

As used herein, " complementary sequence " of nucleotide sequence refers to that its nucleic acid is complementary to the nucleotide sequence of the nucleic acid of described nucleotide sequence fully.

Term " wild-type ", " natural " or " natural origin " mean about biological, polypeptide or nucleotide sequence, described biology be natural generation or by at least a by the mankind transform, the biology of the natural generation of sudden change or other manual operation do not provide.

Term " genetically modified " or " reorganization " refer to contain transgenosis or change its genomic cell by importing transgenosis when being used for cell.Term " genetically modified " one or more contain genetically modified cell or changes the tissue or the plant of its genomic cell by importing transgenosis being used to organize or referring to respectively during plant comprise.Can produce transgenic cell, tissue and plant by several different methods, it comprises the karyomit(e) that the method (as using methods described herein) by manual intervention will contain " transgenosis " importing target cell of nucleic acid (normally DNA) or be integrated into target cell.

Term used herein " transgenosis " refers to via the genomic any nucleotide sequence of experimental implementation transfered cell.Transgenosis can be " endogenous dna sequence dna " or " allogeneic dna sequence " (i.e. " foreign DNA ").Term " endogenous dna sequence dna " refers to the nucleotide sequence of natural discovery in the cell that is imported into, as long as this nucleotide sequence does not comprise modification (as point mutation, have selectable marker gene etc.) with respect to natural generation sequence.Term " allogeneic dna sequence " refers to nucleotide sequence, and it is connected in or is operated and is connected in the nucleotide sequence that does not connect or be connected different positions under native state under native state.Allogeneic dna sequence DNA is not endogenous to the cell that is imported into, but obtains from another cell.Allogeneic dna sequence DNA also comprises the endogenous dna sequence dna that contains some modifications.Usually, although and nonessential, allogeneic dna sequence DNA is encoded, and it is imported into and RNA and protein that the cell of expressing does not produce usually.The example of allogeneic dna sequence DNA comprises reporter gene, transcribes and translates adjusting sequence, selective marker protein (as giving the protein of drug resistance) etc.Preferably, about regulating sequence (as promotor of the present invention), term " genetically modified " or " reorganization " mean that described adjusting sequence is covalently attached to and adjacent to non-conterminous nucleic acid in its natural surroundings.

Term " foreign gene " refers to operate by experiment the genomic any nucleic acid of transfered cell (as gene order) and can be included in the gene order of finding in this cell, as long as the gene that imports contains certain modification (as point mutation, have selectable marker gene or the like) with respect to the gene of natural generation.

" recombinant polypeptide " or " recombinant protein " refers to be produced by recombinant DNA technology, i.e. the polypeptide or the protein that produce of polypeptide of being wanted by coding or proteinic external source recombinant DNA construction body institute cell transformed.But recombinant nucleic acid and polypeptide can also comprise that non-natural exists be through modification, change, sudden change or other manually-operated molecule.

Term " heterologous nucleic acid sequence " or " allogeneic dna sequence DNA " be tradable to be used in reference to the nucleotide sequence that generation is connected in nucleotide sequence, and this is connected and does not exist under the native state or be connected different positions in natural.Allogeneic dna sequence DNA is endogenous to the cell right and wrong that are imported into, but can obtain from other cell.Generally speaking, although and nonessential, these allogeneic dna sequence DNAs RNA and protein that this cell does not generally produce of in the cell of its expression, encoding.

Term " biology ", " host ", " target biology " or " host living beings " refer to any protokaryon or eukaryote, and it can be the acceptor of recombinant clone multiple expression constructs.Term as used herein " host " comprise by the protokaryon of genetic modification or eukaryote.These hosts' example is seen Maniatis T, Fritsch EF and Sambrook J (1989) Molecular Cloning:A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor (NY)).Comprise complete biological and be derived from its organ, partly, cell, culture, fertile material.Preferred microorganism, non-human animal and plant biological.Preferred microorganism is bacterium, yeast, algae or fungi.

Preferred bacterium is the bacterium of following dependent of dead military hero: Escherichia (Escherichia), Corynebacterium (Corynebacterium), bacillus (Bacillus), erwinia (Erwinia), Agrobacterium (Agrobacterium), Flavobacterium (Flavobacterium), Alkaligenes (Alcaligenes), fusobacterium (Clostridium), Proionibacterium, Butyrivibrio (Butyrivibrio), eubacterium (Eubacterium), lactobacillus (Lactobacillus), brown algae (Phaeodactylum), Colpidium (Colpidium), mortierella (Mortierella), entomophthora (Entomophthora), Mucor (Mucor), Crypthecodinium cohnii (Crypthecodinium) or cyanobacteria belong to (cyanobacteria), for example Synechocystis.Particularly preferably be the microorganism of can infection plant and transmitting construct of the present invention thus.Preferred microorganism is from Agrobacterium, and agrobacterium tumefaciens (Agrobacterium tumefaciens) is planted particularly.

Preferred yeast is mycocandida (Candida), yeast belong (Saccharomyces), Hansenula (Hansenula) or Pichia (Pichia).Preferred fungi is Aspergillus (Aspergillus), Trichoderma (Trichoderma), AshbyaCif (Ashbya), Neurospora (Neurospora), Fusarium (Fusarium), Beauveria (Beauveria) or other fungi.According to purpose of the present invention, plant biological still is that those can carry out photosynthetic other biology, for example algae or cyanobacteria, and mosses.Preferred algae be green alga as, haematococcus (haematococcus), Phaedactylumtricornatum, volvox (Volvox) or Dunaliella salina belong to the algae of (Dunaliella).

Preferred eukaryotic cell and biology comprise vegetable cell and biology, zooblast and inhuman animal organism, comprise eukaryotic microorganisms such as yeast, algae or fungi.

" inhuman animal organism " includes but not limited to inhuman vertebrates and invertebrates.Preferred fish; Non-human mammal is as milk cow, horse, sheep, goat, mouse, rat or pig; Birds are as chicken or goose.The preferred animal cell comprises for example CHO, COS, HEK293 cell.Invertebral living creature comprises for example nematode and insect.Insect cell comprises for example fruit bat S2 cell and noctuid Sf9 or Sf21 cell.

Preferably can instruction plant, animal or human's nematode.Preferably nematode comprises, for example Ancylostoma (Ancylostoma), Ascaridia (Ascaridia), Ascaris (Ascaris), Bunostomum (Bunostomum), latent rhabditida belongs to (Caenorhabditis), Hepaticola (Capillaria), Chabertia (Chabertia), Cooperia (Cooperia), Dictyocaulus (Dictyocaulus), Haemonchus (Haemonchus), Heterakis (Heterakis), Nematodirus (Nematodirus), oesophagostomum (Oesophagostomum), Ostertagia (Ostertagia), Oxyuris (Oxyuris), parascris (Parascaris), Strongylus (Strongylus), Toxascaris (Toxascaris), Trichocephalus (Trichuris), trichostrongylus (Trichostrongylus), Tfhchonema, the nematode of Belascaris (Toxocara) or Ancylostoma (Uncinaria).Particularly preferably be the nematode of phytotrophy, as umbrella Aphelenchoides (Bursaphalenchus), little loop wire Eimeria (Criconemella), Diiylenchus, Ditylenchus (Ditylenchus), gold nematode (Globodera), spiral belongs to (Helicotylenchus), Heterodera (Heterodera), minute hand belongs to (Longidorus), Melodoigyne, pearl curve Eimeria (Nacobbus), needlework Eimeria (Paratylenchus), Pratylenchidae belongs to (Pratylenchus), perforation belongs to (Radopholus), Rotelynchus, Tylenchus (Tylenchus) or Xiphinema (Xiphinema).Preferred insect comprises the insect of Coleoptera (Coleoptera), Diptera (Diptera), lepidopteran (Lepidoptera) and Homoptera (Homoptera).

Preferred fungi is Aspergillus, Trichoderma (Trichoderma), AshbyaCif (Ashbya), Neurospora (Neurospora), Fusarium (Fusarium), Beauveria (Beauveria) or other fungi, as at Indian Chem Engr.Section B.Vol 37, No 1,2 (1995), 15 page tables 6 are described.Preferred especially thread Hemiascomycelaceae Ashbya gossypii.

Preferred yeast is mycocandida, yeast belong, Hansenula or Pichia (Pichia), special preferably saccharomyces cerevisiae and pichia pastoris phaff (Pichia pastoris) (ATCC searching number 201178).

Term used herein " plant " or " plant biological " refer to numerous vegetable cells, and it is divided into the structure in any stage that is present in development of plants to a great extent.Such structure comprises one or more plant organs, and it includes, but are not limited to fruit, bud, stem, leaf, petal etc.Preferably as the host of genetically modified organism or target biology especially plant.All genus and the kind that comprise botanic senior or lower plant within the scope of the present invention.Also comprise maturation plant, seed, bud and seedling and part, reproductive material and therefrom deutero-culture, for example cell culture.Term " maturation plant " is understood that to mean the seedling plant of any etap on the stage.Term " seedling " is understood that to mean the immature plant of the youth of etap in early days.

Yearly plant, 2 years living plants, unifacial leaf and dicotyledonss are the preferred host living beings that is used to produce transgenic plant.Genetic expression in whole ornamental plants, tree useful or that view and admire, flower, cut-flower, shrub or lawn is more useful.Can mention by way of example but not as the plant of restriction be angiosperm, bryophyte as, for example liverwort (Hepaticae) and mosses Musc; Pteridophyte (Pteridophytes) is as pteridophyte, horse hair and lycopod; Gymnosperm is as pine, sago cycas, ginkgo and Gnetatae; Algae such as Chlorophyceae (Chlorophyceae), Phaeophyceae (Phaeophpyceae), Rhodophyceae (Rhodophyceae), Myxophyceae, Xanthophyceae (Xanthophyceae), diatom (Bacillariophyceae) and Euglenophyceae (Euglenophyceae).

Be preferred for the plant of food or feed purpose, as pulse family (Leguminosae) as pea, clover and soya bean; Gramineae (Gramineae) is as rice, corn, wheat, barley, jowar, grain, rye, triticale or oat; Umbelliferae (Umbelliferae), particularly Daucus (Daucus), very particularly carrot seed (carota) (Radix Dauci Sativae) and Apium L (Apium), very particularly celery (Graveolens dulce) and other; Solanaceae (Solanaceae), particularly tomato belongs to (Lycopersicon), very special tomato species (esculentum) (tomato) and Solanum (Solanum), very specifically potato seed (tuberosum) (potato) and eggplant (melongena) (eggplant) and other (as tobacco); And Capsicum (Capsicum) capsicum kind (annuum) (capsicum) and other; Pulse family (Leguminosae), particularly Glycine (Glycine) soybean kind (max) (soybean), clover, pea, alfalfa, beans or peanut and other; And Cruciferae (Brassicacae), particularly Btassica (Brassica) colea kind (napus) (rape), rape kind (campestris) (beet), oleracea cv Tastie (Caulis et Folium Brassicae capitatae), oleracea cv Snowball Y (Cauliflower) and oleracea cv Emperor (Cauliflower); And Arabidopsis (Arabidopsis) Arabidopis thaliana kind (thaliana) and other; Composite family, particularly Lactuca (Lactuca) lettuce kind (sativa) (lettuce) and other; Aster section (Asteraceae) is as Sunflower Receptacle, Flower of Aztec Marigold, lettuce or mary bush and other; Curcurbitaceae (Cucurbitaceae) is as melon, pumpkin or summer squash (zucchini) and Semen Lini.More preferably cotton, sugarcane, hemp, flax, capsicum and multiple tree, nut and winespecies.Especially preferred is Arabidopis thaliana (Arabidopsis thaliana), tobacco (Nicotianatabacum), Flower of Aztec Marigold (Tagetes erecta), mary bush (Calendula officinalis), soybean (Glycine max), Zea mays (Zea mays), rice (Oryza sativa), common wheat (Triticumaestivum), pea (Pisum sativum), Kidney bean (Phaseolus vulgaris), barley (Hordiumvulgare), colea (Brassica napus).

Term " cell " refers to individual cells.The phalangeal cell group gone back in term " cell ".Described group can be the pure cell mass that comprises a kind of cell type.Similarly, described group can comprise more than a kind of cell type.In the present invention, the cell type number that cell mass can comprise without limits.Described cell can be synchronized or unsynchronized, and preferred described cell is synchronized.

Mean the part of plant and can comprise (but should not be limited to) for example root, fruit, branch, stem, leaf, flower pesticide, sepal, petal, pollen, seed etc. about the term " organ " (or " plant organ ") of plant.

Mean about the term " tissue " (or " plant tissue ") of plant and to comprise arrangements differentiation and a plurality of vegetable cells undifferentiated plant tissue.Plant tissue can constitute the part (as the epidermis of leaf) of plant organ but also can constitute tumor tissue and polytype culturing cell (as individual cells, protoplastis, embryo, Zhi, class protocorm etc.).Plant tissue can be in plant in (in planta), the organ culture, in the tissue culture or in the cell cultures.

Term " chromosomal DNA " or " chromosomal DNA sequence " are understood that to be independent of the nuclear genomic dna of cell cycle state.Therefore chromosomal DNA can be organized in karyomit(e) or the chromatid.They can be condensed or uncoiling.Can be by the multiple currently known methods in present technique field, as the insertion in polymerase chain reaction (PCR) analysis, southern blotting technique analysis, original position fluorescent hybridization (FISH) and original position PCR proof and the analysis chromosomal DNA.

Term used herein " structure gene " means transcribes the dna sequence dna that becomes mRNA, and this mRNA is translated into subsequently and is the distinctive aminoacid sequence of specific polypeptide.

Term " purpose nucleotide sequence " refers to any nucleotide sequence, the operation that can be wanted this sequence for any reason quality of raising (as give) by those of ordinary skills.These nucleotide sequences include, but are not limited to the non-coding and regulating sequence (as promoter sequence, polyadenous glycosidation effect sequence, terminator sequence, enhancer sequence etc.) of the encoding sequence (as reporter gene, selectable marker gene, oncogene, drug resistance gene, somatomedin etc.) of structure gene and do not encode mRNA or protein.

Term " expression " refers to the biosynthesizing of gene product.For example, be example with structure gene, express and to relate to structure gene and transcribe to become mRNA and randomly translate mRNA subsequently and become one or more polypeptide.

Term " expression cassette " or " expression construct " mean any nucleotide sequence to be expressed be operably connected promoter sequence and the randomly other combination that is beneficial to the element (as terminator and/or polyadenous glycosidation effect sequence) that described nucleotide sequence expresses as used herein.

Term " promotor ", " promoter element " or " promoter sequence " refer to can control the dna sequence dna that the purpose nucleotide sequence is transcribed into mRNA when being connected in the purpose nucleotide sequence as used herein.Promotor normally, although it is and nonessential, be positioned at and transcribed by its control to become 5 ' (being the upstream) (as proximity structure gene transcription initiation site) of the purpose of mRNA nucleotide sequence, and provide specific binding site for RNA polymerase and other are used for initial transcription factor of transcribing.The transcription rate of repressible promoter responds inhibitor and descends.The transcription rate of inducible promoter responds inductor and rises.The transcription rate of constitutive promoter is not regulated by specificity, but can change under common metabolism condition influence.

Promotor can be tissue specificity or cell-specific.This promotor that term " tissue specificity " refers to when being used for promotor can instruct the purpose nucleotides sequence to be listed in specific type of tissue (as petal) selective expression, and the expression that same purpose nucleotides sequence is listed in the dissimilar tissues (as root) lacks relatively.The tissue specificity of promotor can be evaluated, by, for example reporter gene is operably connected to promoter sequence and produces promoter construct, with this promoter construct import Plant Genome make the reporter gene construct be integrated into generation transgenic plant institute in a organized way, and in the different tissues of transgenic plant examining report expression of gene (as detecting mRNA, protein or protein active) by the reporter gene coding.The expression that in one or more tissues, detects reporter gene relatively in other tissue more high expression level show that this promotor has and has the more specificity of the tissue of high expression level to detecting.This promotor that term " cell type specificity " refers to when being used for promotor can instruct the purpose nucleotides sequence to be listed in the specific cell type selective expression, and same purpose nucleotides sequence is listed in to express relatively in the dissimilar cells of same tissue and lacks.Term " cell type specificity " refers to also that when being applied to promotor promotor can promote the purpose nucleotides sequence to be listed in selective expression in the zone in the individual cells.Can use familiar method in this area such as GUS active coloring or immunohistochemical staining to estimate the cell type specificity of promotor.In brief, tissue slice is embedded in the paraffin then paraffin section and one-level antibody response, the nucleotide sequence coded polypeptide product of purpose that this antibody specific recognition is expressed by promotor control.To special (as the peroxidase conjugated) secondary antibody of one-level antibody through mark be allowed to be incorporated into the tissue of section and with the microscopy detection specificity in conjunction with (as using avidin/biotin).

Promotor can be composing type or adjustable.Term " composing type " means promotor when being used for promotor stimulate (as heat shock, chemical, illumination etc.) can instruct the nucleotide sequence that is operably connected to transcribe down in shortage.Usually, constitutive promoter can instruct genetically modified expression in any substantially cell and any tissue.On the contrary, " adjustable " promotor is the promotor that can instruct the nucleotide sequence transcriptional level that is operably connected in the presence of (as heat shock, chemical, illumination etc.) stimulating, and this transcriptional level is different from the transcriptional level that lacks the nucleotide sequence that is operably connected when these stimulate.

Term " exercisable connection " or " operatively connecting " are understood that to mean, the series arrangement of regulatory element (as promotor) and nucleotide sequence to be expressed and (if suitably) other regulatory elements (as terminator) for example, this arrangement mode makes each regulatory element can finish its expectation function to allow, to modify, to promote or to influence the expression of described nucleotide sequence.Described expression can be by the nucleotide sequence arrangement decision relevant with justice or sense-rna.Therefore, the direct connection on the chemical implication and nonessential.The Genetic Control sequence, enhancer sequence for example can also be to the target sequence of farther place or even to other dna molecular performance function.The preferred arrangement is wherein to be positioned at after the sequence as promotor by recombinant expressed nucleotide sequence, makes two arrangements that sequence is covalently bound each other.Preferably be less than 200 base pairs at promoter sequence with by the distance between the recombinant expressed nucleotide sequence, especially preferably be less than 100 base pairs, more preferably less than 50 base pairs.The reorganization of routine that can be by as described and clone technology produce be operably connected and expression construct (as at Maniatis T, Fritsch EF and SambrookJ (1989) Molecular Cloning:A Laboratory Manual, the 2nd version, Cold SpringHarbor Laboratory, Cold Spring Harbor (NY); Silhavy TJ, Berman ML and Enquist LW (1984) Experiments with Gene Fusions, Cold SpringHarbor Laboratory, Cold Spring Harbor (NY); People (1987) Current Protocols in Molecular Biology such as Ausubel FM, Greene Publishing Assoc.andWiley Interscience; People such as Gelvin (editor) (1990) Plant Molecular BiologyManual; Kluwer Academic Publisher, Dordrecht, The Netherlands).Yet, may also have more sequence between these two sequences, for example as the joint of restriction enzyme specificity cleavage site or as the sequence of signal peptide.The insertion of sequence can also cause Expression of Fusion Protein.Preferably, can exist with the form of vector integration by the expression construct that connects to form of promotor and nucleotide sequence to be expressed and for example insert Plant Genome by transforming.

Term used herein " conversion " refers to genetic material (as transgenosis) transfered cell.Transformation can be stable or instantaneous.Term " instantaneous conversion " or " instantaneous conversion " refer to one or more transgenosis transfered cells, and the transgenosis unconformability is to the genome of host cell.Instantaneous conversion can be passed through, and for example enzyme-linked immunosorbent assay (ELISA) detects, and it detects the existence by the polypeptide of one or more transgenes encodings.Alternatively, can pass through as this paper proved to detect and detect instantaneous conversion by transgenosis (as uid A gene) encoded protein matter activity (β-glucuronidase) and [, in the presence of the GUS enzyme, obtain blue the precipitation as Histochemistry with the painted GUS enzymic activity of X-gluc; With use GUS-Light test kit (Tropix) to carry out the chemiluminescence assay of GUS enzymic activity].Term " instantaneous conversion body " refers to the instantaneous one or more genetically modified cells that mix.

Compare, term " stable conversion " or " stable conversion " are pointed to cellular genome and are imported and integrate one or more transgenosiss, preferably produce chromosomal integration and by the reduction division genetic stability.The stable conversion of cell can by cell genomic dna with can detect in conjunction with the hybridization of the southern blotting technique of one or more genetically modified nucleotide sequences.Alternatively, can also detect the stable conversion of cell by the polymerase chain reaction (PCR) amplification transgenic sequence of cell genomic dna.Term " stable conversion body " has referred to integration stable in the genomic dna one or more genetically modified cells.Therefore, the difference of stable conversion body and instantaneous conversion body is that the genomic dna of stable conversion body contains one or more transgenosiss, and the genomic dna of instantaneous conversion body does not conform to transgenosis.Conversion comprises that also this virus vector relates to duplicating and genetic expression of table karyomit(e) (epichromosomal) with the form importing vegetable cell of genetic material with plant viral vector, and it can demonstrate variable characteristic aspect reduction division stability.Stable conversion also comprises form with virus vector with the genetic material transfered cell, and this carrier relates to table chromosome duplication and genetic expression, and it can demonstrate variable characteristic aspect reduction division stability.

Clone and transformation technology operation to ciliate and algae are well known in the art.WO98/01572; People such as Falciatore (1999) Marine Biotechnology 1 (3): 239-251; People such as Dunahay (1995) J Phycol 31:10004-1012).

The transformation technology of mainly mentioning that is suitable for vegetable cell or biology (as described below) can also be used for animal or yeast bio and cell.Preferred directly transformation technology is as calcium phosphate or liposome-mediated conversion or electroporation.

The term " infection " and " infection " that relate to bacterium refer to target biological sample (as cell, tissue etc.) and bacterium common incubation under certain condition, thereby the nucleotide sequence that bacterium is contained imports in the one or more cell of target biological sample.

Term " Agrobacterium " refers to the phytopathogenic bacterium of native biography, Gram-negative, shaft-like generation crown gall.Term " Agrobacterium " includes, but is not limited to agrobacterium tumefaciens (Agrobacterium tumefaciens) (it produces crown gall the plant that infects usually) and rhizobiaceae (Agrobacteriumrhizogenes) (it produces hair root the plant that infects usually) bacterial strain.Usually produce opine (as nopaline, agropine, octopine etc.) at infected cell with the agroinfection vegetable cell.Therefore, the agrobacterium strains (as bacterial strain LBA4301, C58, A208) of generation nopaline is called as " nopaline type " Agrobacterium; The agrobacterium strains (as bacterial strain LBA4404, Ach5, B6) that produces octopine is called as " octopine type " Agrobacterium; Be called as " agropine type " Agrobacterium with the agrobacterium strains (as bacterial strain EHA105, EHA101, A218) that produces agropine.

Term " bombardment ", " bombardment " and " biological projectile bombardment " instigate particle to produce wound and/or make particle enter the method for target biological sample on target biological sample (as cell, tissue etc.) quickens with the cytolemma that is implemented in the target biological sample.The method of biological projectile bombardment is (as US5584807, its content is introduced into as a reference herein) well known in the art, and is that obtainable (particle accelerator (PDS-1000/He) that drives as helium (BioRad) by commercial sources.

Term " homology " or " identity " refer to complementary degree when relating to nucleic acid.The identity that homology between two nucleic acid or identity are understood that to mean the nucleotide sequence that runs through each sequence total length, this identity is at auxiliary (the Wisconsin Package version 10.0 down of GAP algorithm routine, Cheng Sikang star university (University of Wisconsin), heredity calculating group (Genetics ComputerGroup, GCG), Madison, USA) through relatively calculating, used parameter setting is as follows:

Interval weight: 12 length weights: 4

Average coupling: 2912 average mispairing :-2003

Alternatively, the part complementary sequence is understood that to suppress at least in part the sequence of fully-complementary sequence and the hybridization of its target nucleic acid and relates to functions of use term " basic homologous ".Can under low stringency condition, use the inhibition of hybridization assays method (southern blotting technique or RNA trace, solution hybridization etc.) inspection to fully-complementary sequence and target sequence hybridization.Under low stringency condition, combine (promptly hybridize) of complete homologous sequence to target will compete and suppress to basic homologous sequence or probe (promptly can with the oligonucleotide of another purpose oligonucleotide hybridization).This is not to say that low stringency condition is the condition that allows non-specific combination; It is specificity (being selectivity) combination that low stringency condition needs the combination between two sequences.Can lack even there is not non-specific combination in second target of the complementary degree of part (as being less than about 30% identity) proof by use; When not having non-specific binding, probe will be not and the second incomplementarity target hybridization.

When relating to double-strandednucleic acid sequence such as cDNA or genomic clone, term " basic homologous " refers to can hybridize any probe to the arbitrary of double-strandednucleic acid sequence or two chains under low stringency condition as mentioned below.When being used for the single-chain nucleic acid sequence, term " basic homologous " refers to can hybridize any probe to the single-chain nucleic acid sequence under low stringency condition as mentioned below.

As used herein, term " hybridization " and " hybridization " comprise " nucleic acid chains is by base pairing and any process of complementary strand bonded " (Coombs (1994) Dictionary of Biotechnology, StocktonPress, New York N.Y).Hybridization and intensity for hybridization (being the bonding strength between the nucleic acid) are subjected to following factors influence, as the complementary degree between the nucleic acid, the severity about condition, the Tm of formation hybrid molecule and the G in the nucleic acid: the C ratio.

As used herein, term " Tm " refers to " melting temperature (Tm) ".Melting temperature (Tm) is that double chain acid molecule group half dissociates and becomes the temperature of strand.The equation that calculates nucleic acid Tm is well-known in the art.Shown in the canonical reference document, can simply estimate the Tm value by equation: when the aqueous solution of nucleic acid at 1M NaCl, Tm=81.5+0.41 (%G+C), [see as Anderson and Young, QuantitativeFilter Hybridization, in Nucleic Acid Hybridization (1985)].Other reference comprises more complicated calculating, and it considers structure and sequence signature in the calculating of Tm.

Low stringency condition is when relating to nucleic acid hybridization, and it condition that comprises is equal to when using length about 100 to the dna probe of about 1000 Nucleotide, 68 ℃, by 5xSSPE (43.8g/L NaCl, 6.9g/L NaH ₂PO ₄.H ₂O and 1.85g/L EDTA regulate pH to 7.4 with NaOH), 1%SDS, 5xDenhardt ' s reagent [the every 500mL of 50x Denhardt ' s contains following material: the 5g Fick (400 types, Pharmacia), 5g BSA (V component; Sigma)] and in the solution formed of 100 μ g/mL sex change salmon sperm DNAs in conjunction with or hybridization, at room temperature contain rinsing in the solution of 0.2xSSPE and 0.1%SDS subsequently.

When relating to nucleic acid hybridization, the included condition of high stringent condition is equal to when using length about 100 to arrive the dna probe of about 1000 Nucleotide, in 68 ℃, the solution formed by 5xSSPE, 1%SDS, 5xDenhardt ' s reagent and 100 μ g/mL sex change salmon sperm DNAs in conjunction with or hybridization, the rinsing in 68 ℃ of solution that containing 0.1xSSPE and 0.1%SDS that continues.

When relating to the hybridization conditions of purpose hybridization conditions, term " is equal to " and means the nucleic acid array hybridizing that hybridization conditions and purpose hybridization conditions cause having the percent homology (%) of same range as.For example, if the purpose hybridization conditions causes first nucleotide sequence and the hybridization that has with other nucleotide sequence of first nucleotide sequence from 80% to 90% homology, if another hybridization conditions also causes first nucleotide sequence and the hybridization that has with other nucleotide sequence of first nucleotide sequence from 80% to 90% homology, this another hybridization conditions is called as and is equal to the purpose hybridization conditions so.

When relating to nucleic acid hybridization, known in the field is that multiple condition of equivalent can be used to comprise low or high stringent condition; Consider as the length of probe and the character of character (DNA, RNA, based composition) and target (DNA, RNA, based composition, existence or immobilization in solution, or the like) and the factor of salt concn and other composition (as existing or lacking methane amide, dextran sulfate, polyoxyethylene glycol) and can change hybridization solution and be different from generation, but be equal to the above hybridization conditions of enumerating the low or high strictness of condition.Can reduce or get rid of the non-specific combination between purpose nucleotide sequence and other nucleotide sequence although skilled in the art will recognize that higher severity, lower severity can detect the many nucleotide sequences with homology different with the purpose nucleotide sequence.

Term " by product " hypodactylia one or more or all want by the progeny molecule of the expression cassette of subclone.

The dna molecular that refers at least a reorganization intermediate state of the present invention " integrated " altogether in term, and it contains two parents (initial) dna molecular (donor inserts fragment and acceptor inserts fragment) simultaneously.It is cyclic normally.It can be linear in some embodiments.

Term " insertion fragment " is used in the context of the present invention refer to that flank is the nucleotide sequence (preferred dna sequence dna) of recombination site.This insertion fragment can comprise one or more expression cassettes.

Term " inserts the fragment donor " and refers to one of two class parental nucleic acid molecules (as RNA or DNA) of the present invention, and it carries the insertion fragment.This insertion fragment donor molecule is included in the insertion fragment that both sides have recombination site.This insertion fragment donor can be linearity or cyclic.In one embodiment of the invention, insertion fragment donor is ring-shaped DNA molecule and comprises the cloning vector sequence that recombination signal is outer.

Term " multiple expression constructs " refers to the segmental progeny molecule of wanting of insertion (seeing Fig. 6,7) that inserts the fragment donor molecule that comprised that produces after the recombination event in the recombinant clone process.

Term " recognition sequence " finger protein matter, compound, DNA or RNA molecule (as restriction endonuclease, modification methylase or recombinase) identification and bonded particular sequence.In the present invention, recognition sequence is often referred to recombination site.For example, the recognition sequence of Cre recombinase is loxP, it is 34 base-pair sequences, and the reverse repetition (as the recombinase binding site) that is included in two 13 base pairs of 8 base pair core sequence flanks (is seen Sauer B (1994) Current Opinion in Biotechnology5:521-527; Fig. 1).The example of other recognition sequence is attB, attP, attL and the attR sequence by the identification of recombinase lambda integrase.AttB is the sequence that is about 25 base pairs that contains two 9 base pair core type Int binding sites and one 7 base pair overlap.AttP is the sequence that is about 240 base pairs (seeing Landy, Current Opinion inBiotechnology 3:699-707 (1993)) that contains core type Int binding site and arm type Int binding site and auxiliary protein integration host factor (IHF), FIS and excisionase (Xis) site.Can also transform these sites according to the present invention to improve the output of product in the inventive method.When the site of these transformations lacks when making irreversible P1 of recombining reaction or H1 structural domain (as attR or attP), these sites can be called attR ' or attP ' with the structural domain of representing these sites by to a certain degree modification.

Term " recombinase " refers to the enzyme in specific recombination site catalytic dna fragment exchange.

Term " recombinant clone " refers to methods described herein, and the fragment of nucleic acid molecule or these molecular groups are exchanged, insert, replace, substitute or modify by the site-specific recombinase effect in external or body thus.

The polypeptide of term " recombinant protein " reference and one or more recombination site recombining reactions, it comprises excision property or conformability protein, enzyme, cofactor or related protein (Landy (1993) CurrentOpinion in Biotechnology 3:699-707).

Suppress box and be the nucleic acid fragment of the repressor that contains selective marker that in subcloning vector, exists.

Term " selective marker " is instigated and is allowed to select under particular adjustments usually or get rid of certain a part or contain the dna fragmentation of the cell of this molecule.These marks a kind of activity of can encoding maybe can provide the binding site of RNA, peptide, protein, inorganic and organic compound or composition etc. as (but being not limited to) RNA, peptide or proteinic generation.The example of selective marker includes but not limited to:

(a) its coded product provides the dna fragmentation (" negative selectable marker ") at other toxic chemical (as microbiotic) resistance in recipient cell or biology.Negative selectable marker is given the resistance to biocide such as metabolic poison (as 2-deoxyglucose-6-phosphoric acid, WO 98/45456), microbiotic (as kantlex, G418, bleomycin or Totomycin) or weedicide (as phosphinothricin or glyphosate).Particularly preferred negative selectable marker is the mark of giving Herbicid resistant.The example that can mention is:

-phosphinothricin acetyl transferase (PAT; Have another name called Bialophos ^Bar; People (1987) EMBO J 6:2513-2518 such as de Block; EP0333033; US4,975,374)

-give at Glyphosate ^The 5-enol acetonyl shikimic acid-3-phosphate synthase (EPSPS) of (N-((phosphonomethyl)) glycine) resistance (people (1986) Science 233:478 such as Shah)

-Glyphosate ^Degrading enzyme (Glyphosate ^The oxidative degradation enzyme; Gox),

-Dalapon ^Inactivation dehalogenase (deh)

The acetolactate synthase of-sulfonylurea-inactivation and imidazolone-inactivation (the ALS variant that for example has the sudden change of S4 and/or Hra sudden change)

-Bromoxynil ^Degradation property nitrilase (bxn)

-kalamycin resistance gene or G418 resistant gene (NPTII; NPTI), its coding is as neomycin phosphotransferase people (1983) Proc Natl Acad Sci USA 80:4803 such as () Fraley

-give 2-deoxyglucose-6-phosphate phosphatase (DOG at 2-deoxyglucose resistance ^RThe 1-gene product; WO 98/45456; EP0807836) (people (1995) Yeast 11:1233-1240 such as Randez-Gil)

-mediation is to the hygromix phosphotransferase (HPT) of hygromycin resistance people (1985) Plant Mol Biol.5:299 such as () Vanden Elzen

-Tetrahydrofolate dehydrogenase (people (1987) Somatic Cell andMolecular Genetics 13:67-76 such as Eichholtz)

The negative selectable marker gene of giving the bacterial origin of antibiotics resistance in addition comprises aadA gene, GAT, streptomycin phosphotransferase (SPT), aminoglycoside-3-adenosyl transferase and bleomycin resistance determiner (people such as Hayford, the Plant Physiol.86:1216 (1988) that gives microbiotic spectinomycin resistance; People such as Jones (1987) Mol Gen Genet 210:86; People such as Svab (1990) Plant Mol.Biol.14:197; People such as Hille (1986) Plant Mol.Biol.7:171).

Especially preferably give negative selectable marker (WO 03/060133) at the resistance of the toxic action that causes by D-amino acid such as D-L-Ala and D-Serine.Particularly preferred in this article negative selectable marker is daol gene (EC:1.4.3.3:GenBank Acc.-No.:U60066) and bacillus coli gene dsdA (D-serine dehydratase) (D-the serine deaminase) (EC:4.3.1.18 from rhodotorula (Rhodotorula gracilis) (the red winter spore yeast of circle); GenBank Acc.-No.:J01603).

The selective marker that is suitable for the eukaryotic system of protokaryon or non-plant also can be based on the above-mentioned selective marker (except expression cassette is based on other host specificity promotor) of plant.For mammalian cell, preferred pin is to Xin Meisu (G418), Totomycin, bleomycin, zeocin (people (1987) Mo such as Gatignol) .Gen.Genet.207:342; People such as Drocourt (1990) Nucl.Acids Res.18:4009), tetracycline (is seen, for example Kaufman (1990) Meth.Enzymol.185:487; Kaufman (1990) Meth.Enzymol.l85:537) resistance.Corresponding selectable marker gene (is seen for example Srivastava and Schlessinger, Gene 103:53 (1991) being known in the art; People such as Romanos, " Expression of Cloned Genes in Yeast, " in DNA Cloning 2:Expression Systems, 2.sup.nd version, 123-167 page or leaf (IRL Press 1995); Markie, Methods Mol.Biol.54:359 (1996); People such as Pfeifer, Gene 188:183 (1997); Tucker and Burke, Gene 199:25 (1997); People such as Hashida-Okado, FEBS Letters425:117 (1998)).For prokaryotic organism, preferred pin is to the resistance of penbritin, kantlex, spectinomycin or tsiklomitsin.Can use the nucleotide sequence clone of announcement or synthesize selectable marker gene, or can commercially obtain marker gene.

(b) its coded product virose dna fragmentation (" anti-selective marker ") in recipient cell or biology.Anti-selective marker is particularly suitable for selecting biology (people (1999) the Plant J 19 (6) such as Koprek T: 719-726) that contains described mark and have the sequence of disappearance.The example of anti-selective marker comprises thymidine kinase (TK), Isocytosine deaminase (people (1999) Plant Mol Biol.40 (2): 223-35 such as Gleave AP; People (1993) Plant Mol.Biol 23 (4): 793-799 such as Perera RJ; Stougaard J; (1993) Plant J 3:755-761), cytochrome p450 protein matter (people (1999) Plant J 19 (6) such as Koprek T: 719-726), haloalkane dehalogenase (Naested H (1999) Plant J 18:571-576), iaaH gene product (people (1995) Gene Develop9:1797-1810 such as Sundaresan), Isocytosine deaminase codA (Schlaman HRM and Hooykaas PJJ (1997) Plant J 11:1377-1385) or tms2 gene product (Fedoroff NV and Smith DL (1993) Plant J 3:273-289).

(c) its coded product is given the dna fragmentation (" positive selective marker ") of recipient cell or biological growth or proliferative advantage.Gene is as from agrobacterium tumefaciens (bacterial strain: PO22; Genbank Acc.-No.:AB025109) isopentyl transferring enzyme can promote to transform the regeneration (selecting as the substratum by the acellular factor) of plant as the biosynthetic key enzyme of cytokine.Corresponding system of selection is existing to be described (people (2000) Proc Natl Acad Sci USA 94:2117-2121 such as Ebinuma; People such as Ebinuma (2000) Selection of Marker-free transgenic plants using the oncogenes (ipt, rol A, B, C) of Agrobacterium as selectable markers, In MolecularBiology of Woody Plants.Kluwer Academic Publishers).Give transform plant with respect to the other positive selective marker of unconverted plant-growth advantage as in EP-A0601092, describing.The growth-stimulating selective marker can comprise (but should be not limited to) β-glucuronidase (with as the combination of cytokine glucuronide), mannose-6-phosphate isomerase (with the seminose combination), UDP-semi-lactosi-4-epimerase (with as the semi-lactosi combination), and wherein the mannose-6-phosphate isomerase with the seminose combination is particularly preferred.

(d) its coded product can be easy to the dna fragmentation (" reporter gene or protein " of evaluation; As phenotypic markers, as beta-galactosidase enzymes, green fluorescent protein (GFP) and cell surface proteins).Encode easy quantitative protein and allow to transformation efficiency, express the site or expression time is assessed of reporter gene via its color or enzymic activity.Especially preferred herein is coding reporter gene proteinic gene (Schenborn E, Groskreutz D. (1999) Mol Biotechnol13 (1): 29-44) as green fluorescent protein (GFP) (people (1995) Plant J 8 (5): 777-784 such as Sheen; People such as Haseloff (1997) Proc Natl Acad Sci USA 94 (6): 2122-2127; People such as Reichel (1996) Proc Natl Acad Sci USA 93 (12): 5888-5893; People such as Tian (1997) PlantCell Rep 16:267-271; WO 97/41228; People (1996) Curr Biol6:325-330 such as Chui WL; People such as Leffel SM (1997) Biotechniques.23 (5): 912-8), CAT, luciferase (people (1986) Science 234:856-859 such as Ow; People such as Millar (1992) PlantMol Biol Rep 10:324-414), aequorin gene (people (1985) BiochemBiophys Res Commun 126 (3) such as Prasher: 1259-1268), beta-galactosidase enzymes, R locus gene (be coded in the plant tissue and regulate the protein that produces cyanin pigment (redness)) and therefore allow to the direct analysis promoter activity and do not need to add more auxiliary substance or chromogenic substrate (people (1988) In:Chromosome Structure and Function:Impact of New Concepts such as Dellaporta, 18th Stadler Genetics Symposium, 11:263-282; People such as Ludwig (1990) Science247:449), be more preferably β-glucuronidase (GUS) (Jefferson (1987b) Plant Mol.Bio.Rep., 5:387-405, people such as Jefferson (1987a) EMBO J., 6:3901-3907).By expressing at tissue and the blue detection β-glucuronidase (GUS) in 5-bromo-4-chloro-3-indyl-β-D-glucuronic acid incubation; Express by light emission bacterial detection luciferase (LUX); With the luciferin incubation after detect Lampyridea luciferase (LUC) by light emission and express; And with detecting the galactoside expression of enzymes by sapphirine behind 5-bromo-4-chloro-3-indyl-β-D-galactopyranoside dyeing tissue.Reporter gene can also use as the alternative valuable mark of antibiotics resistance mark.Use the existence of the genetic expression that these marker detection shift or measure its expression level.Only when cell modification efficient is high, in plant, use the cell effect that valuable mark is identified or marker gene is modified good.

(e) its coded product suppresses the dna fragmentation of cell function in recipient cell;

(g) with product (as restriction endonuclease) the bonded dna fragmentation of modifying substrate;

(h) coding can be by the dna fragmentation of the specific nucleotide recognition sequence of protein, RNA, DNA or chemical identification;

(i) cell killing that directly or indirectly in recipient cell specific compound is caused when lacking or not existing is given the dna fragmentation of resistance or susceptibility;

(j) dna fragmentation of its coded product suppressor gene its lytic activity in recipient cell;

(k) its coded product otherwise the dna fragmentation (as tRNA gene, nutrient defect type mark) that in recipient cell, lacks and;

(1) can be used to separate or identify the dna fragmentation (as the particular proteins binding site) of the molecule of wanting.

Term used herein " site-specific recombinase " refers to one type recombinase, and it has following at least four kinds of activity (or its combination) usually: (1) discerns one or both specific nucleic acid sequences; (2) described one or both sequences of cutting; (3) relate to the topoisomerase enzymic activity that chain exchanges; (4) reconnect the ligase enzyme activity of the nucleic acid chains of cutting.See Sauer, B., Current Opinions in Biotechnology5:521-527 (1994).Conservative locus specificity reorganization and homologous recombination and swivel base difference mutually are the high degree of specificity of two mating partners.Described chain exchanging mechanism relates to when not existing DNA synthetic the cutting of specific dna sequence and reconnects (Landy, A. (1989) Ann.Rev.Biochem.58:913-949).

Term " subcloning vector " refers to comprise the cloning vector of ring-type or linear nucleic acid molecule, and this nucleic acid molecule preferably includes suitable replicon.In the present invention, subcloning vector can also contain functional element and/or regulatory element, wish described element be integrated into end product with the DNA that acts on the clone insert fragment or and clone's DNA insert fragment and concur.Subcloning vector can also contain selective marker (preferred DNA).

The term carrier points to the insertion fragment and provides the biology of usefulness or the nucleic acid molecule of biochemical characteristic (preferred DNA).Example comprises plasmid, phage, autonomously replicating sequence (ARS), centriole and can duplicate or be replicated in external or host cell, or the nucleic acid fragment that can will want in host cell is delivered to other sequence in the site of wanting.Carrier can have one or more restriction endonuclease recognition sites, and sequence can be cut in confirmable mode in this site and do not lost the basic biological function of carrier, and can be in carrier the montage nucleic acid fragment so that its duplicate and clone.Carrier can also provide primer sites, as is used for PCR, transcribes and/or translation initiation and/or regulatory site, recombination signal, replicon, selective marker etc.Significantly, insert desirable nucleic acid fragment method (this method does not need to use homologous recombination, swivel base or Restriction Enzyme) (as, but be not limited to the segmental UDG clone of PCR (US5334575 is incorporated herein by reference by complete), TA Cloning herein ^TMThe PCR clone of trade mark (Invitrogen Corp., Carlsbad, Calif.) etc.) also can be used for fragment cloning is gone into the cloning vector used according to the present invention.Cloning vector can also contain the one or more selective marker that is applicable to evaluation cloning vector institute cell transformed.

Term " insert sheet receptor seq " refers to a kind of in two kinds of parental nucleic acid molecules of the present invention (as RNA or DNA), and it carries the dna fragmentation of DNA skeleton (as carrier framework), and this DNA skeleton comprises will become the part of desirable multiple expression constructs.Preferably, inserting the sheet receptor seq is the carrier molecule that constitutes the carrier donor.The carrier donor comprises subcloning vector (also do not contain cloning vector if insert the fragment donor, it can be called as cloning vector) and flank is the fragment (seeing Fig. 6,7) of recombination site.Flank has the fragment of recombination site and the fragment outside recombination site can contain just like the described element that helps to select the multiple expression constructs molecule wanted of above selection scheme.Described recombination signal can be identical or different, and can be by identical or different recombinase effect.In addition, the carrier donor can be linearity or cyclic.

Term " primer " refers to during the amplification of nucleic acid molecule (as dna molecular) or polyreaction the strand or the double chain oligonucleotide that extend via the nucleotide monomer covalent linkage.Aspect preferred, primer comprises the part of one or more recombination site or these recombination sites.The part of recombination site comprises at least 2 bases of purpose recombination site, at least 5 bases, at least 10 bases or at least 20 bases.When using recombination site a part of, the part that recombination site is lost can be provided by new synthetic nucleic acid molecule.Such recombination site can be positioned at one or two of primer terminal and/or on.Preferably, other sequence is added into the primer of contiguous recombination site to increase or to promote reorganization and/or stable recombination site in regrouping process.Such static stabilization sequence can be any sequence (the abundant sequence of preferred G/C) of any length.Preferably, such sequence size scope from 1 to about 1000 bases, 1 to about 500 bases, 1 to about 100 bases, 1 to about 60 bases, 1 to about 25 bases, 1 to about 10 bases, 2 to about 10 bases and preferred about 4 bases.Preferably, like this sequence length greater than 1 base and preferred length greater than 2 bases

Term " template " refers to will be amplified, the two strands or the single stranded nucleic acid molecule of synthetic or order-checking.Under the duplex molecule situation, preferably before these molecular clonings, synthetic or order-checking with its chain sex change forming first and second chains, or directly use duplex molecule as template.For single-stranded template, with a part of complementary primer of template under appropriate condition with template hybridization and one or more polypeptide (as archaeal dna polymerase and/or reversed transcriptive enzyme) with polymerase activity can synthesize subsequently and as described in all or part of complementary nucleic acid molecule of template.Alternatively, for double-stranded template, one or more promotor can be used in combination with one or more polysaccharase so that nucleic acid molecule complementation all or part of in described template.Can be identical with primary template length or shorter according to new synthetic molecule of the present invention.In addition, during synthetic or amplification, can use nucleic acid-templated group to produce the nucleic acid molecule group who represents the primary template group usually.

Term " adapter " refers to oligonucleotide or nucleic acid fragment or section (preferred DNA), it contains one or more recombination site (or part of these recombination sites), and described recombination site can add ring-type or linear fragment donor molecule and other other the nucleic acid molecule described herein that inserts according to the present invention.When using the part of recombination site, can provide the part of disappearance by inserting the fragment donor molecule.Such adapter can be added in any position in ring-type or the linear molecule, yet this adapter preferably is added in or near the end or the two ends of linear molecule.Preferably, adapter is placed in the both sides (flank) of specific purpose nucleic acid molecule.Synthetic (as, the annealing operation synthetic by oligonucleotide and/or the PCR) of adapter is standard technique well-known to those skilled in the art.According to the present invention, can by the standard recombinant technology (as restriction digest be connected) adapter is added the purpose nucleic acid molecule.For example, can be by earlier with suitable Restriction Enzyme digestion molecule, at cleavage site adding adapter be formed on the ring molecule that cleavage site contains adapter again adapter is added in the ring molecule.Alternatively, adapter can be directly connected in one or more terminal and preferred two ends of linear molecule, thereby is created in the linear molecule that there is adapter at an end or two ends.One aspect of the present invention can add adapter a whole or most end and the preferred linear molecule group of at two ends containing adapter of linear molecule group (as cDNA library or the genomic dna that has been cut or digested) with molecular group as described in being formed on.

To generally understand other term in recombinant DNA technology and molecule and cytobiology field used herein at the those of ordinary skill of applicable technical field.

Detailed Description Of The Invention

Correspondingly, first embodiment of the present invention relates to the method that produces the multiple expression constructs that comprises at least two different expression cassettes, and described method is included in external or the interior combination of body

I) one or more insertion fragment donor molecule, described insertion fragment donor molecule contains at least two altogether and inserts fragment (n), each inserts fragment and contains at least one expression cassette, described insertion fragment flank is two different recombination site A (2n) and A (2n+1), wherein n characterizes each to insert segmental from 1 to m integer, and m be different insert segmental sums and

Ii) insert fragment acceptor molecule IA and contain two different recombination site A1 and A (2m+2), wherein m is a step I) difference insert segmental sum

Wherein all recombination site A (1) are different to A (2m+2), and the re-assembly side A (2i-1) of specific i wherein, can with re-assembly side A (2i) reorganization of identical i, but basic another recombination site of discord recombinates, described i be from 1 to m+1 integer and

Iii) at least a locus specificity recombinant protein, its can with the reorganization of the described recombination site in described insertion fragment donor molecule and described insertion fragment acceptor molecule and

Being enough to whole described insertion fragments are transferred to the described combination of incubation under the condition of described insertion fragment acceptor molecule, produce multiple expression constructs thus.

By selecting some recombination site, each recombination site wherein only allows and another other recombination site reorganization, has realized that a plurality of expression cassette orientations are assembled into clear and definite product (multiple expression constructs).Specificity, speed and/or the productive rate that the present invention improves helps the cluster of a plurality of expression cassettes in a dna molecular (as an expression vector).

The insertion fragment donor molecule used according to the present invention contains two or more recombination sites, and its insertion fragment (expression cassette that comprises the purpose nucleic acid fragment) that allows to insert the fragment donor molecule is transferred or moves to according to one or more insertion fragment acceptor molecule (as the carrier donor molecule) of the present invention.Can prepare insertion fragment donor molecule of the present invention by any technology that is used for adding two or more recombination sites to molecules of interest.These be used to comprise recombination site with the means that prepare insertion fragment donor molecule of the present invention comprise nucleic acid molecule sudden change (as at random or site-specific mutagenesis), recombinant technology (being connected to linear molecule) as adapter or the nucleic acid molecule that contains recombination site, amplification (primer that contains recombination site or its part as use), swivel base (transposon that contains recombination site as use), reorganization (the one or more homologous sequence that contains recombination site as use), nucleic acid synthetic (as contain recombination site molecule chemosynthesis or use the enzymatic of multiple polysaccharase or reversed transcriptive enzyme synthetic) etc.According to the present invention, the nucleic acid molecule that is added into one or more recombination sites can be from any nucleic acid molecule in any source and can comprise that nucleic acid that non-natural produces is (as RNA ' s; See US5539082 and 5482836).Particularly preferred nucleic acid molecule is dna molecular (strand or a two strands).In addition, being used to produce the purpose nucleic acid molecule that inserts the fragment donor molecule can be linearity or ring-type and can to contain specific aim sequence (as gene) maybe can be molecular group (as the molecule that produces from genomic library or cDNA library).

1. recombinant protein

In the present invention, by using recombinant protein (comprising recombinase and relevant cofactor and protein) to realize the exchange of dna fragmentation.Multiple recombinant protein has been described in this area.The example of these recombinases comprises:

Cre: from protein (Abremski and the Hoess of phage P1, J.Biol.Chem.259 (3): 1509-1514 (1984)) exchange (promptly produce reorganization) of catalysis between the 34bpDNA sequence that is called as loxP (exchange locus) site (seen people such as Hoess, Nucl.Acids Res.14 (5): 2287 (1986)).Cre is by commercial sources obtainable (Novagen, Catalog No.69247-1).Reorganization by the Cre mediation is free reversible.Consider that from thermokinetics the integration (two intermolecular reorganization are to form a molecule) of surprised Cre mediation is more much lower than excision (recombinating to form two the sub-molecules) efficient of Cre mediation between with two loxP sites of a part.As known in the art, Cre works in containing magnesium or the spermidine simple buffering liquid as cofactor.The DNA substrate can be linear or supercoiled.The loxP site (people such as Hoess, above-mentioned) of many sudden changes has been described.One of them: loxP511 and the reorganization of another loxP511 site, but do not recombinate with the loxP site.

Intergrase: from the protein of lambda particles phage, its mediation λ genome conformity is gone into escherichia coli chromosome.Lambda particles phage Int recombinant protein promotes the reorganization between its substrate att site to form or the inductive part as lysogenized state.The reversibility of recombining reaction is from integrating two independently approach generations of reorganization and excision reorganization.But every kind of approach uses unique one group of 15 protein binding site of eclipsed, and it contains att site DNA.The direction that relates to the collaborative of four kinds of protein (Int, Xis, IHF and FIS) and competitive interaction decision reorganization.

Integrate reorganization and relate to Int and IHF protein and site attP (240bp) and attB (25bp).Reorganization forms two novel site: attL and attR.Excision reorganization needs Int, IHF and Xis and site attL and attR to produce attP and attB.Under certain conditions, FIS excites the excision reorganization.Except these popular responses, should understand attP and attB and when being placed in, can promote the excision reorganization to produce two kinds of excision products, a kind of attL that has, a kind of attR that has with a part.Similarly, in the presence of Int, IHF and Xis, the intermolecular reorganization that contains the molecule of attL and attR can cause to be integrated reorganization and produces attP and attB.Therefore, in the presence of suitable recombinant protein, can have the appropriate combination in the att site of through engineering approaches, can instruct the excision reorganization or the integration reorganization of reversed reaction each other by making the dna fragmentation flank.

The 15bp core sequence is contained in each att site; Independent sequential element with functional importance is present in the inside and outside and intersection (Landy, A., Ann.Rev.Biochem.58:913 (1989)) in border of this common core.The core common region that need exist between the reorganization mating partner in the effective reorganization between a plurality of att site is identical, yet, have now found that definite sequence is modifiable.As a result, find that at present core inside has derivative the same poor efficiency with original core sequence in reorganization in the att site of change.

Intergrase makes the attP site (about 240bp) of lambda particles phage and attB site (about 25bp) reorganization (Weisberg of bacillus coli gene group, R.A. and Landy, A.in Lambda II, 211 pages (1983), Cold Spring Harbor Laboratory) be the λ genome of the integration in attL (about 100bp) and attR (about 160bp) site to produce flank.(see as follows) when lacking Xis, this reaction is irreversible substantially.Work in the external simple buffering liquid that contains spermidine by the integrating remark of intergrase and IHF mediation.Can be as Nash, H.A., the described acquisition intergrase of Methods of Enzymology 100:210-216 (1983).Can be as Filutowicz, people such as M., the described acquisition of Gene 147:149-150 (1994) IHF.

The stand-by mixture that preferably has the lambda integrase of its respective secondary factor can be from InvitrogenInc. (Gateway ^TMLR Clonase ^TMEnzyme-added) obtain.Gateway ^TMLR Clonase ^TMThe Plus enzyme mixture contains lambda particles phage recombinant protein intergrase (Int) and excisionase (Xis), and intestinal bacteria encoded protein matter integration host factor (IHF) (Landy, A. (1989) Ann.Rev.Biochem.58,913).Gateway ^TMLR Clonase ^TMThe Plus enzyme mixture promotes vitro recombination between attL and the attR flank region entering on clone and the purpose carrier, and generation contains the cloning by expression of attB.

Based on instruction provided herein and guidance, can also use from different biological multiple recombination systems.See that as people such as Hoess Nucleic Acids Research 14 (6): 2287 (1986); People such as Abremski, J.Biol.Chem.261 (1): 391 (1986); Campbell, J.Bacteriol.174 (23): 7495 (1992); People such as Qian, J.Biol.Chem.267 (11): 7794 (1992); People such as Araki, J.Mol.Biol.225 (1): 25 (1992).The intergrase family (people EMBO such as Argos is (1986) J.5:433-440) that wherein much belongs to recombinase.Best research wherein may be from lambda particles phage intergrase/att system (Landy A (1993) Current Opinions in Genetics and Devel3:699-707), from (Hoess and Abremski (1990) the InNucleic Acids and Molecular Biology of Cre/LoxP system of phage P1, vol.4. edit: Eckstein and Lilley, Berlin-Heidelberg:Springer-Verlag; The 90-109 page or leaf) with from the FLP/FRT system (people (1982) Cell 29:227-234 such as Broach) of yeast saccharomyces cerevisiae 2 μ m plasmids.

Second family member's resolvase family (as γ δ, Tn3 resolvase, Hin, Gin and Cin) of site-specific recombinase is also known.The recombinase family member of this height correlation is limited to intramolecular reaction (as inversion and excision) usually and can needs the host-encoded factor.Isolated the mutant of the restriction minimizing of some needs (Maeser and Kahnmann (1991) Mol.Gen.Genet.230:170-176) and intramolecularly reorganization to host's factor.

Other is similar to λ Int can to substitute Int and Cre with similar to P1 Cre site-specific recombinase.These recombinases are known.The purifying of these other recombinases existing description under many circumstances in the present technique field.When they are unknown, can use cell extract maybe can use this enzyme is carried out partial purification about the described operation of Cre and Int.

Although as an example Cre and Int are described in detail, there are many relevant recombinase systems and its application in described invention also is provided according to the present invention.The intergrase family that can use site-specific recombinase the invention provides alternative recombinant protein and recombination site, as the locus specificity recombinant protein by lambda particles phage phi80, P22, P2,186, P4 and P1 coding.This histone matter presents beyond thought sequence polymorphism.Although there is diversity, all recombinases can be in half comparison of its C-terminal.The zone of 40 residues of contiguous C-terminal especially high conservative and regional homology contiguous in whole these protein with yeast 2 μ plasmid Flp c-terminal of protein.Have three sites conservative fully in this family: Histidine, arginine and tyrosine are found the comparison position 396,399 and 433 separately, C-terminal zone that is positioned at high conservative.These residues help the avtive spot of this recombinase family, and show trorsine 14 33 chain cutting be connected again in form instantaneous covalently bound with DNA.See that as Argos people such as P., EMBO be (1986) J.5:433-40.

The recombinase of some transposons is as recombinase (as Tn916) (Scott and the Churchward.1995.Ann Rev Microbiol 49:367 of conjugative transposon; Taylor and Churchward, 1997.J Bacteriol 179:1837) belongs to the intergrase family of recombinase and show strong preference (people 1992.J Bacteriol 174:1801 such as Ike in some cases the specific integration site; People such as Trieu-Cuot, 1993.Mol.Microbiol 8:179)

Alternatively, IS231 and other bacillus thuringiensis (Bacillus thuringiensis) transposable element can be used as recombinant protein and recombination site.Bacillus thuringiensis is the insect malignant bacteria, and its toxicity is owing to be present in the activated δNei Dusu crystal of sporangial carrier to agricultural pest and humans and animals disease.The gene of most of these toxin protein of coding is that plasmid carries and is connected in insertion sequence (IS231, IS232, IS240, ISBT1 and ISBT2) and transposon (Tn4430 and Tn5401) on the structure usually.In these displaceable elements some have shown the movability that has activity and participate in the crystal gene, thereby help the bacterium changes of toxicity.

The structural analysis of iso-IS231 element is shown that it is relevant with the IS1151 that comes automatic gas-producing capsule clostridium (Clostridumperfringens) and far away with IS4 and IS186 relation from intestinal bacteria (Escherichia coli).As other IS4 family member, they contain conservative transposase-intergrase motif of finding in other IS family and retrovirus.And the performance data of collecting from colibacillary IS231A shows the nonreplicative transposition with particular target preferences.(Bacillius subtilis) also obtains similar result with bacillus thuringiensis subtilis.See as Mahillon people such as J., Genetica 93:13-26 (1994); Campbell, J.Bacteriol.7495-7499 (1992).

The recombinase of uncorrelated family---transposase also has been used to transfer information between replicon.Transposon is structurally variable (simple or complicated), but the flank of encoding usually has the recombinase gene of the dna sequence dna of reverse tissue.The integration of transposon can be at random or high degree of specificity.Highly site-specific representative such as Tn7 have been used to dna fragmentation effectively moving between replicon people 1993.J.Virol 67:4566-4579 such as () Lucklow.

But a kind of relevant element integron also transposition ground promotes the drug resistance box from a replicon moving to another.Usually these elements are defective type transposon derivatives.Transposon Tn21 contains the I class integron that is called as In2.From the intergrase (Intl1) of In2 be general for such whole integrons and mediation between two 59bp elements or the reorganization between 59bp element and the attI site, it can cause being inserted into the acceptor integron.Described intergrase is catalysis excision reorganization (Hall, 1997.Ciba Found Symp 207:192 also; People such as Francia, 1997.J Bacteriol 179:4419).

Group II intron is coding catalytic RNA and proteinic movably genetic elements.Described protein component has ThermoScript II, maturing enzyme and endonuclease enzymic activity, and described RNA has the endonuclease enzymic activity and determine the sequence of the target site that intron is integrated into.Modification by RNA sequence part can limit the integration site that this element is integrated into.Exogenous DNA array can be incorporated between two ends of intron, makes it decide specific site by target.This process is called as contrary target-seeking (retrohoming), takes place via the DNA:RNA intermediate, and this intermediate is copied into cDNA and finally enters double-stranded DNA (people such as Matsuura, Genes and Dev 1997; People such as Guo, EMBO J, 1997).Identified the target-seeking endonuclease (Belfort and Roberts, 1997.NAR 25:3379) of multiple intron coding.This type systematic can be easy to adopt is used for described subclone method.

Can determine in order to drive the amount of the recombinase that recombining reaction adds by using known assay method.Particularly, use titrimetry to determine the sufficient quantity of the recombinase of purifying, or the sufficient quantity of extract.

2.1 recombination site-general introduction

Above recombinant protein and corresponding recombination site are applicable to according to recombinant clone of the present invention.Yet the wild-type recombination site may contain and reduces recombining reaction efficient or specific sequence, and reaction efficiency or specificity are needed with the clear and definite assembling multiple expression constructs molecule of method of the present invention.In addition, a plurality of terminator codons in attB, attR, attP, attL and loxP recombination site appear in a plurality of reading frames of two chains, thereby translation efficiency is lowered (as must pass the place of recombination site at encoding sequence), and (on every chain in loxP and attB site only one read frame can with) maybe can not translate (at attP, attR or attL).

Therefore, the present invention also provides the recombination site of transforming to overcome these problems.For example, the att site can be had by transformation one or more sudden changes with the specificity that improves recombining reaction or efficient (as, att1, att2 and att3 site); The minimizing reversed reaction (as, remove P1 and H1 from attR).The test of these mutant determines which mutant provides enough reorganization activity, and it is suitable for according to reorganization subclone of the present invention.

Therefore can introduce the sudden change that strengthens the locus specificity reorganization to recombination site.The sudden change of this class includes, but are not limited to by same protein identification but the different recombination site of base sequence, thus its to a great extent or only with their homologous mating partner reaction.The parallel use of the recombination site of this class sudden change makes can consider a plurality of (parallel) reaction.Can determine which specific reaction takes place by the specific mating partner that is present in the reaction mixture.For example, can be by containing recombination site attR1 and attR3 respectively; AttL1 and attR2; The parental DNA construct of attL2 and attL3 realizes that three protein merge.

Some methods that nucleotide sequence is introduced in specific sudden change are well-known.Some of them are described in people such as Ausubel FM, Current Protocols in Molecular Biology, WileyInterscience, New York (1989-1996).Can design sudden change in oligonucleotide is used for modifying existing clone's sequence or designs sudden change at amplified reaction.If can provide suitable system of selection to separate mutant DNA or the RNA that wants, can also use random mutagenesis.Can confirm the existence of desirable sudden change by well-known method by nucleic acid sequencing.

The nucleus that can use the following non-limiting method modification or the given recombination site that suddenlys change is to provide the mutational site that can use in the present invention:

1. the recombination mechanism by locus specificity (as attL and attR so that attB to be provided) or other (as homologous) produces the core sequence of final sudden change by (wherein parent's dna fragmentation contains one or more sequence changes) of two parent's dna sequence dnas reorganization;

By directly suddenly change or mutagenesis (locus specificity, PCR, at random, spontaneous etc.) desirable core sequence;

By mutagenesis (locus specificity, PCR, at random, spontaneous etc.) parent's dna sequence dna, its reorganization produces desirable core sequence;

4. pass through the reverse transcription of the RNA of the desirable core sequence of coding; With

5. the de novo synthesis (chemosynthesis) of the sequence by having desirable sequence change.

Can prove the functional of sudden change recombination site with several different methods, described method is decided by desirable concrete feature.For example, can in recombination site, lack translation stop codon by expressing suitable fused protein proof.Can be by in vitro reactions, introducing suitable molecule and measuring as the reorganization specificity between this paper description or the recombinant products known in the art proof homology mating partner.Other desirable sudden change can comprise other the known function that exists or lack restriction site, translation or transcription initiation signal, protein binding site and nucleic acid base sequence in recombination site.Can use the hereditary selection scheme of specific functional attributes in the recombination site according to known method steps.The dna sequence dna that for example can lack the coding toxicant via the reorganization between the site realizes that the site modification is to provide noninteracting mating partner (from a pair of noninteracting site).Similarly, those skilled in the art can easily design the selection in the site of removing the translation termination sequence, the existence of protein binding site or disappearance etc.

2.2 the selection of recombination site-assembling multiple expression constructs

For method of the present invention provides one or more insertion fragment donor molecules, they comprise at least two together and insert fragment I (n).Each inserts fragment and comprises at least one expression cassette.Each inserts fragment flank is two different recombination site A (2n) and A (2n+1), and wherein n characterizes each to insert segmentally from 1 to m integer, and m is the segmental sums of different insertions.For example inserting fragment I1 flank is recombination site A2 and A3, and inserting fragment 12 flanks is recombination site A4 and A5 or the like.

Also provide at least one to insert fragment acceptor molecule IA, it comprises two different recombination site A1 and A (2m+2), and wherein m is the different segmental sums that insert.For example, if use two different insertion fragments (I1 and I2), insert the sheet receptor seq and comprise different recombination site A1 and A6.

Now, whole recombination site A (1) are different to A (2m+2).For concrete i, recombination site A (2i-1) can recombinate with the re-assembly side A (2i) of identical i, but the other recombination site reorganization of basic discord, and described i is the integer from 1 to m+1.(I1 has recombination site A2 and A3 to insert fragment at above-mentioned two, and I2 has recombination site A4 and A5) and example that inserts sheet receptor seq (having recombination site A1 and A6) in, A1 only can recombinate with A2, and A3 only can recombinate with A4, and A5 only can recombinate with A6.

Recombination site A (2i-1) only recombinates with recombination site A (2i), this means at least 2 times of the recombination frequency of any other recombination site on recombination frequency between A (2i-1) and A (2i) or velocity ratio A (2i-1) and A (2i) next door or A (2i) and any other recombination site on A (2i-1) next door or speed height but the other recombination site of getting along well is substantially recombinated, preferred 5 times, more preferably 10 times, most preferably 100 times.This recombination frequency or speed can, for example, the specificity by the recombining reaction kind and the number of unexpected by product (promptly by) is assessed.

Insert the fragment donor and insert the sheet receptor seq and the combination of at least a locus specificity recombinant protein of the recombination site in described insertion fragment donor molecule and described insertion fragment acceptor molecule can being recombinated by incubation, all insertion fragment transfers are entered described insertion fragment acceptor molecule, thereby produce multiple expression constructs.Only when all the insertion fragment is transferred, can obtains a ring-type, reproducible insertion sheet receptor seq (as expression vector) and the dna fragmentation of the past between A1 and A (2m+2) and correctly be replaced.

Provide following example with help to the selection of recombination site and combination with and the understanding of the ability of recombinating each other.

Insert sheet receptor seq (IA) number

Insert fragment (I) number

Recombination site among the IA

Insert the recombination site in the fragment

The reorganization ability

1	2(I1、I2)	A1、A6	I1：A2、A3 I2：A4、A5	A1/A2 A3/A4 A5/A6
1	2(I1、I2)	A1、A6	I1：A2、A3 I2：A4、A5	A1/A2 A3/A4 A5/A6	1	3(I1、I2、 I3)	A1、A8	I1：A2、A3 I2：A4、A5 I3：A6、A7	A1/A2 A3/A4 A5/A6 A7/A8
1	4(I1、I2、 I3、I4)	A1、A10	I1：A2、A3 I2：A4、A5 I3：A6、A7 I4：A8、A9	A1/A2 A3/A4 A5/A6 A7/A8 A9/A10	1	3(I1、I2、 I3)	A1、A8	I1：A2、A3 I2：A4、A5 I3：A6、A7	A1/A2 A3/A4 A5/A6 A7/A8

Table 1: one insert sheet receptor seq (carrier donor) molecule respectively with 2,3 or 4 examples that insert fragment combination.Preferably, each insertion fragment is comprised in the insertion fragment donor molecule separately.The reorganization ability shows that two specified recombination sites (as A1 and A2=A1/A2) can recombinate, but in these sites none can with other recombination site reorganization.

Can be by easily obtaining recombination site A1 to A (2m+2) as the described method of US5888732 (complete herein being incorporated herein by reference).This class recombination site comprises the nucleus of the sudden change with at least one transformation.Except changing the reorganization specificity, the sudden change of recombination site can also be given the enhancement of reorganization, and described enhancement is selected from substantially by the following group of forming: (i) help integrating; (ii) help reorganization; (ii) reduce needs to host's factor; (iii) increase the efficient that is total to dna integration or multiple expression constructs DNA formation; (iv) increase the specificity that described dna integration altogether or multiple expression constructs DNA form.The nucleic acid molecule of forming recombination site preferably contains at least one recombination site from attB, attP, attL or attR, as attR ' or attP '.More preferably, the att site is selected from att1 as described herein, att2 or att3.

In preferred embodiments, the nucleus of recombination site comprises and is selected from following dna sequence dna:

(a)RKYCWGCTTTYKTRTACNAASTSGB(m-att) (SEQ ID NO：1)；

(b)AGCCWGCTTTYKTRTACNAACTSGB(m-attB)(SEQ ID NO：2)；

(c)GTTCAGCTTTCKTRTACNAACTSGB(m-attR) (SEQ ID NO：3)；

(d)AGCCWGCTTTCKTRTACNAAGTSGB(m-attL) (SEQ ID NO：4)；

(e)GTTCAGCTTTYKTRTACNAAGTSGB(m-attP1)(SEQ ID NO：5)；

(f)RBYCWGCTTTYTTRTACWAASTKGD(n-att) (SEQ ID NO：39)；

(g)ASCCWGCTTTYTTRTACWAASTKGW(n-attB) (SEQ ID NO：40)；

(h)ASCCWGCTTTYTTRTACWAAGTTGG(n-attL) (SEQ ID NO：41)；

(i)GTTCAGCTTTYTTRTACWAASTKGW(n-attR) (SEQ ID NO：42)；

(j)GTTCAGCTTTYTTRTACWAAGTTGG(n-attP) (SEQ ID NO：43)；

Or corresponding or complementary DNA or RNA sequence, wherein R=A or G; K=G or T/U; Y=C or T/U; W=A or T/U; N=A or C or G or T/U; S=C or G; And B=C or G or T/U, as given at 37 C.F.R.. § 1.822 (" Symbols and format to be used fornucleotide and/or amino acid sequence data "), with its complete being incorporated herein by reference, wherein said nucleus does not contain the terminator codon in one or more reading frames herein.

This nucleus also preferably comprises and is selected from following dna sequence dna:

(a)AGCCTGCTTTTTTGTACAAACTTGT(attB1) (SEQ ID NO：6)；

(b)AGCCTGCTTTCTTGTACAAACTTGT(attB2) (SEQ ID NO：7)；

(c)ACCCAGCTTTCTTGTACAAAGTGGT(attB3) (SEQ ID NO：8)；

(d)GTTCAGCTTTTTTGTACAAACTTGT(attR1) (SEQ ID NO：9)；

(e)GTTCAGCTTTCTTGTACAAACTTGT(attR2) (SEQ ID NO：10)；

(f)GTTCAGCTTTCTTGTACAAAGTGGT(attR3) (SEQ ID NO：11)；

(g)AGCCTGCTTTTTTGTACAAAGTTGG(attL1) (SEQ ID NO：12)；

(h)AGCCTGCTTTCTTGTACAAAGTTGG(attL2) (SEQ ID NO：13)；

(i)ACCCAGCTTTCTTGTACAAAGTTGG(attL3) (SEQ ID NO：14)；

(j)GTTCAGCTTTTTTGTACAAAGTTGG(attP1) (SEQ ID NO：15)；

(k)GTTCAGCTTTCTTGTACAAAGTTGG(attP2，P3)(SEQ ID NO：16)；

(l)AGCCTGCTTTTTTGTACAAACTTGC(attB1 ^*) (SEQ ID NO：52)；

(m)ACCCAGCTTTCTTGTACAAAGTGGC(attB2 ^*) (SEQ ID NO：53)；

(N)CAACTTTATTATACATAGTTG (attB3 ^*) (SEQ ID NO：54)

(O)CAACTTTTCTATACAAAGTTG (attB4 ^*) (SEQ ID NO：55)

(p)GTTCAACTTTTTTGTACAAACTTGC(attR1 ^*) (SEQ ID NO：56)

(q)TTCAACTTTCTTGTACAAAGTGGG (attR2 ^*) (SEQ ID NO：57)

(r)GTTCAACTTTATTATACATAGTTGA(attR3 ^*) (SEQ ID NO：58)

(s)GTTCAACTTTTCTATACAAAGTTGA(attR4 ^*) (SEQ ID NO：59)

(t)AGCCTGCTTTTTTGTACAAAGTTGG(attL1 ^*) (SEQ ID NO：60)

(u)ACCCAGCTTTCTTGTACAAAGTTGG(attL2 ^*) (SEQ ID NO：61)

(v)GGCAACTTTATTATACAAAGTTGG (attL3 ^*) (SEQ ID NO：62)

(w)ACCCAACTTTTCTATACAAAGTTGG(attL4 ^*) (SEQ ID NO：63)

(x)GTTCAACTTTTTTGTACAAAGTTGG(attP1 ^*) (SEQ ID NO：64)

(y)GTTCAGCTTTCTTGTACAAAGTTGG(attP2 ^*) (SEQ ID NO：65)

(z)GTTCAACTTTATTATACAAAGTTGG(attP3 ^*) (SEQ ID NO：66)

(aa)GTTCAACTTTTCTATACAAAGTTGG(attP4 ^*) (SEQ ID NO：67)

Or corresponding or complementary DNA or RNA sequence.

Significantly, the broad variety in above particular core zone and to arrange the sequence number be considered to be suitable for carrying out method of the present invention and constitute suitable recombination site of the present invention almost be unlimited is described every sequence at this paper for simplicity and not.Yet this class variation is considered with arrangement and thinks different embodiment of the present invention.Preferably, recombination site comprises with at least one of above sequence and has at least one dna sequence dna of 80-90% homology (or wherein any scope or numerical value) at least, or any suitable recombination site, or the sequence of under stringent condition as known in the art, hybridizing.

3. insert the fragment donor molecule and insert fragment

Described insertion fragment donor molecule can comprise one or more insertion fragments.In preferred embodiments, insert the fragment donor molecule and comprise an insertion fragment.Inserting the fragment donor molecule can be made up of linearity or ring-shaped DNA molecule.The dna fragmentation that described insertion fragment donor molecule can comprise carrier (preferred cyclic plasmid carrier) or be produced by amplification.Any clone or expression vector can be used as carrier.Multiple example is well known in the art and is exemplified below (seeing " carrier donor ").Insertion fragment donor molecule based on cloning vector has and can avoid unexpected sudden change to hang down the advantage that error rate is duplicated.Insert in ring-type under the situation of fragment donor molecule, described molecule can be supercoiled or lax, and is preferably supercoiled.

Yet in another embodiment of the present invention, described insertion fragment donor molecule can be the linear DNA sequence.The amplification method that can for example mediate by polymerase chain reaction (PCR) adds at expression cassette and comprises the adapter of recombination site separately to obtain this class sequence.Can add described adapter by using by recombination site and characterizing the Oligonucleolide primers that 5 ' of target expression cassette-or 3 '-terminal sequence is formed.

In the preferred embodiment of the invention, insert the dna fragmentation that fragment donor dna molecule can also comprise at least one mark of encoding, described mark is selected from cloning site, restriction site, promotor, operon, replication orgin, function DNA, sense-rna, PCR fragment, protein and protein fragments.Preferably, at least one mark can be included within least one insertion fragment.More preferably, described mark is selective marker (preferred negative selective marker) or reporter gene or protein.Preferred selective marker is to select the selective marker (by mixing the insertion fragment that contains described selective marker) of the multiple expression constructs that produced.Described selective marker can preferably include at least a mark, its be selected from antibiotics resistance gene, herbicide resistance gene, tRNA gene, nutrient defect type mark, virulent gene, phenotypic markers, antisense oligonucleotide, restriction endonuclease, restriction endonuclease cleavage site, enzyme cleavage site, protein binding site and with PCR primer sequence complementary sequence.Suitable selective marker can comprise at least a dna fragmentation that is selected from by the following group of forming:

(a) dna fragmentation, product (" negative selectable marker ") that provides in recipient cell or the biology at the resistance of other toxin compound is provided for it;

(b) dna fragmentation, it is coded in virose product in recipient cell or the biology (" anti-selective marker ");

(c) dna fragmentation, its coding is given the product of recipient cell or biological growth or proliferative advantage;

(d) dna fragmentation, its coding can certified product;

(e) dna fragmentation, it is coded in the product that suppresses cell function in the recipient cell;

(f) dna fragmentation, it suppresses the activity of arbitrary dna fragmentation of above (a)-(e);

(g) dna fragmentation, it is in conjunction with the product of modifying substrate;

(h) dna fragmentation, its coding can be by the specific nucleotide recognition sequence of protein, RNA, DNA or chemical identification;

(i) dna fragmentation, when disappearance, it directly or indirectly gives the susceptibility of the cell killing that specific compound is caused in recipient cell;

(j) dna fragmentation, its coding suppresses the active product of gene product in the recipient cell;

(k) dna fragmentation, its be coded in the product that lacks in the recipient cell and

(l) dna fragmentation, it can be used for separating or identifying desirable molecule.

Concrete example is above providing.

Method of the present invention also comprises the steps: to select to comprise the segmental multiple expression constructs of all described insertions of described insertion fragment donor molecule.

Describe and claim according to technology well known in the art, hereinafter accompanying drawing and invention, other embodiment preferred of the present invention is conspicuous for those of ordinary skills.

4. insert the fragment acceptor molecule

In preferred embodiments, insert the fragment acceptor molecule and comprise that flank is the dna fragmentation of described two different recombination site A1 and A (2m+2), described recombination site will be replaced in regrouping process.

Inserting the fragment acceptor molecule can be made up of linearity or ring-shaped DNA molecule.Insert the fragment acceptor molecule and can comprise carrier.In this case, insert the fragment acceptor molecule and become carrier donor molecule (preferred cyclic plasmid carrier).Any clone or expression vector can be used as carrier.A plurality of examples of this area are known and illustrate below.Insertion fragment acceptor molecule based on cloning vector has and can avoid unexpected sudden change to hang down the advantage that error rate is duplicated.Preferred carrier donor molecule is the carrier that can be used to transform with multiple expression constructs the target biology of selecting.For example, can use the basis (details see below) of Agrobacterium binary vector as the carrier donor molecule of transformed plant cells or biology.Insert in ring-type under the situation of fragment acceptor molecule (carrier donor molecule), described molecule can be superhelix or relaxed type, preferred relaxed type.

Yet in another embodiment of the present invention, inserting the fragment acceptor molecule can be the linear DNA sequence.Can add the linking that comprises recombination site separately to expression cassette by the amplification method of for example polymerase chain reaction (PCR) mediation and be obtained this class sequence.Can add this adapter by using by recombinase site and characterizing the Oligonucleolide primers that 5 ' of target expression cassette-or 3 '-terminal sequence is formed.

In another embodiment preferred of the present invention, inserting the fragment acceptor molecule is the genomic dna molecule, the dna molecular of for example chromosomal or plasmid.Therefore, multiple expression constructs directly can be assembled into the genome (as by inserting the cotransformation of fragment donor molecule) of host living beings.Can be created in genomic dna is provided by suitable recombination site (provide thus and insert the fragment acceptor molecule) cell or biology, for example, the DNA construct insertion genomic dna of described recombination site be will contain in the step in front by the standard conversion technology, chief cell or the biology that wherein can assemble multiple multiple expression constructs will be provided at thus.

Preferably, insert sheet receptor seq or carrier donor molecule and comprise at least one selective marker.More preferably, this insertion sheet receptor seq or carrier donor molecule also comprise (a) virulent gene and (b) selective marker, and wherein said virulent gene and described selective marker are on different dna fragmentations, and described dna fragmentation is separated from each other by at least two recombination sites.Preferably, in the result of recombination method, from insert sheet receptor seq or carrier donor molecule, lack virulent gene.

Described selective marker can preferably include at least a be selected from antibiotics resistance gene, herbicide resistance gene, tRNA gene, nutrient defect type mark, virulent gene, phenotypic markers, antisense oligonucleotide, restriction endonuclease, restriction enzyme cleavage site, enzyme cleavage site, protein binding site and with the mark of PCR primer sequence complementary sequence.

Can use carrier advantageously to introduce cell, preferred introduced plant cell according to multiple expression constructs of the present invention.In advantageous embodiment, multiple expression constructs is carrier or is included in the carrier or inserts in the carrier, is preferably selected from the carrier of protokaryon and/or eucaryon.Therefore, in the preferred embodiment of the invention, inserting the sheet receptor seq is the carrier donor, and relevant carrier sequence is provided.In one embodiment, method of the present invention relates to the transgene expression vector inverting biological or the cell (as plant or vegetable cell) (as mentioned above) that contain multiple expression constructs of the present invention.As used herein, term " carrier " and " vehicle " use convertibly, refer to the nucleic acid molecule of dna fragmentation from a cell transfer to another cell.Term as used herein " expression vector " refers to contain desirable encoding sequence and express the required suitable nucleotide sequence of encoding sequence that effectively is connected in the specific host biology.

Method of the present invention is not limited to expression vector disclosed herein.Any can being positioned within the scope of the present invention to the expression vector expection that vegetable cell is introduced the purpose nucleotide sequence.Usually, expression vector comprises transgene expression cassette of the present invention and allows carrier cloning to go into bacterium or phage host's combination of elements.Carrier preferred (but not must) contains the replication orgin that function is arranged in extensive prokaryotic hosts.Usually, but not necessary, comprise the cell that selective marker makes can select tape desirable carrier.

The example of carrier can be plasmid, glutinous grain, phage, virus or Agrobacterium.Example more specifically about various transformation technologies provides below.

Preferred making can enter the expression construct stable integration carrier of host genome.When DNA injection or electroporation entered cell (as vegetable cell), used plasmid need not to satisfy any specific needs.Can use simple plasmid as pUC series.If, need to exist in the plasmid other selectable marker gene from the complete plant of cell transformed regeneration.Multiple possible plasmid vector can be used for introducing foreign gene to plant, and these plasmid vectors contain the replication orgin that duplicates usually in intestinal bacteria and the marker gene of the bacterium that is used to select transform.Example is pBR322, pUC series, M13mp series, pACYC184 etc.

According to the present invention, the carrier donor molecule can be included in the carrier that function is arranged in multiple systems or the host cell.Be preferred for carrier of the present invention and comprise prokaryotic vector, eukaryotic vector or the carrier (as shuttle vectors) that can between multiple protokaryon and/or eukaryotic system, shuttle back and forth.Preferred eukaryotic vector is included in the carrier that duplicates in yeast cell, vegetable cell, fry cell, eukaryotic cell, mammalian cell or the insect cell.Preferred prokaryotic vector is included in the carrier that duplicates in Gram-negative and/or the gram positive bacterium, more preferably the carrier that duplicates in the bacterium of Escherichia (Escherichia), salmonella (Salmonella), bacillus (Bacillus), streptomyces (Streptomyces), Agrobacterium (Agrobacterium), rhizobium (Rhizobium) or Rhodopseudomonas (Pseudemonas).The carrier that in intestinal bacteria and Agrobacterium, can both duplicate most preferably.Be used for eukaryotic vector of the present invention and be included in the carrier that cells such as yeast cell, vegetable cell, mammalian cell (particularly people's cell), fungal cell, insect cell, fry cell are bred and/or duplicated.Concrete purpose carrier includes but not limited to cloning vector, sequencing vector, expression vector, fusion vector, double cross carrier, gene therapy vector and reverse double cross carrier.Depend on that by concrete carrier, these carriers can be used for protokaryon and/or eukaryotic system.

According to the present invention, can use any vector construction carrier donor of the present invention.Particularly, can transform according to the present invention well known in the art and those make it comprise that one or more recombination sites is to be used for method of the present invention by the obtainable carrier of commercial sources (with its variant or derivative).Can from, for example Invitrogen, Vector Laboratories Inc., InVitrogen, Promega, Novagen, NEB, Clontech, Boehringer Mannheim, Pharmacia, EpiCenter, OriGenes Technologies Inc., Stratagene, PerkinElmer, Pharmingen, LifeTechnologies, Inc. and Research Genetics obtain this class carrier.Such carrier can for example be used to clone or subclone purpose nucleic acid molecule subsequently.The general category of specific purpose carrier comprises protokaryon and/or eukaryotic cloning carrier, expression vector, fusion vector, double cross or reverse double cross carrier, inserts segmental carrier etc. greatly in shuttle vectors, mutagenesis carrier, transcription vector, the acceptance of different hosts' uses.

Other purpose carrier comprises the carrier (M13 carrier, bacterial lambda phage vector, adenovirus carrier and retroviral vector) of viral origin, high and low and the adjustable carrier of copy number has combination and is used for single host's the carrier (pACYC184 and pBR322) of consistency replicon and the episomal replication carrier (pCDM8) of eucaryon.

Specific purpose carrier comprises prokaryotic expression carrier such as pcDNA II, pSL301, pSE280, pSE380, pSE420, pTrcHisA, B and C, pRSET A, B and C (Invitrogen, Inc.), pGEMEX-1 and pGEMEX-2 (Promega, Inc.), pET carrier (Novagen, Inc.), pTrc99A, pKK223-3, pGEX carrier, pEZZ18, pRIT2T and pMC1871 (Pharmacia, Inc.), pKK233-2 and pKK388-1 (Clontech, Inc.), and pProEx-HT (Life Technologies, Inc.) and its variant and derivative.The carrier donor can also prepare from carrier for expression of eukaryon, described carrier for expression of eukaryon is such as pFastBac, pFastBacHT, pFastBacDUAL, pSFV and pTet-Splice (Life Technologies, Inc), pEUK-C1, pPUR, pMAM, pMAMneo, pBI101, pBI121, pDR2, pCMVEBNA and pYACneo (Clontech), pSVK3, pSVL, pMSG, pCH110 and pKK232-8 (Pharmacia, Inc), p3 ' SS, pXT1, pSG5, pPbac, pMbac, pMC1neo and pOG44 (Stratagene, Inc.) and pYES2, pAC360, pBlueBacHis A, B and C, pVL1392, pBsueBacIII, pCDM8, pcDNA1, pZeoSV, pcDNA3, pREP4, pCEP4, and pEBVHis (Invitrogen, Inc.) and its variant or derivative.

Other specific purpose carrier comprises pUC18, pUC19, pBlueScript, pSPORT, glutinous grain, phagemid, YAC ' s (yeast artificial chromosome), BAC ' s (bacterial artificial chromosome), P1 (coliphage), pQE70, pQE60, pQE9 (quagan), the pBS carrier, the PbageScript carrier, the BlueScript carrier, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene), pcDNA3 (InVitrogen), pGEX, pTrsfus, pTrc99A, pET-5, pET-9, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia), pSPORT1, pSPORT2, (Life Technologies is Inc.) with its variant or derivative for pCMVSPORT2.0 and pSV-SPORT1.

Other purpose carrier comprises the pTrxFus from Invitrogen, pThioHis, pLEX, pTrcHis, pTrcHis2, pRSET, pBlueBacHis2, pcDNA3.1/His, pcDNA3.1 (-)/Myc-His, pSecTag, pEBVHis, pPIC9K, pPIC3.5K, pAO815, pPICZ, pPICZ α, pGAPZ, pGAPZ α, pBlueBac4.5, pBlueBacHis2, pMelBac, pSinRep5, pSinHis, pIND, pIND (SP1), pVgRXR, pcDNA2.1.pYES2, pZErO1.1, pZErO-2.1, pCR-Blunt, pSE280, pSE380, pSE420, pVL1392, pVL1393, pCDM8, pcDNA1.1, pcDNA1.1/Amp, pcDNA3.1, pcDNA3.1/Zeo, pSe, SV2, pRc/CMV2, pRc/RSV, pREP4, pREP7, pREP8, pREP9, pREP10, pCEP4, pEBVHis, pCR3.1, pCR2.1, pCR3.1-Uni, and pCRBac; λ ExCell, λ gt11, pTrc99A, pKK223-3, pGEX-1 λ T, pGEX-2T, pGEX-2TK, pGEX-4T-1, pGEX-4T-2, pGEX-4T-3, pGEX-3X, pGEX-5X-1, pGEX-5X-2, pGEX-5X-3, pEZZ18, pRIT2T, pMC1871, pSVK3, pSVL, pMSG, pCH110, pKK232-8, pSL1180, pNEO and pUC4K from Pharmacia; PSCREEN-1b (+) from Novagen, pT7Blue (R), pT7Blue-2, pCITE-4abc (+), pOCUS-2, pTAg, pET-32LIC, pET-30LIC, pBAC-2cp LIC, pBACgus-2cp LIC, pT7Blue-2 LIC, pT7Blue-2, λ SCREEN-1, λ BlueSTAR, pET-3abcd, pET-7abc, pET9abcd, pET11abcd, pET12abc, pET-14b, pET-15b, pET-16b, pET-17b-pET-17xb, pET-19b, pET-20b (+), pET-21abcd (+), pET-22b (+), pET-23abcd (+), pET-24abcd (+), pET-25b (+), pET-26b (+), pET-27b (+), pET-28abc (+), pET-29abc (+), pET-30abc (+), pET-31b (+), pET-32abc (+), pET-33b (+), pBAC-1, pBACgus-1, pBAC4x-1, pBACgus4x-1, pBAC-3cp, pBACgus-2cp, pBACsurf-1, plg, Signal plg, pYX, Selecta Vecta-Neo, Selecta Vecta-Hyg, with Selecta Vecta-Gpt; PLexA from Clontech, pB42AD, pGBT9, pAS2-1, pGAD424, pACT2, pGAD GL, pGAD GH, pGAD10, pGilda, pEZM3, pEGFP, pEGFP-1, pEGFP-N, pEGFP-C, pEBFP, pGFPuv, pGFP, p6xHis-GFP, pSEAP2-Basic, pSEAP2-Control, pSEAP2-Promoter, pSEAP2-Enhancer, p β gal-Basic, p β gal-Control, p β gal-Promoter, p β gal-Enhancer, pCMV, pTet-Off, pTet-On, pTK-Hyg, pRetro-Off, pRetro-On, pIRES1neo, pIRES1hyg, pLXSN, pLNCX, pLAPSN, pMAMneo, pMAMneo-CAT, pMAMneo-LUC, pPUR, pSV2neo, pYEX4T-1/2/3, pYEX-S1, pBacPAK-His, pBacPAK8/9, pAcUW31, BacPAK6, pTripEx, λ gt10, λ gt11, pWE15, and TripEx; λ APII from Stratagene, pBK-CMV, pBK-RSV, pBluescriptII KS+/-, pBluescriptII SK+/-, pAD-GAL4, pBD-GAL4 Cam, pSurfscript, λ FIXII, λ DASH, λ EMBL3, λ EMBL4, SuperCos, pCR-Scrigt Amp, pCR-Script Cam, pCR-Script Direct, pBS+/-, pBC KS+/-, pBC SK+/-, Phages cript, pCAL-n-EK, pCAL-n, pCAL-c, pCAL-kc, pET-3abcd, pET-11 ' abcd, pSPUTK, pESP-1, pCMVLacI, pOPRSVI/MCS, pOPI3 CAT, pXT1, pSG5, pPbac, pMbac, pMC1neo, pMC1neo Poly A, pOG44, pOG45, pFRT β GAL, pNEO β GAL, pRS403, pRS404, pRS405, pRS406, pRS413, pRS414, pRS415, and pRS416.

The double cross of specific purpose and reverse double cross carrier comprise pPC86, pDBLeu, pDBTrp, pPC97, p2.5, pGAD1-3, pGAD10, pACt, pACT2, pGADGL, pGADGH, pAS2-1, pGAD424, pGBT8, pGBT9, pGAD-GAL4, pLexA, pBD-GAL4, pHISi, pHISi-1, placZi, pB42AD, pDG202, pJK202, pJG4-5, pNLexA, pYESTrp and its variant or derivative.

The preferred carrier of expression in escherichia coli be pQE70, pQE60 and pQE-9 (QIAGEN, Inc.); PBluescript carrier, phagescript carrier, pNH8A, pNH16a, pNH18A, pNH46A (Stratagene Cloning Systems, Inc.); Ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia Biotech, Inc.).

Preferably the carrier of expressing at eucaryon, animal system comprises pWLNE0, pSV2CAT, pOG44, pXT1 and pSG (Stratagene Inc.); PSVK3, pBPV, pMSG and pSVL (Pharmacia Biotech, Inc.).The example of derivable carrier is pTet-tTak, pTet-Splice, pcDNA4/TO, pcDNA4/TO/LacZ, pcDNA6/TR, pcDNA4/TO/Myc-His/LacZ, pcDNA4/TO/Myc-His A, pcDNA4/TO/Myc-His B, pcDNA4/TO/Myc-His C, pVgRXR (Invitrogen, Inc.) or pMAM-Serie (Clontech, Inc.; GenBank searching number: U02443).

Preferred carrier of in yeast, expressing for example comprise pYES2, pYD1, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, PHIL-D2, PHIL-Sl, pPIC3SK, pPIC9K and PA0815 (Invitrogen, Inc.).

The carrier that is used for agriculture bacillus mediated conversion is described and preferably included to the carrier that preferably is used for Plant Transformation hereinafter.Agrobacterium tumefaciens and Agrobacterium rhizogenes are the morbific soil bacterias of plant, its genetic transformation plant cell.Ti of agrobacterium tumefaciens and Agrobacterium rhizogenes and Ri plasmid have the gene (Kado (1991) Crit Rev Plant Sci 10:1) of the genetic transformation of being responsible for plant respectively.Carrier of the present invention can be based on Agrobacterium Ti or Ri plasmid and can utilize natural DNA transfer system to enter Plant Genome thus.

As the part of the supercrescence of high development, Agrobacterium shifts the determining section (T-DNA of its genomic information; Flank is about 25bp tumor-necrosis factor glycoproteins, is named as a left side and right hand edge) enter the chromosomal DNA (Kado (1991) Crit Rev Plant Sci 10:1) of vegetable cell.The combined action of passing through the vir gene (part of original Ti-plasmids) that is called mediates the transfer of described DNA.In order to utilize this natural system, developed the Ti-plasmids (" unloading the first carrier ") that lacks initial tumor inducting gene.In further improving, physically separate (EP-A120516 with other functional element (as the vir gene) of Ti-plasmids by the T-DNA that the more maneuverable shuttle vectors of T-DNA introducing is made; US4.940.838), described T-DNA is called as " binary vector system ".These binary vectors comprise (except unloading first T-DNA and its edge sequence) and are used for the protokaryon sequence of duplicating Agrobacterium and intestinal bacteria simultaneously.The advantage of agriculture bacillus mediated conversion is that usually flank only is that the DNA at described edge is transferred and enters genome and preferentially only insert a copy.Description to agrobacterium vector system and agriculture bacillus mediated gene transfer method is (people (1993) " Procedures forIntroducing Foreign DNA into Plants " in METHODS IN PLANTMOLECULAR BIOLOGY AND BIOTECHNOLOGY such as Miki well known in the art; The 67-88 page or leaf; People such as Gruber (1993) " Vectors for Plant Transformation, " in METHODS INPLANT MOLECULAR BIOLOGY AND BIOTECHNOLOGY; The 89-119 page or leaf; People such as Moloney (1989) Plant Cell Reports 8:238-242).T-DNA is used for the purposes of vegetable cell conversion and has been furtherd investigate and described (EP120516; Hoekema (1985) In:TheBinary Plant Vector System, Offsetdrukkerij Kanters B.V., Alblasserdam, Chapter V; Fraley 1985; And people (1985) EMBO J 4:277-287 such as An).Known have a multiple binary vector, and wherein some are obtainable by commercial sources, for example pBIN19 (Clontech Laboratories, Inc.U.S.A.).

Therefore, for agriculture bacillus mediated conversion, multiple expression constructs is integrated into certain plasmid (enter and shuttle back and forth or intermediate carrier, or enter binary vector).If use Ti or Ri plasmid to transform, the right hand edge at least of Ti or Ri plasmid T-DNA so, but most cases bottom right and left hand edge are connected in the transgene expression construct that will import with the form of flank region.The preferred binary vector that uses.Binary vector can duplicate in intestinal bacteria and Agrobacterium simultaneously.They can comprise that selectable marker gene and flank are the joint or the polylinker (being used to insert the expression construct that for example will shift) of right and left T-DNA edge sequence.They can directly be shifted enters Agrobacterium people (1978) Mol Gen Genet 163:181-187 such as () Holsters.Described selectable marker gene allows to select the Agrobacterium that transforms and is for example to give the nptII gene to the resistance of kantlex.Agrobacterium as the host living beings effect should contain the plasmid that has the vir zone in the case.The latter is that T-DNA shifts needed to vegetable cell.The Agrobacterium of Zhuan Huaing can be used to transformed plant cells in this way.T-DNA is used for the existing deep research and the description (EP120516 of purposes of transformed plant cells; Hoekema (1985) In:The Binary Plant Vector System, OffsetdrukkerijKanters B.V., Alblasserdam, Chapter V; People such as An (1985) EMBO J4:277-287; Also see below).

Common binary vector is based on the plasmid of " wide host range ", as be derived from P type plasmid RK2 pRK252 (people (1984) Nucl Acid Res 12 such as Bevan, 8711-8720) or pTJS75 (people (1985) EMBO J 4 (2) such as Watson: 277-284).These carriers be mostly pBIN19 derivative (people (1984) Nucl Acid Res 12 such as Bevan, 8711-8720).Known multiple binary vector, some of them are obtainable by commercial sources, for example pBI101.2 or pBIN19 (ClontechLaboratories, Inc.USA).Other carrier is being improved (as pPZP aspect size and the operability; People such as Hajdukiewicz (1994) Plant Mol Biol 25:989-994).Improved carrier system also is described in WO 02/00900.

In preferred embodiments, the agrobacterium strains that is used for practice of the present invention comprises the octopine bacterial strain, as LBA4404 or agropine bacterial strain, as EHA101 or EHA105.Be applicable to that agrobacterium tumefaciens bacterial strain that DNA shifts is EHA101pEHA101 people (1986) JBacteriol 168:1291-1301 such as () Hood for example, EHA105[pEHA105] (people (1992) Plant MolBiol 20:1037-1048 such as Li), LBA4404[pAL4404] (people (1983) Nature303:179-181 such as Hoekema), C58C1[pMP90] (Koncz and Schell (1986) Mol Gen Genet204:383-396) and C58C1[pGV2260] (people (1985) Nucl Acids Res13:4777-4788 such as Deblaere).Other bacterial strain that is suitable for is agrobacterium tumefaciens C58, nopaline bacterial strain.Other bacterial strain that is fit to is agrobacterium tumefaciens C58C1 (people (1974) Nature252 such as Van Laerebeke, 169-170), A136 (people (1975) J.Bacteriol 123 such as Watson, 255-264) or LBA4011 (people (1980) J.Bacteriol. such as Klapwijk, 141,128-136).In preferred embodiments, the agrobacterium strains that is used to transform with the pre-incubated plant tissue of plant-based phenolic compounds contains L, and L-succinamopine type Ti-plasmids preferably unloads the plasmid of first, as pEHA101.In another embodiment preferred, the agrobacterium strains that is used to transform with the pre-incubated plant tissue of plant-based phenolic compounds contains octopine type Ti-plasmids, preferably unloads first, as pAL4404.Usually, when using octopine type Ti-plasmids or helper plasmid, preferred virF gene is lacked or deactivation.In preferred embodiments, use agrobacterium strains to transform and use plant-based phenolic compounds, as the pre-incubated plant tissue of Syringylethanone.Method of the present invention can also be used in combination with specific agrobacterium strains, with further increase transformation efficiency, as wherein owing to exist sudden change or chimeric virA or virG gene to make wherein vir genetic expression and/or its induce reformed agrobacterium strains (as people such as Hansen (1994) Proc.Natl.Acad.Sci.USA 91:7603-7607; Chen and Winans (1991) J.Bacteriol.173:1139-1144; People such as Scheeren-Groot (1994) J.Bacteriol 176:6418-6426).

Binary vector or any other carrier can be modified by conventional DNA recombinant technology, in intestinal bacteria propagation and via as electroporation or other transformation technology importing Agrobacterium (Mozo and Hooykaas, Plant Mol.Biol.16 (1991), 917-918).Growth of Agrobacterium and using as described in this area.The carrier that comprises agrobacterium strains is passable, for example the YP substratum that has added suitable microbiotic (as the 50mg/L spectinomycin) (5g/L yeast extract, 10g/L peptone, 5g/L Nail, 15g/L agar, pH6.8) growth 3 days.Collect bacterium and resuspension with ring from solid medium.For purposes of the present invention, provide Agrobacterium consistency carrier by for example site-specific recombination site of described in an embodiment insertion.

Carrier construction (as the carrier of carrier donor molecule or insertion fragment donor molecule or multiple expression constructs composition) afterwards, can be bred carrier with the synthetic nucleic acid molecule that produces nucleic acid polymers in host cell.Carrier is often referred to " shuttle vectors ", can duplicate at least two kinds of incoherent expression systems.Duplicate in order to help this, carrier should comprise at least two replication orgin, and each is effective in a kind of dubbing system.Usually, shuttle vectors can duplicate in eukaryotic system and prokaryotic system.This allows to detect protein expression, " express cell type " in eucaryon host, and increase in prokaryotic hosts this plasmid, " amplifying cells type ".As an illustration, a replication orgin can be derived from SV40, and another replication orgin can be derived from pBR322.Those skilled in the art will know that multiple suitable transcriptional start point.

Carrier construction (as the carrier of carrier donor molecule or insertion fragment donor molecule or multiple expression constructs composition) afterwards, breed in host cell usually by carrier.Carrier propagation can be easily at prokaryotic host cell, as carrying out in intestinal bacteria or the subtilis (Bacillus subtilus).The coli strain that is fit to comprises that BL21 (DE3), BL21 (DE3) pLysS, BL21 (DE3) pLysE, DB2, DB3.1, DH1, DH4I, DH5, DH5I, DH5IF, DH5IMCR, DH10B, DH10B/p3, DH11S, C600, HB101, JM101, JM105, JM109, JM110, K38, RR1, Y1088, Y1089, CSH18, ER1451 and ER1647 (see, Brown (editor) for example, Molecular Biology Labfax (Academic Press 1991)).The bacillus subtilis strain that is fit to comprises that BR151, YB886, M1119, M1120 and B170 (see, Hardy for example, " BacillusCloning Methods, " in DNA Cloning:A Practical Approach, Glover (editor) (IRL Press 1985)).To be that those skilled in the art is well-known (see the standard technique of propagation carrier in prokaryotic hosts, people (editor) such as Ausubel for example, Short Protocols in MolecularBiology, 3.sup.rd version (John Wiley and Sons 1995) [" Ausubel 1995 "]; People such as Wu, Methods in Gene Biotechnology (CRC Press, Inc.1997)).

5. the selection of reorganization scheme-multiple expression constructs

A general scheme of method is shown in Fig. 6 and 7 in the external or body of the present invention, wherein inserting the fragment donor and insert sheet receptor seq (as the carrier donor) can be ring-type or linear DNA, but be shown as linearly to inserting the fragment donor, be shown as cyclic inserting sheet receptor seq (carrier donor).Multiple expression constructs is introduced (or being assembled into) via recombinant clone operation of the present invention and is inserted sheet receptor seq or carrier donor.

The multiple expression constructs molecule that produces can randomly be selected from other molecule such as unreacted insertion fragment acceptor molecule or insertion fragment donor molecule or other unexpected by product or separate.Such selection preferably in vivo (as in intestinal bacteria) use and to be included in the one or more selective markers of inserting in fragment or the carrier donor and to realize, described selective marker is introduced into final multiple expression constructs as the result of recombinant clone operation or from disappearance wherein.

In the preferred embodiment of the invention, the construct of generation (as plasmid) can at first be imported into intestinal bacteria and further select and amplification.The correct intestinal bacteria that transform obtain selecting and growth, and obtain recombinant precursor by method known to the skilled.Can use restriction analysis and sequence verification clone step.

Flank is the fragment and the insertion fragment bunch exchange in inserting the fragment donor of recombination site in inserting sheet receptor seq or carrier donor molecule (it can comprise repressor box or anti-selective marker).Method of the present invention can be transferred the insertion fragment and enters any amount of carrier.Described insertion fragment can be transferred to specific carrier or can be transferred to many carriers in a step.In addition, can be with the insertion fragment in the multiple expression constructs that produces bunch from the multiple expression constructs sequential transfer of described generation to any amount of carrier.

According to the present invention, desirable is the multiple expression constructs of selecting generation at other molecule (comprising unreacted parent's molecule, by product or intermediary cointegrate).For this purpose, in preferred embodiments, the zone that at least one inserts fragment and/or flank is recombination site in inserting the sheet receptor seq comprises at least one selective marker, expression signal, replication orgin, or be used to detect, select, express, the specialization function of mapping or sequenced dna.

Can use multiple other selection scheme known in the art to select multiple expression constructs of the present invention.Depend on individual's preference and needs (as the target host type), can use many dissimilar selection schemes.Those skilled in the art can utilize obtainable a plurality of dna fragmentation or prepare their the conventional different choice method of using of method and this area.This class dna fragmentation include but not limited to encode a kind of activity as, but be not limited to, produce RNA, peptide or protein or the dna fragmentation of binding site be provided for these RNA, peptide or protein.

Term " selection scheme " instigate can be from contain the mixture that inserts fragment donor, carrier donor, any intermediate (as intasome altogether) and/or by product selection, enrichment or identify any method of desirable one or more multiple expression constructs.Several different methods be those skilled in the art known and, for example, be described in US5888732.Preferably need be that selection scheme causes the only selection or the enrichment of the desirable multiple expression constructs of one or more.As herein defined, select dna molecular to comprise that (a) selects the existence of desirable dna molecular or enrichment and (b) select or enrichment at the existence of undesirable dna molecular.

In one embodiment, selection scheme (it can reversely carry out) will be taked one of three kinds of forms, and it will be discussed in Fig. 6 and 7.Herein at first to use negative selectable marker (SN) and anti-selective marker (as the virulent gene product; SC) select the multiple expression constructs molecule to carry out illustration, described multiple expression constructs molecule contains to insert fragment and lack the parent and inserts that flank is the fragment of recombination site in the sheet receptor seq.Virulent gene can be the DNA that is expressed as virulent gene product (toxic protein or RNA), maybe can be itself virose (in one situation of back, virulent gene is understood that to have the routine definition of its " inherited characteristics ").

The example of these virulent gene products is well-known in the art, and comprise, but be not limited to restriction endonuclease (as DpnI), apoptosis-related genes (as ASK1 or bcl2/ced-9 family member), reverse transcription virus gene, comprise the reverse transcription virus gene of human immunodeficiency virus (HIV); Defensin is as NP-1; Oppositely repeat or paired palindromic DNA sequence; As bacterial virus bacteriolysis gene from  X174 or phage T4; The antibiotic sensitive gene is as rpsL; Antimicrobial sensitivity genes is as pheS; Plasmid kills and wounds gene; Produce the eukaryotic transcription vector gene of the toxic gene product of bacterium, as GATA-1; And the gene that when lacking inhibit feature, kills the host, as kicB or ccdB.Alternatively, virulent gene can be in external selection, as restriction site.

In second kind of form, one or more insertion fragments contain negative selectable marker (as, give at microbiotic, weedicide or other plain resistance of killing livestock) or the other expression cassette of positive selective marker (giving growth vigor).Other example includes, but are not limited to:

(i) produce new PCR primer sites (as two original dna sequence dnas not arranged side by side side by side);

(ii) comprising by the dna sequence dna of effects such as restriction endonuclease or other dna modification enzyme, chemical, ribozyme;

(iii) by the comprising of the dna sequence dna of identifications such as dna binding protein dna, RNA, DNA, chemical, as the affinity labelling (Davis, the Nucl.Acids Res.24:702-706 (1996) that from colony, select or get rid of; J.Virol.69:8027-8034 (1995)) or be used for promotor arranged side by side to be used for in-vitro transcription;

(iv) by using randomized and selecting the RNA part outward for the rrna L22 aleuroplast of the RNA that expresses in conjunction with Epstein-Barr virus from the RNA library of cDNA;

(v) its active location that needs specific orientation or functional element arranged side by side (as (a) recombination site, its trans be to react very weak, but when place cis, in the presence of suitable protein, cause recombinating, destroy some molecular group; (as the promoter sequence that allows to vitro synthesized RNA is rebuild).This RNA can directly use, or can obtain desirable DNA construct by reverse transcription;

(vi) select desirable product by bulk of molecule (as fractional separation) or other physical property; With

(vii) make comprising that it can certified specific modification (as methylating) needed dna sequence dna.

After forming multiple expression constructs and by product with method of the present invention, can in external or body, select step by concrete selection scheme decision, described scheme is an optional design in concrete recombinant clone operation.For example, can be designed for the external system of selection of inserting the fragment donor and inserting sheet receptor seq (carrier donor) dna molecular.These schemes can comprise that the rare restriction site of transformation in initial circular vectors makes that described rare cleavage site is arranged in by product after recombination event takes place.Therefore, when external when in reaction mixture, being added in the restriction enzyme of rare restriction enzyme sites combination and cutting, the all DNA molecule that has rare cleavage site, promptly initiate dna molecule, cointegrate and by product will be cut and make it not duplicate in the purpose host cell.

Similarly, when handling linear DNA molecule, can design external system of selection.Can be transformed with PCR primer sequence complementary dna sequence dna, thereby they are only transferred in the multiple expression constructs by the recombinant clone method.After reaction finishes, suitable primer is added reaction soln and sample is carried out PCR.So all or part of multiple expression constructs molecule is amplified.

Screening scheme can particularly use in the e. coli strains system at multiple host cell in other body.A kind of method is that the repressor gene is placed one section fragment inserting sheet receptor seq (carrier donor) molecule, and the drug labelling of this repressor control places on another fragment of same plasmid.Other method is that to place the flank that inserts the fragment acceptor molecule be the zone (Fig. 6 and 7) of recombination site with killing and wounding gene.Certainly must a kind ofly make this class insert the method for fragment acceptor molecule (as plasmid vector) growth, promptly must exist to make and kill and wound the environment that gene does not does not kill and wound.Known have many such genes to need special coli strain.A kind of scheme is to use restriction enzyme DpnI, and this enzyme only could cut when its recognition sequence GATC is methylated.Many coli strains commonly used GATC sequence that methylates, but mutant is arranged, DpnI that therein can cloning by expression and do not damage this mutant strain.Can also use other restriction enzyme allele to be used for selecting as virulent gene.Under these circumstances, the host of containing the gene of the corresponding methylase of coding provides and has been used for shielded host of the present invention.Similarly, ccdB protein is effective toxic agent of DNA gyrase, can effectively catch the gyrase molecule in the complex body that can cut, and produces DNA splitting of chain and necrocytosis.The sudden change of the gyrA subunit of DNA gyrase, the resistance to ccdB (Bernard and Couturier, J.Mol.Bio.226 (1992) 735-745) is given in particularly gyrA462 sudden change.The coli strain DB2 that has made up contains the gyrA462 sudden change.The DB2 cell that contains the plasmid of expressing the ccdB gene can not killed by ccdB.This bacterial strain can obtain also to be preserved in agricultural research institute preservation center (Agricultural Research Culture Collection) (NRRL) on October 14th, 1997 from Life Technologies, 1815 North University Street, Peoria, Ill.61604 USA, its preserving number are NRRLB-21852.

Certainly, selection scheme is used for other host living beings like can design class.For example, tet repressor/operator gene of Tn10 has been used in controlling gene expression (Gossen, M. and Bujard, H., Proc.Natl.Acad.Sci.USA 89:5547-5551 (1992)) in the eukaryote.Therefore can be used for selecting multiple expression constructs by tet repressor same control or other selection scheme described herein by this paper institute illustration to drug resistance at eukaryotic cell.

6. preferably insert the fragment expression box

Preferably, insertion fragment of the present invention comprises at least a expression cassette, and it makes can express purpose nucleic acid and passable, for example, promotes the expression of selectable marker gene, character gene, sense-rna or double-stranded RNA.Preferably, described expression cassette is included in the promoter sequence that effective connection nucleotide sequence of function is arranged in target host cell or the biology (preferred plant cell), and described nucleotide sequence is given these cells or biological favourable phenotype when expressing.Skilled in the art will recognize that multiple sequence applicable to this paper.For plant, can use sequence, as increasing grain and feed quality, generation chemical, fine chemicals or medicine (as VITAMIN, oil, carbohydrate; Dunwell JM (2000) J ExpBot 51 Spec No:487-96), give resistance, or cause male sterile weedicide.In addition, can increase growth, output and at abiotic and biological coerce the factor (as, as fungi, virus or insect) resistance.Can pass through marking protein or expressed, as express corresponding sense-rna (people (1988) Proc Natl Acad Sci USA 85:8805-8809 such as Sheehy by reducing endogenous protein; US4,801,340; People such as Mol (1990) FEBS Lett 268 (2): 427-430) or double-stranded RNA give favourable characteristic (people (2000) Plant Mol Biol43:401-415 such as Matzke MA; People (1998) Nature 391:806-811 such as Fire A.; People such as Waterhouse (1998) Proc Natl Acad Sci USA 95:13959-64; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364).

Advantage of the present invention is the selection by recombination site, not only produces clear and definite multiple expression constructs (expression cassette that comprises whole expections), and in described multiple expression constructs the direction of each expression cassette be predetermined and can arrange as required.This helps being avoided contingent unexpected effect (for example gene silencing) in some orientations of many expression cassettes.

6.1 preferred promotor

For expressing gene, purpose nucleic acid molecule to be expressed must effectively connect the adjusting sequence of controlling transcriptional expression, and imports host cell subsequently.Except transcriptional regulatory sequences, for example outside promotor and the enhanser, expression vector can comprise the adjusting sequence (detailed description in see above " definition ") that can transcribe and translate.

As an illustration, be applicable to that the conditioning signal of transcribing and translate of mammalian hosts can be from viral source, as adenovirus, bovine papilloma virus, simian virus etc., wherein conditioning signal is connected with the specific gene that high expression level is arranged.The suitable adjusting sequence of transcribing and translate can also obtain as Actin muscle, collagen protein, myosin and metallothionein gene from mammalian genes.

Suitable transcriptional regulatory sequences comprises is enough to the synthetic initial promoter region of guide RNA.Illustrative promoter in eukaryote comprises mouse metallothionein(MT) I gene promoter (people such as Hamer, J.Molec.Appl.Genet.1:273 (1982)), TK promotor (the McKnight of simplexvirus, Cell31:355 (1982)), SV40 early promoter (people such as Benoist, Nature 290:304 (1981)), rous sarcoma virus promoter (people such as Gorman, Proc.Nat ' l Acad.Sci.USA 79:6777 (1982)), cytomegalovirus promoter (people such as Foecking, Gene 45:101 (1980)) and mouse mammary tumor virus promotor (see Etcheverry usually, " Expression of Engineered Proteins inMammalian Cell Culture; " in Protein Engineering:Principles andPractice, people such as Cleland (editor), 163-181 page or leaf (John Wiley and Sons, Inc.1996)).Alternatively, if prokaryotic promoter is regulated by eukaryotic promoter, prokaryotic promoter such as phage T3 rna polymerase promoter can be used for controlling the expression (people such as Zhou of goal gene at mammalian cell, Mol.Cell.Biol.10:4529 (1990), with people such as Kaufman, Nucl.Acids Res.19:4485 (1991)).

When the expression of plant, the specific promotor of preferred plant.Term " plant specificity promoter " is understood that mainly to mean in part, vegetable cell, plant tissue or the plant culture of plant or plant and can expresses by controlling gene, particularly any promotor of expression of exogenous gene.In this article, expression can be, for example composing type, derivable or rely on and grow.Below be preferred:

A) constitutive promoter

" composing type " promotor refers to a certain substantial phase at development of plants, preferably whole periods of development of plants many, preferably in whole tissues, guarantee expression promoter.Especially preferably use the promotor of plant promoter or plant-derived virus.The promotor of preferred especially CaMV (cauliflower mosaic virus) 35S transcript (people (1980) Cell 21:285-294 such as Franck; People such as Odell (1985) Nature 313:810-812; People such as Shewmaker (1985) Virology 140:281-288; People such as Gardner (1986) Plant Mol Biol 6:221-228) or 19S CaMV promotor (US5,352,605; WO 84/02913).Suitable in addition constitutive promoter is that rice actin starts and to give (people such as McElroy, Plant Cell 2:163171 (1990)), rubisco small subunit (SSU) promotor (US4,962,028), legumin B promotor (GenBank Acc.No.X03677), promotor from the nopaline synthase of Agrobacterium, TR binary promotor, OCS (octopine synthase) promotor from Agrobacterium, ubiquitin promotor (people (1995) Plant Mol Biol 29:637-649 such as Holtorf S), ubiquitin 1 promotor (people (1989) PlantMol.Biol.12:619-632 such as Christensen, people such as Christensen (1992) Plant Mol Biol 18:675-689; People such as Bruce (1989) Proc Natl Acad Sci USA 86:9692-9696), Smas promotor, cinnamyl-alcohol dehydrogenase promotor (US5,683,439), vacuole ATP enzyme subunit promotor, pEMU promotor (people (1991) Theor.Appl.Genet.81 such as Last DI, 581-588), (people (1984) EMBO such as Velten J is (12) J.3: 2723-2730) and corn H3 histone promotor (people such as Lepetit, Mol.Gen.Genet.23 1:276-285 (1992) for the MAS promotor; People such as Atanassova (1992) Plant J 2 (3): 291-300), Arabidopis thaliana nitrilase 1 gene promoter (GenBank Acc.No.:U38846, Nucleotide 3862 to 5325 or to 5342) or from the rich proline protein matter promotor (WO 91/13991) of wheat, and other in plant the promotor of constitutive expression gene.

B) tissue-specific or organize preferred promotor

More preferably to the promotor of seed specific, for example, phaseoline promotor (US5,504,200; People such as Bustos (1989) Plant Cell 1 (9): 839-53, people such as Murai, Science 23:476-482 (1983); People such as Sengupta-Gopalan, Proc.Nat ' l Acad.Sci.USA 82:3320-3324 (1985)), 2S albumin gene promotor (people (1987) J Biol Chem262:12196-12201 such as Joseffson LG), legumin promotor (people (1989) Mol Gen Genet215 (2) such as Shirsat A: 326-331), USP (unknown seed protein) promotor (people (1991a) MolGen Genet 225 (3) such as B  umlein: 459-467), rapeseed protein gene promoter (US5,608,152; People such as StalbergK (1996) Planta 199:515-519), sucrose-binding proteins matter promotor (WO 00/26388) or legumin B4 promotor (LeB4; People (1991b) Mol Gen Genet225:121-128 such as B  umlein H, 1992), Arabidopis thaliana oleosin promotor (WO 98/45461) and Btassica Bce4 promotor (WO 91/13980).More preferably leaf specificity and photoinduced promotor, for example cab or rubisco promotor (people (1985) EMBO J4:2723-2729 such as Simpson; People such as Timko (1985) Nature 318:579-582); Anther specific promoter is as the promotor (people (1989b) Mol Gen Genet 217:240-245 such as Twell) of LAT52; Pollen specific promoter is as the promotor (people (1993) Mol Gen Genet224:161-168 such as Guerrero) of Zml3; With the preferred promotor of sporule, as promotor (people (1983) Sex.Plant Reprod.6:217-224 such as Twell) from apg.

C) chemical inducible promoter

Expression cassette can also comprise chemical inducible promoter (survey article: people such as Gatz (1997) Annu Rev Plant Physiol Plant Mol Biol 48:89-108), can control foreign gene by this promotor and express at particular point in time in plant.This class promotor, for example PRP1 promotor (people 1993 such as Ward), Whitfield's ointment inducible promoter (WO 95/19443), benzsulfamide inducible promoter (EP0388186), tsiklomitsin inducible promoter (people (1991) MolGen Genetics 227:229-237 such as Gatz; People such as Gatz (1992) Plant J 2:397-404), dormin inducible promoter (EP0335528) or ethanol-pimelinketone inducible promoter (WO 93/21334) can use too.What be suitable for equally is gsh-S transferring enzyme isoform II gene (GST-II-27) promotor, the safener that it can be provided by external source, N for example, N-diallyl-2,2-dichloro acetamide (WO 93/01294) activates and can operate in many tissues of unifacial leaf and dicotyledons.Inducible promoter of the present invention comprises the promotor from the ACE1 system (people PNAS 90:4567-4571 (1993) such as Mett) of replying copper or from the In2 promotor of replying the benzenesulfonamide herbicide safener (people (1991) the MolGen Genetics 227:229-237 such as Hershey of corn for can be used in of can giving an example in addition; People such as Gatz (1994) Mol Gen Genetics 243:32-38).Can use the promotor of replying the inductor that plant do not respond usually.Exemplary inducible promoter is the inducible promoter from the steroid hormone gene, and its transcriptional activity is by glucocorticosteroid hormone induction (people (1991) Proc Nat ' l Acad Sci USA 88:10421 such as Schena).

Particularly preferably be constitutive promoter.In addition, other promotor can effectively connect the nucleotide sequence that will express, and this promotor allows at the other plant tissue or at other biology, for example expression in escherichia coli.Suitable plant promoter is all above-mentioned promotors in principle.

Hereditary component and/or expression cassette can comprise except promotor other genetic control sequence.Term " genetic control sequence " should be by with broad understanding and refer to specializing or the effective full sequence of function according to expression cassette of the present invention.For example, genetic control sequence is modified at transcribing and translating in protokaryon or the eukaryote.Preferably, expression cassette according to the present invention is included in the promotor with 5 '-upstream of recombinant expressed nucleotide sequence of being positioned at that works in the plant, with 3 '-downstream as the terminator sequence of other genetic control sequence and, if it is suitable, other conventional regulatory elements, all these control sequences all effectively connect treats recombinant expressed nucleotide sequence.

Genetic control sequence also comprises the noncoding 3 '-district of 5 '-non-translational region, intron or gene, for example Actin muscle 1 intron or Adh1-S introne 1,2 and 6 (reference usually: The MaizeHandbook, Chapter 116, Freeling and Walbot edit, Springer, New York (1994)).Proved that they can exercise vital role in the adjusting of genetic expression.Therefore, proved that 5 '-non-translated sequence can strengthen the transient expression of heterologous gene.The example of the translational enhancer that can propose is tobacco mosaic virus (TMV) 5 '-leader sequence (people (1987) Nucl Acids Res15:8693-8711 such as Gallie) etc.In addition, it can also improve tissue specificity (people (1998) Plant J 15:435-440 such as Rouster J).

Expression cassette can advantageously comprise the one or more enhancer sequence that effectively is connected in promotor, and this enhancer sequence can increase the recombinant expressed of nucleotide sequence.Favourable sequence in addition as other regulatory elements or terminator, also can be inserted 3 '-end with recombinant expressed nucleotide sequence.

Expression cassette can also comprise transcription termination sequence and randomly, polyadenylation signal sequence.The polyadenylation signal that is suitable as control sequence is the plant polyadenylation signal, preferably correspond essentially to T-DNA polyadenylation signal, particularly the polyadenylation signal of OCS (octopine synthase) terminator and NOS (nopaline synthase) terminator from agrobacterium tumefaciens.Expression vector does not need to contain Transcription Termination and polyadenylation signal sequence, because these elements can be provided by cloned genes or gene fragment.

Hereditary component of the present invention and/or expression cassette can comprise other functional element.The term functional element should and refer to that generation, amplification or function for hereditary component of the present invention, expression cassette or reorganization biology have whole elements of influence by broad understanding.Functional element for example can comprise (but should not be limited to) selectable marker gene (comprise negative, positive and anti-selective marker, see the following detailed), reporter gene and

1) replication orgin, it guarantees expression cassette of the present invention or carrier for example, the amplification in the intestinal bacteria.The example that can mention is ORI (dna replication dna starting point), pBR322 replication orgin or P15A replication orgin (Maniatis T, Fritsch EF and Sambrook J (1989) Molecular Cloning:A Laboratory Manual, second edition, Cold Spring Harbor Laboratory, ColdSpring Harbor (NY)).The other example that the dubbing system of function is arranged in intestinal bacteria is ColE1, pSC101, pACYC184 etc.Except intestinal bacteria dubbing system or replacement intestinal bacteria dubbing system, can use the dubbing system of wide host range, as the dubbing system of the incompatible plasmid of P-1; As pRK290.These plasmids are effective especially to the floristics host for shifting T-DNA with the Ti-plasmids that first is arranged or unload first.Expression vector can also comprise the SV40 starting point.The episome that this element can be used in the clone of expressing the SV40 large T antigen duplicates and saves.

2) the agriculture bacillus mediated required element of Plant Transformation, for example, T-DNA right and/or, randomly, left hand edge or vir zone.

3) cloning site: cloning site is multiple clone site preferably.Can use any multiple clone site, and many multiple clone site are obtainable by commercial sources.

4) S/MAR (support/matrix attachment regions).Matrix attachment regions (MARs) operationally is defined as in external specific combination in the DNA element of nuclear matrix (nuclear scaffold protein) and be suggested and mediate adhering to of chromatin and nuclear scaffold in vivo.It also may mediate combining of chromatin and nuclear matrix in vivo and change the genomic topological framework of energic nucleus.When MAR is positioned at genetically modified either side, their existence causes producing in genetically modified organism (particularly plant) or the clone higher and more stable expression usually, and this is likely by minimizing (the summary: people (2000) Plant Mol Biol 43 (2-3) such as Allen GC: 361-76) that gene silencing is realized.Multiple S/MAR sequence and its influence to genetic expression (people (2003) Transgenic Research.12 (2): 137-54 such as Sidorenko L has been described; People (1996) Plant Cell 8 (5) such as Allen CG, 899-913; People (2001) J.Mol.Biol.312 such as Villemure JF, 963-974; Mlynarova, people such as L (2002) Genetics 160,727-40).The S/MAR element can be preferred for reducing gene silencing, gene silencing can be in multiple expression constructs some direction of expression cassette (people (2003) Plant Cell.15 (9) such as Mlynarova L: 2203-17) takes place.The example of S/MAR be lysozyme of chicken A element (people such as Stief, 1989, Nature341:343).

5) further modify the expressed proteinic sequence of transcribing, translating and/or transport.For example expressed protein can be the chimeric protein that contains secretory signal sequence.This secretory signal sequence effectively connects goal gene, two sequences are connected in correct reading frame and locatees to instruct new synthetic desired polypeptides to enter the Secretory Pathway of host cell.Secretory signal sequence be usually located at coding purpose aminoacid sequence nucleotide sequence 5 ', yet some excretory signal sequence can be positioned at other position (US5037743, US5143830) of purpose nucleotide sequence.Expression vector can also comprise the peptide-labeled nucleotide sequence of the auxiliary desired polypeptides purifying of coding.Be used to separate peptide-labeled poly histidine mark (it has affinity to the nickel resin), c-myc mark, caldesmon matter (separating), Substance P, RYIRS mark (itself and anti-RYIRS antibodies), Glu-Glu mark and the FLAG mark (itself and anti-FLAG antibodies) of comprising of recombinant polypeptide with the calmodulin affinity chromatography.See people such as Luo for example, Arch.Biochem.Biophys.329:215 (1996), people such as Morganti, people such as Biotechnol.Appl.Biochem.23:67 (1996) and Zheng, Gene 186:55 (1997).The peptide-labeled nucleic acid molecule of this class of encoding can, for example (St.Louis Mo.) obtains from Sigma-Aldrich Corporation.

Disclosed herein and claimed whole compositions and method can be under instruction of the present disclosure with preparation with carry out and without undo experimentation.Although the compositions and methods of the invention are described according to embodiment preferred, it will be apparent to one skilled in the art that the order of the step of the step that can change composition described herein, method and method or methods described herein and step and do not deviate from notion of the present invention, spirit and scope.More specifically, obviously some chemistry material all relevant with physiology can substitute material described herein and obtain same or analogous effect.What conspicuous to those skilled in the art all these classes were similar substituting and revising within spirit of the present invention, scope and the notion that is considered to be in by the claims definition.Whole publication cited herein, patent and patent application are incorporated herein by reference hereby for all purposes.

6.2 preferred purpose nucleic acid

As noted above, multiple expression constructs of the present invention can carry multiple nucleotide sequence.Method of the present invention can be preferred for obtaining to have the transgenic cell and the biology of valuable proterties, and it need express two or more purpose nucleic acid.Purpose nucleic acid can, for example, be used to suppress native gene (as by antisence or double-stranded RNA) or be used for expressing or cross marking protein.

Preferably, expressed protein has industry, treatment, diagnosis or researching value.Illustrative protein comprises antibody and antibody fragment, acceptor, immune modulator, hormone etc.For example, expression cassette can comprise the nucleic acid molecule of the pharmaceutically active molecule of encoding, described pharmaceutically active molecule is for example factor VIIa, proinsulin, Regular Insulin, follicle stimulating hormone, tissue plasminogen activator, tumour necrosis factor, interleukin is (as il-1 (IL-1), IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20 and IL-21), G CFS (as granulocyte colony-stimulating factor and rHuGM-CSF), Interferon, rabbit is (as interferon-' alpha ',-β,-γ,-ο,-δ,-τ and-ε), stem cell factor, erythropoietin, lymphokine, toxin is (as ricin, abrine, ETA, herpes simplex virus thymidine kinase, the intestinal bacteria guanine phosphoribosyl transferase, shiga toxin, the wheat toxalbumin, antiviral protein, Phytolacca acinosa, spend more white tree toxalbumin, diphtheria toxin), prodrug, the prodrug activator, the antigen that immune stimulatory is replied, ribozyme and support or suppress the protein of immunne response, and the antisense sequences just sequence of (or be used for " antisense application ") and thrombopoietin.The example of other target protein matter comprises antibody, antibody fragment, antiidiotypic antibody (or its fragment), chimeric antibody, humanized antibody, antibody fusion protein etc.Preferably, can use method of the present invention to express the protein that comprises two or more different subunits.Can use multiple expression constructs of the present invention that whole expression cassettes of all subunits are imported host cell simultaneously in a step.

Can easily obtain the above-mentioned proteinic sequence of coding from multiple source, described source comprises, American type culture collection (American Type CultureCollection) (ATCC for example, Rockville, Md.), perhaps commercial source is as BritishBio-Technology Limited (Cowley, Oxford, England).Can also the above-mentioned proteinic sequence of composite coding, for example use Applied Biosystems Inc.DNA synthesizer (as, APBDNA synthesizer model 392 (Foster City, Calif.)).

Preferably, the transgene expression construct of the present invention that inserts the target Plant Genome comprises at least one expression construct, its can, for example, make things convenient for the expression of selective marker, character gene, sense-rna or double-stranded RNA.Preferred described expression construct contains the promoter sequence that function is arranged at vegetable cell, (perhaps-and preferred-effectively connect promotor of the present invention or another suitable promotor of nucleotide sequence as mentioned above, described nucleotide sequence gives plant transformed favourable phenotype when expressing).Those skilled in the art knows the multiple sequence that can be used for this paper, and these sequences are used for, as increasing grain and feeding quality, production chemical, fine chemicals or medicine (as VITAMIN, oil, carbohydrate; Dunwell JM (2000) J Exp Bot 51 Spec No:487-96), give the resistance of weedicide or give male sterile.In addition, can increase growth, output and at the abiotic and biological resistance of coercing the factor (as for example fungi, viral nematode or insect).Can pass through marking protein or reduce endogenous protein and express, as by expressing corresponding sense-rna (people (1988) Proc Natl Acad Sci USA 85:8805-8809 such as Sheehy; US4,801,340; People such as Mol (1990) FEBS Lett 268 (2): 427-430) or double-stranded RNA give favourable characteristic (people (2000) Plant Mol Biol 43:401-415 such as Matzke MA; People (1998) Nature391:806-811 such as Fire A.; People such as Waterhouse (1998) Proc Natl Acad Sci USA95:13959-64; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364).Purpose nucleic acid can encode following (but being not limited to):

1. selective marker and reporter gene

Selective marker is used to select and separates cell successfully that transform or homologous recombination.Multiple negative selectable marker (giving resistance) to toxic chemical or biocide compound, positive selective marker (giving growth or proliferative advantage) or anti-selective marker (giving toxic effect, preferably with other non-toxic chemical combination) are being known in the art and are as above describing (seeing " definition ").In addition, multiple reporter gene and protein are known and as above describe (seeing " definition ") that it allows to easily identify, preferably by visual evaluation cell transformed or biology.

2. character gene

The technician is familiar with multiple purpose nucleic acid (or by its encoded protein matter), and the transgene expression of described nucleic acid is favourable.The technician also is familiar with several genes, and corresponding antisense of this gene or double-stranded RNA suppress or reticent described gene also can obtain advantageous effects by expressing.Following as advantageous effects example and do not propose as limiting:

-acquisition is to the resistance of abiotic stress (high and low temperature, drying, the humidity of increase, environmental toxin, UV radiation)

The resistance of (pathogenic agent, virus, insect and disease) is coerced in-acquisition to biology

-acquisition is to the resistance of phytotoxic material or weedicide

-raising the speed of growth or output.

Following nucleotide sequence or the polypeptide that can be used for these application proposes as limiting as an example and not:

1. improve the protection of plant embryos with to resisting abiotic stress such as drying, high or low temperature, comprise and for example passed through to express from Myoxocephalus scorpius (WO 00/00512), the antifreeze peptide of Myoxocephalus octodecemspinosus, Arabidopis thaliana activating transcription factor CBF1, (WO 97/12983 for glutamate dehydrogenase, WO 98/11240), for example from the embryo producer in late period (LEA) of barley (WO97/13843), calcium dependent kinases gene (WO 98/26045), calcinerin (WO 99/05902), farnesyl transferase (WO 99/06580, and Pei 1998), ferritin (Deak 1999), (WO 99/04013 for oxalate oxidase; Dunwell (1998) Biotechnology and Genetic Engeneering Reviews 15:1-32), the DREB1A factor (dehydration response element B 1A; Kasuga 1999), N.F,USP MANNITOL or trehalose synthetic gene, as trehalose-6-phosphate salt synthase or trehalose-6-phosphate salt Phosphoric acid esterase (WO 97/42326), or by suppressor gene such as mycose-base because of (WO 97/50561).Particularly preferred nucleic acid is coding antifreeze protein matter (GenBank Acc.No.:AF306348) or its function equivalent from the activating transcription factor CBF1 or the Myoxocephalusoctodecemspinosus of Arabidopis thaliana (GenBankAcc.No.:U77378).

2. for example obtain the resistance of the disease that causes at fungi, insect, nematode with by specific metabolite in the embryonic epidermis or the secretion of proteinic target or concentration.The example that can propose is glucosinolate (a defence herbivore); The enzyme of chitinase or dextranase and other infringement parasite cell walls; Ribosome inactivating protein (RIP); Protein (this stress response is caused by wound or microbiological attack plant, or by chemical, for example, Whitfield's ointment, jasmonic acid or ethene cause) with other plant resistance to environment stress and stress response; The N,O-Diacetylmuramidase in non-plant source, for example T4 N,O-Diacetylmuramidase or from multiple mammiferous N,O-Diacetylmuramidase; Insect-killing protein such as bacillus thuringiensis intracellular toxin;-amylase inhibitor or proteinase inhibitor (Cowpea Trypsin Inhibitor); Dextranase; Lectin such as phytohemagglutinin, GNA, wheat germ agglutinin; RNA enzyme or ribozyme.The nucleic acid of special optimized encoding Trichoderma harzianumchit42 endochitinase (GenBank Acc.No.:S78423) or the coding Sorghumbicolor multi-functional cytochrome P-450 of N-hydroxylation (CYP79) protein (GenBank Acc.No.:U32624), or its function equivalent.

Can use transgene expression construct of the present invention to suppress or reduce the expression of endogenous target gene by " gene silencing ".Its inhibition causes that the preferred gene of favourable phenotype or protein are that the technician is known.Example can include but not limited to reduce the proteic β-subunit of Arabidopis thaliana G to increase root quality people (2003) Plant Cell 15:393-409 such as () Ullah, deactivation cyclic nucleotide gate ionic channel (CNGC) to improve disease resistance (WO2001007596) and downward modulation 4-Coumarate-CoA ligase (4CL) gene to change xylogen and content of cellulose (US2002138870).

Can or suppress (justice suppresses) by being total to and realize gene silencing by antisense or double-stranded RNA." antisense " nucleic acid at first is understood that to mean the nucleotide sequence of at least a portion of " justice " chain that is complementary to described target protein wholly or in part.The technician is known can to use alternative cDNA or the corresponding gene starting template as the antisense constructs that is fit to." antisense " nucleic acid preferably with coding region or its part complementation of target protein.Yet, " antisense " nucleic acid can also with non-coding region or its part complementation.The technician can consider that the Watson-Crick base pairing principle begins to design antisense nucleic acid from the sequence information of target protein according to the mode of being familiar with.Antisense nucleic acid can with the complete of target protein or the part nucleic acid array complementation.

Comprise the use of above-mentioned sequence in just direction equally, known as the technician, it can produce common inhibition (justice suppresses).The expression that has proved justice can reduce or close identical expression, is similar to description to the antisense method (people (1991) Proc.Natl Acad.Sci.USA88:1770-1774 such as Goring; People such as Smith (1990) Mol.Gen.Genet.224:447-481; People such as Napoli (1990) Plant Cell 2:279-289; People (1990) Plant Cell2:291-99 such as Van der Krol).In the present context, the construct of importing can be represented the gene that part fully or is only reduced.The possibility of translation not necessarily.

The preferred especially generegulation method of using by double-stranded RNA i (" double-stranded RNA interference ").These class methods are conventionally known to one of skill in the art (as people (2000) Plant MolBiol 43:401-415 such as Matzke MA; People (1998) Nature 391:806-811 such as Fire A.; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364).With particular reference to the method for in described reference, describing.

In addition, can be under promotor of the present invention control expressing human worker transcription factor (as the zinc finger protein type; People such as Beerli (2000) Proc Natl Acad Sci USA 97 (4): 1495-500) to regulate the expression of specific native gene.These factors are connected in the regulatory region of the native gene of waiting to express or suppressing and depend on the design of the factor, cause the expression or the inhibition of native gene.

In the preferred embodiment of the inventive method, assembling multiple expression constructs can be used for the purpose of complicated approach through engineering approaches or is used for producing the complicated product that needs two or more enzymatic reactions.Example can comprise but should not be limited to:

A) synthesize polyunsaturated fatty acid (PUFA):

B) increase oil-contg:

C) synthesise vitamins (as tocopherol) or carotenoid (as astaxanthin):, exist to be selected from the multiple combination of at least two kinds of sequences that ketolase, beta cyclase, B-hydroxylase, B-hydroxylase inhibition sequence, ε-cyclase and ε-cyclase suppress sequence for synthesizing astaxanthin.More preferably, sequence is selected from HMG-CoA-reductase enzyme, (E)-4-hydroxy-3-methyl-but-2-ene base-bisphosphate reductase enzyme, 1-deoxidation-D-wood sugar-5-phosphate synthase, 1-deoxidation-D-wood sugar-5-phosphoric acid-reduction isomerase, isopentene group-bisphosphate-Δ-isomerase, geranyl diphosphate synthase, farnesyl diphosphate synthase, geranyl geranyl diphosphate synthase, phytoene synthase, phytoene desaturase, sigma carotene desaturase, crtISO protein, FtsZ protein and the proteinic encoding sequence of MinD.

The substances content that changes in the biosystem is the purpose of approach operation.As a rule, more than one precursor is depended in biosynthesizing a kind of or a class material.For example the material of being summarized in the term vitamin-E (tocopherol and tocotrienols) synthesizes and depends on the synthetic of homogentisic acid and phytyl tetra-sodium.The phytyl tetra-sodium is that isoprenoid approach product and homogentisic acid are from shikimic acid pathway.Two kinds of products all are essential for relating to the biosynthetic final step of tocopherol that methylates with cyclisation step.All these enzymatic steps and the gene product that relates to are bottlenecks possible in the manipulating approach.In order to increase the end product vitamin-E, must find the rate-limiting enzyme activity.These enzymic activitys should increase according to correct order.In order to realize this purpose, must test many combinations to find the most promising assortment of genes.

In the preferred embodiment of the invention, the expression cassette that imports plant by described multiple expression constructs of the present invention can give that described transgenic plant are at least a to be selected from following phenotype: the pathogen resistance of the vitamin contents of the starch content of the nutritive value of increase, the oil-contg of increase, increase, the protein content of increase, increase, the carotenoid content of increase, increase, the oil of change or the stress tolerance that starch is formed and increased.The quality (as oil) that term " increase " means the quantity of compound or characteristic (as stress tolerance) is higher than the same characteristic in the identical plant variety of loss of expression box.Preferably, increasing is 10% at least, preferably at least 50%, more preferably at least 100%, most preferably at least 500%.Term " modification " means the variation of quality or quantity, the variation that preferred complex mixture is formed.Form about oil, " modification " means preferably more high-load unsaturated and/or polyunsaturated fatty acid.Form about starch, " modification " means the change of preferred amylopectin and amylose starch ratio.

Therefore another embodiment of the present invention relates to the multiple expression constructs that obtains by method of the present invention.Described multiple expression constructs comprises that at least two are inserted fragment I (n), and wherein n characterizes each to insert segmentally from 1 to m integer, and m is the different segmental sums that insert.Each inserts fragment and comprises at least one expression cassette.Each insertion fragment flank is the sequence that re-assembly side A (2i) reorganization of re-assembly side A (2i-1) and identical i produces, and wherein said recombination site is with as above defined identical about being included in the individuality insertion fragment of inserting in the fragment donor molecule.Recombination site attR1 for example ^*With attL1 ^*Reorganization produce attB1 ^*, attR2 ^*With attL2 ^*Produce attB2 ^*, attR3 ^*With attL3 ^*Produce attB3 ^*, attR4 ^*With attL4 ^*Produce attB4 ^*(the sequence explanation sees above).

7. target biology and transformation technology

Another research theme of the present invention relates to the transgenic cell that transforms with at least a multiple expression constructs of the present invention or non-human being and from the cell of this class biology, cell culture, tissue, organ (as the leaf of plant biological, root etc.) or breeding material.

Preferably, transgenic cell or non-human being are selected from protokaryon and eukaryotic cell or biology (as above define and illustrate).Most preferably, described transgenic cell or biology are selected from vegetable cell or biology (as above define and illustrate).

Produce the biology or the cell transformed that transform and the DNA that is discussed need be imported the host cell of being discussed.Several different methods can be used for this step, and it is called as conversion (seeing Keown (1990) Methods in Enzymology 185:527-537 again).For example, DNA can directly import by microinjection or via the microparticle bombardment of DNA bag quilt.In addition, all right saturatingization of chemistry cell for example uses polyoxyethylene glycol, makes DNA can diffuse into cell.Can also merge importing DNA by protoplastis with other unit such as minicell, cell, lysosome or liposome that contains DNA.Another appropriate method that imports DNA is an electroporation, and wherein cell is changed by reversible thoroughly by electricimpulse.

Aforesaid host cell or biology can be any protokaryon or eukaryote.Preferably mammalian cell, non-human mammal biology, vegetable cell and plant biological as defined above.

Multiple expression constructs of the present invention preferably is imported into eukaryotic cell.It can preferably be inserted into genome (as plastid or chromosomal DNA), but can also be present in extrachromosome or table karyomit(e).Preferred eukaryotic cell is mammalian cell, fungal cell, vegetable cell, insect cell, bird cell etc.The example of suitable mammalian host cell comprises African green monkey kidney cell (Vero; ATCCCRL 1587), HEKC (293-HEK; ATCC CRL 1573), baby hamster kidney cell (BHK-21, BHK-570, ATCC CRL 8544, ATCC CRL 10314), Madin-Darby canine kidney(cell line) (MDCK; ATCC CCL 34), Chinese hamster ovary cell (CHO-K1; ATCC CCL61; CHO DG44 (people such as Chasin, Som.Cell Molec.Genet.12:555,1986)), rat pituitary cell (GH1; ATCC CCL82), HeLa S3 cell (ATCC CCL2.2), rat hepatoma cell (H-4-II-E; ATCC CRL 1548), the monkey-kidney cells (COS-1 of SV40 conversion; ATCCCRL 1650) and mouse protoblast (NIH-3T3; ATCC CRL 1658).

Can use multiple standards technology such as comprising the sending of calcium phosphate transfection, liposome-mediated transfection, microinjection mediation, electroporation that multiple expression constructs is imported host cell.Can select and breed cells transfected and comprise the recombinant host cell that stable integration is gone into the goal gene of host cell gene group to provide.

Described multiple expression constructs can be the rhabdovirus expression vector that uses at rhabdovirus system.Rhabdovirus system provides effective means that clone's goal gene is imported insect cell.Suitable expression vector is based on autographa california multiple nuclear polyhedrosis virus (AcMNPV), and contain known promotor, as, early gene promoter (ie-1) of fruit bat heat shock protein(HSP) (hsp) 70 promotors, autographa california nuclear polyhedrosis virus mediation and early stage 39K promotor, baculovirus p10 promotor and the fruit bat metallothionein promoter that postpones.The other method of preparation recombinant baculovirus is to use as the described system based on transposon of Luckow (Luckow waits the people, J.Virol.67:4566 (1993)).This system uses transfer vector, and (Life Technologies, Rockville Md.) sell with the BAC-to-BAC test kit.This system uses the transfer vector PFASTBAC (LifeTechnologies) that contains the Tn7 transposon, and the DNA of its mobile coding desired polypeptides enters the baculovirus genome of the big plasmid that is maintained at colibacillary being called as " baculovirus shuttle vectors ".See Hill-Perkins and Possee, J.Gen.Virol.71:971 (1990), Bonning waits the people, J.Gen.Virol.75:1551 (1994), and Chazenbalk and Rapoport, J.Biol.Chem.270:1543 (1995).In addition, transfer vector can comprise that the DNA with the epi-position mark of the C-of the expressed polypeptide of coding and N-end meets the fusion of frame ground, for example Glu-Glu epi-position mark people such as (, Proc.Nat ' lAcad.Sci.82:7952 (1985)) Grussenmeyer.Use the transfer vector conversion that technology known in the art will contain goal gene to enter intestinal bacteria, and screening contain the baculovirus shuttle vectors of the interruption lacZ gene that shows recombinant baculovirus.Use routine techniques to separate the described genomic baculovirus shuttle vectors of the recombinant baculovirus DNA that contains subsequently.Use described recombinant virus or baculovirus shuttle vectors transfection host cell.Suitable insect host cell comprises the clone (ovary cell line of the greedy noctuid pupa in a kind of meadow) from IPLB-Sf-21, as Sf9 (ATCC CRL 1711), Sf21AE and Sf21 (Invitrogen Corporation; San Diego, Calif.), and fruit bat Schneider-2 cell and from the HIGH FIVEO clone (Invitrogen) of cabbage looper (U.S. Patent number 5300435).Can use by the obtainable serum-free culture basal growth of commercial sources and keep described cell.Suitable medium is Sf900 IITM (Life Technologies) or the ESF 921TM (Expression Systems) that is used for the Sf9 cell; With the Ex-cellO405 that is used for the cabbage looper cell ^TM(JRH Biosciences, Lenexa, Kans.) or Express FiveO ^TM((LifeTechnologies).When using recombinant virus, cell is usually from about 2-5 * 10 ⁵Individual cell is to being 1-2 * 10 ⁶The growth of the inoculum density cell of individual cell, add infection multiplicity this moment is 0.1 to 10, more generally near 3 recombinant virus original seed.Be provided for rhabdovirus system the technology of setting up people such as Bailey are arranged, " Manipulation of Baculovirus Vectors; " in Methods in MolecularBiology, Volume 7:Gene Transfer and Expression Protocols, Murray (editor), 147-168 page or leaf (The Humana Press, Inc.1991), by people such as Patel, " Thebaculovirus expression system; " in DNA Cloning 2:Expression Systems, 2nd Edition, people such as Glover (editor), 205-244 page or leaf (Oxford University Press 1995), by Ausubel (1995) at 16-37 to the 16-57 page or leaf, Richardson (editor), BaculovirusExpression Protocols (The Humana Press, Inc.1995), with by Lucknow, " Insect Cell Expression Technology; " in Protein Engineering:Principlesand Practice, people such as Cleland (editor), 183-218 page or leaf (John Wiley﹠amp; Sons, Inc.1996).

The fungal cell comprises yeast cell, also can be used as with multiple expression constructs transformed host cells of the present invention.In this, the yeast species of specific purpose comprises yeast saccharomyces cerevisiae, pichia pastoris phaff and pichia methanolica (Pichia methanolica).Be suitable in yeast expression promoter and comprise promotor from GAL1 (semi-lactosi), PGK (phosphoglyceric kinase), ADH (alcoholdehydrogenase), AOX1 (alcohol oxidase), HIS4 (histidinol dehydrogenase) etc.Existing many yeast clone carriers be designed and can be easy to obtain with, as inserting sheet receptor seq (carrier donor) molecule to derive as underlying carrier.These carriers comprise the carrier based on YIp, as YIp5; The YRp carrier is as YRp17; The YEp carrier is as YEp13 and YCp carrier, as YCp19.Be disclosed in foreign DNA transformed saccharomyces cerevisiae cell and the method that therefrom produces recombinant polypeptide, for example US4599311, US4931373, US4870008, US5037743 and US4845075.By selective marker, normally the Phenotypic Selection of the ability decision of drug resistance or growth when lacking specific nutrition thing (as leucine) is by cell transformed.The illustrative carrier system that uses in yeast saccharomyces cerevisiae is POTI carrier system (US4931373), and it allows cell transformed to select by growing in containing the substratum of glucose.Promotor that is suitable for using in yeast in addition and terminator comprise the promotor and the terminator of glycolytic ferment gene (seeing, as US4599311, US4615974 and US4977092) and alcohol dehydrogenase gene.See US4990446,5063154,5139936 and 4661454.

Other yeast comprises that the conversion system of multiple-shaped nuohan inferior yeast (Hansenula polymorpha), schizosaccharomyces pombe (Schizosaccharomyces pombe), Kluyveromyces lactis (Kluyveromyces lactis), Kluyveromyces fragilis (Kluyveromyces fragilis), Ustilago maydis (Ustilago maydis), pichia pastoris phaff, pichia methanolica, Pichia guilliermondii (Pichia guillermondii) and maltose candiyeast (Candida maltosa) is well known in the art.See people such as Gleeson for example, J.Gen.Microbiol.132:3459 (1986) and US4882279.Can use the aspergillus cell according to people's such as McKnight (US4935349) method.The method (US5162228) that transforms Acremonium chrysogenum is disclosed.The method (US4486533) of conversion neurospora (Neurospora) is disclosed.

For example, purposes (US5716808, the US5736383 of pichia methanolica as the host who produces recombinant protein disclosed, people such as Raymond, Yeast 14:11-23 (1998), WO97/17450, WO 97/17451, WO 98/02536 and WO 98/02565).The dna molecular that is used to transform pichia methanolica is used as two strands, cyclic plasmid preparation usually, before conversion preferably with its linearizing.In order to produce polypeptide in pichia methanolica, promotor in the plasmid and terminator can be the promotor and the terminators of pichia methanolica gene, utilize gene (AUG1 or AUG2) as pichia methanolica alcohol.Other useful promotor comprises the promotor of Protosol synthase (DHAS), hydrogenlyase (FMD) and catalase (CAT) gene.In order to promote DNA to be integrated into host chromosome, the segmental flank of the complete expression two ends of preferred plasmid are the host DNA sequence.For wishing that methyl alcohol uses minimum large-scale industry process, can use two methyl alcohol of disappearance to utilize the host cell of gene (AUG1 and AUG2).In order to produce excretory protein, use the host cell of vacuole protein enzyme gene (PEP4 and PRB1) defective.Use electroporation to import the pichia methanolica cell to impel the plasmid that to contain the DNA of the desired polypeptides of encoding.Can use the pulsed electrical field of exponential attenuation to transform the pichia methanolica cell by electroporation, the field intensity of described electric field is 2.5 to 4.5kV/cm, preferably about 3.75kV/cm, and time constant (t) is 1 to 40 millisecond, most preferably from about 20 milliseconds.

The standard method that nucleic acid molecule is imported bacterium, yeast, insect, Mammals and vegetable cell is provided by for example Ausubel (1995).The general method method of expressing and reclaiming the exogenous protein that is produced by the mammal cell line system is by for example, Etcheverry, " Expression of EngineeredProteins in Mammalian Cell Culture; " in Protein Engineering:Principlesand Practice, people such as Cleland (editor), 163 pages (Wiley-Liss Inc.1996) is provided.Be used for method of having set up such as Richardson (editor) from rhabdovirus system separating recombinant proteins matter, and Baculovirus Expression Protocols (The Humana Press, Inc.1995) described.

Especially preferably shift multiple expression constructs and enter vegetable cell, tissue and/or biology.The method that importing transgene expression construct or carrier enter plant tissue can include but not limited to, as Electricinjection (people (1995) In such as Nan " Biotechnology in Agriculture and Forestry; " Ed.Y.P.S.Bajaj, Springer-Verlag Berlin Heidelberg, Vol 34:145-155; Griesbach (1992) Hort.Science 27:620); Merge with the corpusculum on liposome, lysosome, cell, minicell or other the lipid-surface that can merge people (1982) Proc.Natl. Acad.Sci.USA 79:1859-1863 such as () Fraley; Polyoxyethylene glycol (people (1982) Nature 296:72-74 such as Krens); Increase is to the chemical of dissociative DNA picked-up; Use the conversion of virus etc.In addition, can use biological projectile method, electroporation, dried embryo of incubation and the microinjection in containing the solution of DNA that utilizes particle gun.

Can use method (as being used for paddy rice), wherein by liposome, PEG or electroporation (people (1989) Nature 338:274-276 such as Shimamoto based on protoplastis; People such as Datta (1990b) Bio/Technology 8:736-740) DNA is delivered to protoplastis.Conversion by electroporation relates to uses short, high voltage electric field to produce " hole " at cytolemma, is taken in DNA by this hole.These methods for example are used to produce monocotyledons (people (1984) the EMBO J 3:2717-2722 such as Paszkowski of stable conversion; People such as Shillito (1985) Bio/Technology, 3:1099-1103; People such as Fromm (1986) Nature 319:791-793) paddy rice (people (1989) Nature 338:274-276 such as Shimamoto particularly; People such as Datta (1990b) Bio/Technology 8:736-740; People such as Hayakawa (1992) Proc Natl Acad Sci USA 89:9865-9869).

Particle bombardment or " biological projectile " are to be widely used in plant, the particularly monocotyledonous method of transforming.In " biological projectile " (DNA of particulate mediation sends) method, the particulate that is coated with DNA is accelerated to by mechanism and is enough to penetrate plant cell wall and nuclear speed (WO 91/02071).Described foreign DNA is integrated into host DNA and produces cell transformed.A lot of alternatives (Sanford (1990) Physiologia Plantarium 79:206-209 is arranged in " biological projectile " method; People such as Fromm (1990) Bio/Technology 8:833-839; People such as Christou (1988) Plant Physiol87:671-674; People such as Sautter (1991) Bio/Technology, 9:1080-1085).This method is used to produce the monocotyledons of stable conversion, comprises paddy rice, corn, wheat, barley and oat (people (1991) Bio/Technology 9:957-962 such as Christou; People such as Gordon-Kamm (1990) Plant Cell 2:603-618; People such as Vasil (1992) Bio/Technology, 10:667-674, Wan and Lemaux (1994) Plant Physiol-104:3748).

Except these " directly " transformation technologies, can also realize transforming by the infectation of bacteria of agrobacterium tumefaciens or Agrobacterium rhizogenes.These bacterial strains contain plasmid (Ti or Ri plasmid), and it is accompanied by agroinfection and transfers in the plant.The part that is called as this plasmid of T-DNA (transfer DNA) is integrated into the genome of vegetable cell (seeing above description to carrier).For transfer DNA enters vegetable cell, plant explants and genetically modified agrobacterium tumefaciens or Agrobacterium rhizogenes are cultivated altogether.From vegetable material (for example leaf, root or stem section, and the suspension of protoplastis or the vegetable cell) beginning of infecting, can use suitable medium to produce complete plant, described substratum for example contains microbiotic or sterilant is selected cell transformed.Can in the plant that obtains, screen the plant that has the DNA (finger in the case) that imports subsequently according to expression construct of the present invention.In case DNA has been be integrated into host genome, described genotype is normally stable, and described insertion fragment is also found in the generation subsequently.Usually, the expression construct of integration comprises selective marker, and it gives the resistance of plant transformed at biocide (as weedicide) or microbiotic such as kantlex, G418, bleomycin, Totomycin or phosphinothricin etc.Described selective marker makes never and selects cell transformed (McCormick 1986) in the cell transformed.The plant that obtains can be cultivated and hybridize in a usual manner.Should grow two or more generations to guarantee that genomic integration is stable and heritable.

Aforesaid method has been described (for example, at people (1993) Techniques for GeneTransfer such as Jenes B, in:Recombinant Plants, Vol.1, Engineering and Utilization, SD Kung and R Wu edit, Academic Press, the 128-143 page or leaf; And Potrykus (1991) Ann Rev Plant Physiol Plant Mol Biol 42:205-225)

Skilled in the art will recognize that and to use the multiple currently known methods of this area to improve the transformation efficiency of Agrobacterium.For example, shown that natural wound is replied molecule such as Syringylethanone (AS) adds transformation efficiency people (1987) Plant Mole.Biol.8:291-298 such as () Shahla that the Agrobacterium culture can increase agrobacterium tumefaciens.Alternatively, can increase transformation efficiency by the target tissue that wound will transform.The wound of plant tissue can by for example bore a hole, soften, realization (seeing) such as microparticle bombardment as people such as Bidney (1992) Plant Molec.Biol.18:301-313.

Reported that many other methods that are used to transform plant (particularly monocotyledons) comprise, for example " pollen tube method " (WO 93/18168; Luo and Wu (1988) Plant Mol.Biol.Rep.6:165-174), large-scale injection DNA enters floral tube (noral tiller) (people (1989) GenetManip Plants 5:8-12 such as Du; People (1987) Nature 325:274-276 such as de la Pena), the injection Agrobacterium enters the caryopsis (WO 00/63398) of growth and seed and organize incubation people (1989) Plant Cell 1:133-139 such as () Topfer in dna solution.WO 94/00583 discloses the plant ovule that foreign DNA is injected directly into fertilization when embryonic development begins.WO 97/48814 discloses the callus that can educate method of wheat and produce based on immature embryo fresh separated or pre-incubated, embryo by Agrobacterium of stable conversion and the system of suspension cell transformed wheat of producing.

May wish the fixed specific gene seat of purpose nucleotide sequence target to Plant Genome.Can pass through, for example use the sequence be derived from Agrobacterium by homologous recombination for example with the site-directed vegetable cell genome that is incorporated into of purpose nucleotide sequence.Usually, with vegetable cell and the agrobacterium strains incubation that contains the target-seeking carrier, in the described carrier with the target gene seat in dna sequence dna homologous sequence flank be Agrobacterium transfer DNA (T-DNA) sequence, (US5501967, its complete content is incorporated herein by reference herein) as previously mentioned.Skilled in the art will recognize that and to use the target-seeking carrier that contains with any part (regulatory element that belongs to gene, or the coding region of gene) the homologous sequence of the fixed plant gene of target can realize homologous recombination.As long as treat that the nucleotide sequence of the site flank region that target is fixed is known, just can realize homologous recombination in any zone of plant gene.

When wishing homologous recombination, used target-seeking carrier can be (the US5501967 of displacement or insert type; Above-mentioned).Replacement vector contains two zones usually, and fixed genome sequence homology and its side of itself and target has one section heterologous nucleic acid sequence, as the selectable marker gene sequence.Replacement vector causes the insertion of selectable marker gene, and described marker gene is destroyed the fixed gene of institute's target.Insertional vector contains with the one zone of target gene homologous and makes whole target-seeking carrier insert target gene.

If selective marker is the part of the DNA of importing, so never select cell transformed in the cell transformed, promptly those contain the cell of the DNA that imports that is integrated into host cell DNA.Selectable marker gene can be given the plus or minus selectivity.

Can in construct, use positive selectable marker gene to be used for random integration and site-directed integration.Positive selectable marker gene comprises antibiotics resistance gene and herbicide resistance gene etc.The transformant of expressing such marker gene can be survived under microbiotic that will kill no transformed cells or weedicide concentration.Example is as giving weedicide phosphinothricin (bialaphos; People such as Vasil (1992) Bio/Technology, 10:667-674; People such as Weeks (1993) Plant Physiol102:1077-1084; People such as Rathore (1993) Plant Mol Biol 21 (5): 871-884) the bar gene of resistance, give nptII gene to kalamycin resistance, give the hpt gene of hygromycin resistance or give EPSP gene the herbicide glyphosate resistance, Geneticin (G418) (aminoglycoside) (people (1994) Plant such as Nehra J.5:285-297), glyphosate (people (1987) Bio/Technology 5:579-584 such as Della-Cioppa) and als gene (chlorsulphuron resistance).More preferred marker gene selectable and that can screen are above disclosing.

In construct, also can contain negative selectable marker gene.Preferably use one or more negative selectable marker genes and the just combination of selectable marker gene at the construct that is used for homologous recombination.Negative selectable marker gene is placed in outside the zone that relates to the homologous recombination incident usually.Negative selectable marker gene provides disadvantage (preferred lethality) in effable mode to the genomic cell of these gene integrations being gone into they.The target-seeking carrier random integration that wherein is used for homologous recombination is gone into genomic cell and will be injured or kill owing to there being negative selectable marker gene.When comprising positive selectable marker gene in the construct, have only those cells to survive in the positive selective marker of its genome conformity.As long as negative selectable marker is encoded in the plant transformed cell polypeptide of function is arranged, for the present invention, selecting of negative selectable marker is not crucial.For example, negative select gene can be selected from aux-2 gene from Agrobacterium Ti-plasmid, from the tk gene of SV40, from the Cytochrome P450 of light gray streptomycete (streptomyces griseolus), from the Adh gene of corn or Arabidopis thaliana etc.Can use the coding can be with the gene that the harmless material of vegetable cell is converted into to the enzyme of the deleterious material of vegetable cell.Other preferred negative selectable markers are above open.

Yet, expression cassette or carrier can also prove and analyze to the insertion of chromosomal DNA by many other methods known in the art (not being based on selective marker), described method comprises, but be not limited to the restriction mapping of genomic dna, pcr analysis, DNA-DNA hybridization, DNA-RNA hybridization, dna sequence analysis etc.More particularly, these class methods can comprise, as pcr analysis, southern blotting technique analysis, fluorescence in situ hybridization (FISH) and original position PCR.

In case produce the plant transformed cell, can the known method of use technology personnel obtain complete plant.Therefore, the invention provides transgenic plant.The plant of the purpose nucleotide sequence under the promoter sequence control that each and all cells all be expressed in this paper and provided is provided therein transgenic plant of the present invention.Comprise in scope of the present invention and to comprise at least one plant of expressing the cell of purpose nucleotide sequence (as, chimeric plant).Preferably, but not necessarily, described transgenic plant are at more than one cell with more preferably contain the purpose nucleotide sequence in one or more tissues.

In case obtained to contain the transgenic plant tissue of expression vector, can use means known in the art from these transgenic plant tissue regeneration transgenic plant.Term as used herein " regeneration " mean from a vegetable cell, one group of vegetable cell, plant part or plant piece (as, from protoplastis, callus, the similar corpusculum of protocorm or tissue part) grow up to complete plant.

The species that following plants belongs to can be from the protoplast regeneration that transforms: Fragaria (Fragaria), Lotus (lotus), Medicago (Medicago), donkey food Macroptilium (Onobrychis), Clover (Trifolium), Semen Trigonellae belongs to (Trugonella), Vigna (Vigna), both citrus (Citrus), linum (Linum), Geranium (Geranium), cassava (Manihot), Trigonella (Daucus), mouse ear mustard belongs to (Arabidopsis), Btassica (Brassica), Rhaphanus (Raphanus), sinapsis alba belongs to (Sinapis), Atropa (Atropa), Capsicum, poison tobacco (Hyoscyamus), tomato belongs to, Nicotiana (Nicotiana), Solanum, green winter Solanum (Petunia), Digitalis (Digitalis), Majorana, Ciohorium, Helianthus (Helianthus), Lactuca (Lactuca), Brome (Bromus), Asparagus (Asparagus), antirrhinum (Antirrhinum), Hererocallis, Nemesia, Pelargonium (Pelargonium), millet belongs to (Panicum), Pennisetum (Pennisetum), Ranunculus (Ranunculus), Senecio (Senecio), Salpiglossis, Cucumis (Cucumis), Browaalia, Glycine (Glycine), Pisum (Pisum), lolium (Lolium), Zea (Zea), Triticum (Triticum), jowar belongs to (Sorghum) and Datura (Datura).

For from genetically modified protoplast regeneration transgenic plant, at first provide conversion protoplastis suspension or contain the culture dish of the explant of conversion.Form callus tissue and can also take root subsequently from the callus induction branch.Alternatively, can be in callus the formation of inductor somatic embryo.These somatic embryos are sprouted as natural embryo and are formed plant.Substratum contains multiple amino acids and plant hormone usually, as plant hormone and phytokinin.Add L-glutamic acid and proline(Pro) also is favourable to substratum, especially for those as for the species of corn and clover.Effectively regeneration will depend on substratum, genotype and cultivation history.Can control these three variablees to produce repeatably regeneration by experience.

Can also be from cultured cells or tissue regeneration plant.Shown that the dicotyledons that can obtain complete transgenic plant from the individual cells regeneration that transforms comprises, for example, apple (Malus pumila), blackberry, blueberry (rubus (Rubus)), blackberry, blueberry/rasp berry hybrid (rubus), raspberry (rubus), Radix Dauci Sativae (Daucus carota), Cauliflower (wild cabbage (Brassica oleracea)), celery (Apiumgraveolens), cucumber (Cucumis sativus), eggplant (Solanum melongena), lettuce (Lactuca sativa), potato (Solanum tuberosum), rape (colea (Brassicanapus)), wild soybean (Glycine canescens), strawberry (Fragaria ananassa), tomato (Lycopersicon esculentum), English walnut (Juglans regia), melon (muskmelon (Cucumis melo)), grape (Vitis vinifera) and mango (Mangifera indica).Shown that the monocotyledons that can obtain complete transgenic plant from the individual cells regeneration that transforms comprises, for example, rice (Oryza sativa), rye (Secale cereale) and corn (Zea mays).

In addition, in following plants, observed from the complete plant of cell (the unnecessary conversion) regeneration: apricot (Prunus armeniaca), asparagus (Asparagus officinalis), banana (hybrid Musa), beans (Phaseolus vulgaris), cherry (hybrid Prunus), grape, mango, melon (Cucumismelo), ochra (coffee ambrette (Abelmoschus esculentus)), onion (hybrid Allium), orange (sweet orange (Citrus sinensis)), papaya (Carrica papaya), peach (Prunus persica), Lee (European Lee (Prunus domestica)), pears (European pear (Pyrus communis)), pineapple (pineapple (Ananas comosus)), watermelon (Citrullus vulgaris) and wheat (common wheat (Triticumaestivum)).

The regenerated plant is transferred to the edaphic condition of standard and cultivation in a usual manner.Expression vector be stabilized be integrated into the regenerated transgenic plant after, it can transfer to other plant by vegetative propagation or by sexual hybridization.For example, in vegetative farm crop, produce a plurality of identical plants by cuttage or tissue culture technique and breed sophisticated transgenic plant.In the farm crop of seminal propagation, sophisticated transgenic plant selfing can be transmitted the inbreeding plant of isozygotying of transgenosis to its filial generation according to Mendelian inheritance to produce.The inbreeding plant produces the seed that contains the purpose nucleotide sequence.These seeds can be grown and be produced the plant with selected phenotype.Can also hybridize by inbreeding plant and another inbreeding plant hybridization and develop new hybrid.

Can verify that conversion is to confirm the transgenosis characteristic of cell, tissue and plant by pcr analysis, microbiotic or Herbicid resistant, enzymatic analysis and/or southern blotting technique.Whether can obtain the filial generation of aftergrowth and analyze with the checking transgenosis is heritable.Genetically modified inheritability is proof genetically modified stable conversion in plant further.The plant that produces can be used the usual manner breeding.Can grow two or more generations to guarantee that genomic integration is stable and heritable.Corresponding method is described (people (1993) Techniques for Gene Transfer such as Jenes B, in:Recombinant Plants, Vol.1, Engineering and Utilization, SD Kung and R Wu edit, Academic Press, 128-143 page or leaf; Potrykus (1991) Ann Rev PlantPhysiol Plant Mol Biol 42:205-225).

Also according to the invention provides cell from above-mentioned genetically modified organism, cell culture, tissue, partly, organ (for example being root, leaf etc.) and rotaring gene breeding material such as seed or fruit for transgenic plant are biological.

Another embodiment of the present invention relates to the method that produces grain or feeds product, medicine or chemical, described method comprises provides transgenic cell or the biology that comprises multiple expression constructs of the present invention, grow described cell or biological and, randomly, separate described grain or feeds product, medicine or chemical.

Can be also passable by the plant that the human or animal consumes according to genetic modification of the present invention, for example directly or by known method own be used as grain or feed.

Another theme of the present invention relate to according to above-mentioned genetically modified organism of the present invention and be derived from its cell, cell culture, partly, tissue, organ (for example being root, leaf etc.) and rotaring gene breeding material (as seed or the fruit) purposes that is used to produce grain or feed, medicine or fine chemicals for transgenic plant are biological.

Also preferred the reorganization in host living beings produces the method for medicine or fine chemicals, use a kind of above-mentioned expression construct to transform host living beings in the method, and this expression construct comprise the biosynthetic structure gene of one or more encode desirable fine chemicals or the desirable fine chemicals of catalysis; Cultivation host transformed biology; And separate desirable fine chemicals from substratum.Described method can be widely used in fine chemicals such as enzyme, VITAMIN, amino acid, sugar, lipid acid, natural and synthetic spices, aromatoising substance and tinting material.Especially preferably produce tocopherol and tocotrienols (tocotrienol), carotenoid, oil, polyunsaturated fatty acid etc.Separate by method cultivation host transformed biology known to the skilled and from host living beings or substratum.For example antibody, vaccine, enzyme or existing (Hood and Jilka (1999) the CurrOpin Biotechnol.10 (4): 382-6 of description of proteinic drug manufacture of pharmaceutical active is arranged; Ma and Vine (1999) Curr Top Microbiol.Immunol.236:275-92; Russel (1999) Current Topics in Microbiology andImmunology 240:119-138; People such as Cramer (1999) Current Topics inMicrobiology and Immunology 240:95-118; Gavilondo and Larrick (2000) Biotechniques 29 (1): 128-138; Holliger and Bohlen (1999) Cancer﹠amp; Metastasis Reviews 18 (4): 411-419).

Those of ordinary skill in the related art it should be understood that obviously, can make other suitable modification and reorganization to methods and applications as herein described and do not deviate from the scope of the present invention or its any embodiment.Now the present invention has been made detailed description, will more be expressly understood the present invention by reference the following example, described embodiment only is intended to that the present invention will be described and is non-limiting.

Sequence

1.SEQ ID NO:1 recombination site m-att

5’-RKYCWGCTTTYKTRTACNAASTSGB-3’

2.SEQ ID NO:2 recombination site m-attB

5’-AGCCWGCTTTYKTRTACNAACTSGB-3’

3.SEQ ID NO:3 recombination site m-attR

5’-GTTCAGCTTTCKTRTACNAACTSGB-3’

4.SEQ ID NO:4 recombination site m-attL

5’-AGCCWGCTTTCKTRTACNAAGTSGB-3’

5.SEQ ID NO:5 recombination site m-attP1

5’-GTTCAGCTTTYKTRTACNAAGTSGB-3’

6.SEQ ID NO:6 recombination site attB1

5’-AGCCTGCTTTTTTGTACAAACTTGT-3’

7.SEQ ID NO:7 recombination site attB2

5’-AGCCTGCTTTCTTGTACAAACTTGT-3’

8.SEQ ID NO:8 recombination site attB3

5’-ACCCAGCTTTCTTGTACAAACTTGT-3’

9.SEQ ID NO:9 recombination site attR1

5’-GTTCAGCTTTTTTGTACAAACTTGT-3’

10.SEQ ID NO:10 recombination site attR2

5’-GTTCAGCTTTCTTGTACAAACTTGT-3’

11.SEQ ID NO:11 recombination site attR3

5’-GTTCAGCTTTCTTGTACAAAGTTGG-3’

12.SEQ ID NO:12 recombination site attL1

5’-AGCCTGCTTTTTTGTACAAAGTTGG-3’

13.SEQ ID NO:13 recombination site attL2

5’-AGCCTGCTTTCTTGTACAAAGTTGG-3’

14.SEQ ID NO:14 recombination site attL3

5’-ACCCAGCTTTCTTGTACAAAGTTGG-3’

15.SEQ ID NO:15 recombination site attP1

5’-GTTCAGCTTTTTTGTACAAAGTTGG-3’

16.SEQ ID NO:16 recombination site attP2, P3

5’-GTTCAGCTTTCTTGTACAAAGTTGG-3’

17.SEQ ID NO:17: the oligonucleotide Loy344 of phosphorylation

5’-p-GTCGACCAGATCTGATATCTGCGGCCGCCTCGAGCATATG-3’

18.SEQ ID NO:18: the oligonucleotide Loy345 of phosphorylation

5’-p-GTCGACCAGATCTGATATCTGCGGCCGCCTCGAGCATATG-3’

19.SEQ the double-stranded padding sequence (stuffer out) of ID NO:19 intestinal bacteria hisA gene

5’-ccggtgcaggttggcggcggcgtgcgtagcgaaga-3’

20.SEQ ID NO:20 Oligonucleolide primers Loy 413-attB4 ^*Fwd-a

5’-GGGGACAACTTTGTATAGAAAAGTTGGGTACCCGGGGATCCTCTA-3’

21.SEQ ID NO:21 Oligonucleolide primers Loy 414-attB1 ^*Rev-a

5’-GGGGACTGCTTTTTTGTACAAACTTGCCATGATTACGCCAAGCTTGCA-3’

22.SEQ ID NO:22 Oligonucleolide primers Loy447-a " B4 ^*Fwd-a-inv

5’-GGGGACAACTTTGTATAGAAAAGTTGCCATGATTACGCCAAGCTTGCA-3’

23.SEQ ID NO:23 Oligonucleolide primers Loy448-attB1 ^*Rev-a-inv

5’-GGGGACTGCTTTTTTGTACAAACTTGGGTACCCGGGGATCCTCTA-3’

24.SEQ ID NO:24 Oligonucleolide primers Loy415-attB1 ^*-fwd-b

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGTACCCGGGGATCCTCTA-3’

25.SEQ ID NO:25 Oligonucleolide primers Loy416-attB2 ^*Rev-b

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCATGATTACGCCAAGC-TTGCA-3’

26.SEQ ID NO:26 Oligonucleolide primers Loy449-attB1 ^*Fwd-b-inv

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGATTACGCCAAGC-TTGCA-3’

27.SEQ ID NO:27 Oligonucleolide primers Loy450-attB2 ^*Rev-b-inv

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGGTACCCGGGGATCCTCTA-3’

28.SEQ ID NO:28 Oligonucleolide primers Loy417-attB2 ^*Fwd-c

5’-GGGGACAGCTTTCTTGTACAAAGTGGGGTACCCGGGGATCCTCTA-3’

29.SEQ ID NO:29 Oligonucleolide primers Loy418-attB3 ^*Rev-c

5’-GGGGACAACTTTGTATAATAAAGTTGCCATGATTACGCCAAGCTTGCA-3’

30.SEQ ID NO:30 Oligonucleolide primers Loy451-attB2 ^*Fwd-c-inv

5’-GGGGACAGCTTTCTTGTACAAAGTGGCCATGATTACGCCAAGCTTGCA-3’

31.SEQ ID NO:31 Oligonucleolide primers Loy452-attB3 ^*Rev-c-inv

5’-GGGGACAACTTTGTATAATAAAGTTGGGTACCCGGGGATCCTCTA-3’

32.SEQ ID NO:32 inserts fragment donor molecule carrier Lo391-pENTR-A1

33.SEQ ID NO:33 inserts fragment donor molecule carrier Lo392-pENTR-B1

34.SEQ ID NO:34 inserts fragment donor molecule carrier Lo393-pENTR-C1

35.SEQ ID NO:35 inserts fragment donor molecule carrier Lo394-pENTR-A1-inv

36.SEQ ID NO:36 inserts fragment donor molecule carrier Lo395-pENTR-B1-inv

37.SEQ ID NO:37 inserts fragment donor molecule carrier Lo396-pENTR-C1-inv

38.SEQ ID NO:38 inserts fragment donor molecule carrier Lo375-pENTR-A2

39.SEQ ID NO:39 inserts fragment donor molecule carrier Lo376-pENTR-B2

40.SEQ ID NO:40 inserts fragment donor molecule carrier Lo377-pENTR-C2

41.SEQ ID NO:41 inserts fragment donor molecule carrier Lo397-pENTR-A2-inv

42.SEQ ID NO:42 inserts fragment donor molecule carrier Lo398-pENTR-B2-inv

43.SEQ ID NO:43 inserts fragment donor molecule carrier Lo399-pENTR-C2-inv

44.SEQ ID NO:44 inserts fragment donor molecule pENTR-A-USP ∷ NAN ∷ A7t

45.SEQ ID NO:45 inserts fragment donor molecule pENTR-B-L1-LuFad3-GUS-E9-L2

46.SEQ ID NO:46 inserts the fragment donor molecule

pENTR-C-R2-LeB4-700∷GFP∷LeB3t-L3

47.SEQ ID NO:47 Oligonucleolide primers Loy277 attR4 EcoRV

5′-AAAAAAGATATCGATTACGCCAAGCTATCAACT-3’

48.SEQ ID NO:48 Oligonucleolide primers Loy278 attR3 EcoRV

5′-AAAAAAGATATCCGGCCAGTGAATTATCAACT-3’

49.SEQ ID NO:49 inserts sheet receptor seq (carrier donor) molecular vehicle Lo338-pSUN2-GW-R4R3

50.SEQ ID NO:50 inserts sheet receptor seq (carrier donor) molecular vehicle Lo339-pSUN2-GW-R3R4

51.SEQ ID NO:51 multiple expression constructs

pSUN2-B4-USP-NAN-pa7-E9-GUS-FAD3-LeB4-GFP-LeB3

52.SEQ ID NO:52 recombination site attB1 ^*

5’-AGCCTGCTTTTTTGTACAAACTTGC-3’

53.SEQ ID NO:53 recombination site attB2 ^*

5’-ACCCAGCTTTCTTGTACAAAGTGGC

54.SEQ ID NO:54 recombination site attB3 ^*

5’-CAACTTTATTATACATAGTTG-3’

55.SEQ ID NO:55 recombination site attB4 ^*

5’-CAACTTTTCTATACAAAGTTG-3’

56.SEQ ID NO:56 recombination site attR1 ^*

5’-GTTCAACTTTTTTGTACAAACTTGC-3’

57.SEQ ID NO:57 recombination site attR2 ^*

5’-TTCAACTTTCTTGTACAAAGTGGG-3’

58.SEQ ID NO:58 recombination site attR3 ^*

5’-GTTCAACTTTATTATACATAGTTGA-3’

59.SEQ ID NO:59 recombination site attR4 ^*

5’-GTTCAACTTTTCTATACAAAGTTGA-3 ^*

60.SEQ ID NO:60 recombination site attL1 ^*

5’-AGCCTGCTTTTTTGTACAAAGTTGG-3’

61.SEQ ID NO:61 recombination site attL2 ^*

5’-ACCCAGCTTTCTTGTACAAAGTTGG-3’

62.SEQ ID NO:62 recombination site attL3 ^*

5’-GGCAACTTTATTATACAAAGTTGG-3’

63.SEQ ID NO:63 recombination site attL4 ^*

5’-ACCCAACTTTTCTATACAAAGTTGG-3’

64.SEQ ID NO:64 recombination site attP1 ^*

5’-GTTCAACTTTTTTGTACAAAGTTGG-3’

65.SEQ ID NO:65 recombination site attP2 ^*

5’-GTTCAGCTTTCTTGTACAAAGTTGG-3’

66.SEQ ID NO:66 recombination site attP3 ^*

5’-GTTCAACTTTATTATACAAAGTTGG-3’

67.SEQ ID NO:67 recombination site attP4 ^*

5’-GTTCAACTTTTCTATACAAAGTTGG-3’

The accompanying drawing summary

The abbreviation implication is as follows among the figure:

AadA spectinomycin/streptomycin resistance gene

CcdB:DNA gyrase supressor (anti-selective marker)

ColE1: replication orgin

GUS: β-glucuronidase (GUS) reporter gene

LeB3 ' UT:LeB-3 ' UT transcription terminator

LB/RB: the left side of agrobatcerium T-DNA (LB) and right (RB) edge

The nan:Nan reporter gene

The nosP:nos promotor

The nosT:nos transcription terminator

The nptII:nptII kalamycin resistance gene

PA7T:35S transcription terminator pA7

RbcS E9 T:rbcS (RUBISCO small subunit) E9 transcription terminator

RrnBT1, rrnT2: transcription terminator

Recombination site with the initial name of att (as attP2 ^*, attP1R ^*, attP3 ^*, attP2R ^*, attL4 ^*, attR1 ^*, attL4 ^*, attL1 ^*, attL2 ^*, allR2 ^*, attL3 ^*, attL4 ^*, attR1 ^*Deng).

Figure 1A+B: modified pDONR carrier LO351-pDONR221-mod (I),

The plasmid map of LO348-pDONR-P4-P1R-mod (II) and LO347-pDON-P2R-P3-mod (III).

The plasmid map of Fig. 2 A+B:pENTR carrier LO391-pENTR-A1 (I), LO392-pENTR-B1 (II) and LO393-pENTR-C1 (III).

Fig. 3 A+B: the plasmid map that inserts fragment donor molecule carrier pENTR A-L4-USP-NAN-pA7T-R1 (I), pENTR B-L1-E9-GUS-Fad3-L2 (II) and pENTRC-R2-LeB4-GFP-LeB3T-L3 (III).

Fig. 4: the plasmid map that inserts sheet receptor seq (carrier donor) molecular vehicle Lo338-pSUN2-R4R3 (I) and Lo339-pSUN2-R3R4 (II).

Fig. 5: the plasmid map of multiple expression constructs carrier pSUN2-B4-USP-NAN-pA7-E9-GUS-Fad3-LeB4-GFP-LeB3.

Fig. 6: the reaction scheme of the assembling of many expression cassettes of forming by two expression cassettes (forming) by the purpose nucleic acid (N1, N2) under promotor (p1, P2) control.Two are inserted fragment donor molecule (I1 and I2) and insert fragment acceptor molecule (IA with one; Carrier donor=VD) reorganization.Square, trilateral and circular representative not on the same group recombination site (as, lox site or att site).Only white " trilateral " recombination site can be recombinated with grey " trilateral " recombination site, and white " circle " recombination site can be recombinated or the like with grey " circle " site.Insert the sheet receptor seq and preferably contain anti-selective marker (SC; Under promotor P3 control) expression cassette.Reorganization between recombination site causes the disappearance of anti-selective marker.Only insert two expression cassettes simultaneously and cause lacking fully recirculation with the carrier donor molecule.

Fig. 7: the reaction scheme of the assembling of many expression cassettes of forming by three expression cassettes (expression cassette 1,2,3).Insert fragment donor molecule (pENTR1,2,3) and insert fragment acceptor molecule (pSUN GatewayR4R3=carrier donor) reorganization.The recombination site that only on differing molecular, has identical tail number can recombinate each other (as attR1 and attL1, attR2 and attL2 etc.).Preferably, described insertion sheet receptor seq comprises the ccdB expression cassette of anti-selective marker.Reorganization between recombination site causes the disappearance of anti-selective marker.The insertion of only whole three expression cassettes causes lacking completely the recirculation with the carrier donor molecule.

Fig. 8: the scheme in the T-DNA district of multiple expression constructs carrier pSUN2-B4-USP-NAN-pA7-E9-GUS-Fad3-LeB4-GFP-LeB3.Expression cassette is represented with hexagon.

Embodiment

Chemical

Unless otherwise indicated, chemical in the present embodiment and reagent are from Sigma ChemicalCompany (St.Louis, MO), restriction endonuclease is from New England Biolabs (Beverly, MA) or Roche (Indianapolis, IN), oligonucleotide is by MWG Biotech Inc. (High Point, NC) synthetic, other modifying enzyme or the test kit measured about biological chemistry and molecular biology from Clontech (Palo Alto, CA), Pharmacia Biotech (Piscataway, NJ), Promega Corporation (Madison, WI) or Stratagene (La Jolla, CA).The material that is used for cell culture medium from Gibco/BRL (Gaithersburg, MD) or DIFCO (Detroit, MI).As Sambrook (1989) (people (1989) Cold Spring HarborLaboratory Press such as Sambrook; ISBN 0-87969-309-6) the described step of cloning for the purposes of the present invention, for example restriction enzyme cutting, agarose gel electrophoresis, dna fragmentation purifying, nucleic acid to the transfer of nitrocellulose filter and nylon membrane, be connected the sequential analysis of dna fragmentation, transformed into escherichia coli cell, growth bacterium, breeding phage and recombinant DNA.Use ABI laser fluorescence dna sequencing instrument that recombinant DNA molecules is checked order according to the method for Sanger people (1977) Proc Natl Acad Sci USA 74:5463-5467 such as () Sanger.

Damping fluid: in reaction of the present invention, can use multiple known damping fluid.For restriction enzyme, the damping fluid of manufacturer recommendation is used in suggestion.Can find in the literature easily or design alternative damping fluid by this area those skilled in the art.A kind of exemplary damping fluid that is used for lambda integrase comprises 50mM Tris-HCl pH7.5-7.8,70mM KCl, 5mM spermidine, 0.5mM EDTA and 0.25mg/ml bovine serum albumin, and randomly, 10% glycerine.A kind of preferred damping fluid of P1 Cre recombinase comprises 50mM Tris-HCl pH7.5,33mM NaCl, 5mM spermidine and 0.5mg/ml bovine serum albumin.Be well known in the art or can rule of thumb determine to the damping fluid of λ Int other site-specific recombinase similar by the technician with P1 Cre, special under the guidance of above-mentioned damping fluid.

Embodiment 1: agriculture bacillus mediated conversion in dicotyledonous and monocotyledons

1.1: conversion and the regeneration of transgenic arabidopsis (Columbia) plant

In order to produce the transgenic arabidopsis plant, transform agrobacterium tumefaciens (bacterial strain C58C1 pGV2260) with multiple ptxA or SbHRGP3 promotor/GUS vector construction body.Use agrobacterium strains to produce transgenic plant subsequently.For this purpose, with the Agrobacterium bacterium colony of single conversion with 28 ℃, 4mL culture (substratum: the overnight incubation YEB substratum that contains 50 μ g/mL kantlex and 25 μ g/mL Rifampins).Use this culture to be inoculated in identical 400mL substratum subsequently, and overnight incubation (28 ℃, 220rpm (rev/min)) and centrifugal (the GSA rotor, 8000rpm, 20min).Throw out is at infiltration substratum (1/2 MS substratum; 0.5g/L MES, pH5.8; 50g/L sucrose) resuspension in.Suspension is imported vegetation box (Duchefa), and add SILWET L-77 (the seven poly (alkylene oxide) modified methyl trisiloxanes of 100mL; Osi Specialties Inc. is Cat.P030196) to final concentration 0.02%.The vegetation box that 8 to 12 plants will be housed in moisture eliminator was exposed to vacuum 10 to 15 minutes, subsequently automatic ventilation.Repeat this step 2 to 3 time.With being about to whole plant growings in flowerpot with slowly drained soil, and growth under the long day condition (22 to 24 ℃ of day temperatures, night, temperature was 19 ℃; Relative air humidity 65%).Results seed after 6 weeks.

Alternatively, can transform acquisition transgenic arabidopsis plant by root.It is the white rhizome of the plant in 8 weeks that use has advanced age.For this purpose, use 1MS substratum (1% sucrose that remains under the aseptic condition; The 100mg/L inositol; 1.0mg/L VitB1; 0.5mg/L pyridoxol; 0.5mg/L nicotinic acid; 0.5g MES, pH5.7; 0.8% agar) plant in.Root 3 days (1x Gamborg ' the s B5 mediums of on the substratum of callus induction, growing; 2% glucose; 0.5g/L mercaptoethanol; 0.8% agar; 0.5mg/L 2,4-D (2,4 dichloro benzene ethoxyacetic acid); 0.05mg/L phytokinin).0.5cm long undercut sheet is moved into 10 to 20mL liquid callus inducing medium (form as mentioned above, but do not add agar), with the above-mentioned Agrobacterium culture that spends the night of 1mL (28 ℃, in LB, grow under the 200rpm) also jolting 2 minutes of inoculation.After outwelling unnecessary substratum, the root explant is transferred to the callus inducing medium that contains agar, be transferred to subsequently and do not have the callus induction of agar liquid nutrient medium (500mg/L ticarcillin, SmithKline BeechamPharma GmbH, Munich), jolting is cultivated down, and finally transfers to stem inducing culture (5mg/L2-isopentenyl gland purine phosphoric acid salt; 0.15mg/L indole-3-acetic acid; The 50mg/L kantlex; The 500mg/L ticarcillin).After 5 weeks, and after changing 1 or 2 subcultures, the little stem of green is transferred to germination medium (1MS substratum; 1% sucrose; The 100mg/L inositol; 1.0mg/L VitB1; 0.5mg/L pyridoxol; 0.5mg/L nicotinic acid; 0.5g MES, pH5.7; 0.8% agar) also regeneration becomes plant.

1.2: the conversion of crop plants and regeneration

The agriculture bacillus mediated Plant Transformation of use standard conversion and regeneration techniques can also be used to transform purpose (Gelvin and Schilperoort (1995) the Plant Molecular BiologyManual of crop plants, the 2nd edition, Dordrecht:Kluwer Academic Publ.ISBN 0-7923-2731-4; Glick and Thompson (1993) Methods in Plant Molecular Biology andBiotechnology, Boca Raton:CRC Press, ISBN 0-8493-5164-2).

For example, can transform rape (people (1989) PlantCell Reports 8:238-242 such as Moloney by cotyledon or hypocotyl; People (1989) Plant Physiol 91:694-701 such as De Block).Be used to select the antibiotic use of Agrobacterium and plant to depend on binary vector and the agrobacterium strains that is used to transform.Usually use kantlex to carry out the selection of rape as the selective vegetable mark.

For example can use the described technology of people (1994) Plant Cell Report 13:282-285 such as Mlynarova in flax (Linum usitatissimum), to carry out agriculture bacillus mediated transgenosis.

The conversion of soybean can be used, and for example at EP-A10424047 or at EP-A10397687, technology is carried out described in US5376543, the US5169770.

Corn or other monocotyledonous conversion can be used, and for example carry out in technology described in the US5591616.

Use the DNA picked-up of microparticle bombardment, polyoxyethylene glycol mediation or the Plant Transformation by silicon-carbon acid esters (siliconcarbonate) fibre technology as by Freeling and Walbot (1993) " The maizehandbook " ISBN 3-540-97826-7, Springer Verlag New York is described.

Embodiment 2: the generation of inserting fragment donor molecule (pENTR)

The purpose that pENTR described herein makes up be for three independently expression cassette provide and insert fragment donor molecule (shuttle system), described three expression cassettes are imported in the Agrobacterium binary vector of insertion as carrier donor (inserting the sheet receptor seq) as the single insertion fragment of orientation.

Described pENTR enters GATEWAY by the PCR product that end has a specific attached site ^TMThe pDONR of cloning system ^TMThe BP recombining reaction of carrier (Invitrogen) produces.For this purpose, modify pDONR by introducing NotI site, center one group of multiple clone site on every side ^TMCarrier.This makes that not only cDNA can be imported the NotI site can also be cloned into restriction site on every side with 5 ' element and 3 ' element.

2.1 the structure of multiple clone site

The first step is to set up multiple clone site (MCS) on the pUC19 carrier.For this purpose, primer Loy344 and primer Loy345 annealing are produced double-stranded adapter sequence.

Loy344(SEQ ID NO：17)：

5’-p-GTCGACCAGATCTGATATCTGCGGCCGCCTCGAGCATATG-3’

Loy345(SEQ ID NO：18)：

5’-p-GTCGACCAGATCTGATATCTGCGGCCGCCTCGAGCATATG-3’

With XbaI and PstI cutting pUC19 carrier, with the Pfu polysaccharase overhang is changed into flat end, and dephosphorylation.The adapter of phosphorylation is connected to carrier, causes alternately orientation.

-UNE1：KpnI SmaI BamHI NdeI XhoI NotI EcoRV BglII SaH SphI HindIII

-UNE2：KpnI SmaI BamHI SalI BglII EcoRV NotI XhoI NdeI SphI HindIII

The carrier that produces is by difference called after Lo372-pUC-poly joint-UNE1 and Lo373-pUC-poly joint-UNE2.

2.2 the pDONR that provides by Invitrogen ^TMThe modification of carrier

Invitrogen carrier pDONR ^TM-P4P1R, pDONR ^TM221 and pDONR ^TMThe cleavage site of some restriction endonuclease outside the recombination zone of P2RP3 in the carrier framework is removed the clone's step that is beneficial to subsequently: at pDONR ^TM-P4P1R and pDONR ^TMAmong the P2RP3, EcoRV and NotI site be by with the cutting of EcoRV and NotI enzyme, with Pfu polysaccharase flush endization (mending flat), and connection carrier and removing again, finally form pDONR-P4P1R-mod (A) and pDONR-P2RP3-mod (C) respectively.At pDONR ^TMIn 221, by the cutting of EcoRV enzyme, dephosphorylation, and the double-stranded padding sequence of insertion intestinal bacteria hisA-gene (5 '-ccggtgcaggttggcggcggcgtgcgtagcgaaga-3 '; SEQ ID NO:19) removes EcoRV site on the skeleton.The carrier that produces is named as pDONR 221-mod (C).

2.3 the generation of att-PCR-product

For the described new MCS that increases, design PCR primer is to comprise the reorganization attachment site.Lo372-pUC-poly joint-UNE1 and Lo373-pUC-poly joint-UNE2 are carried out the PCR reaction.

2.3.1 the generation of attB-PCR-A product

Lo372-pUC-poly joint-UNE1 and Lo373-pUC-poly joint-UNE2 use following sequence amplification respectively

1) primer Loy413-attB4 ^*Fwd-a and Loy414-attB1 ^*Rev-a

2) Loy447-attB4 ^*Fwd-a-inv and Loy448-attB1 ^*Rev-a-inv

Two kinds of PCR products that produce are recombined into modified pDONR carrier Lo347-pDONR-P2R-P3-mod (A) respectively, obtain four kinds of pENTR carriers shown in the table 1 hereinafter.

Loy413-attB4 ^*fwd-a(SEQ ID NO：20)：

5’-GGGGACAACTTTGTATAGAAAAGTTGGGTACCCGGGGATCCTCTA-3’

Loy414-attB1 ^*rev-a(SEQ ID NO：21)：

5’-GGGGACTGCTTTTTTGTACAAACTTGCCATGATTACGCCAAGCTTGCA-3’

Loy447-attB4 ^*fwd-a-inv(SEQ ID NO：22)

5’-GGGGACAACTTTGTATAGAAAAGTTGCCATGATTACGCCAAGCTTGCA-3’

Loy448-attB1 ^*rev-a-inv(SEQ ID NO：23)：

5’-GGGGACTGCTTTTTTGTACAAACTTGGGTACCCGGGGATCCTCTA-3’

2.3.2 the generation of attB-PCR-B product:

Lo372-pUC-poly joint-UNE1 and Lo373-pUC-poly joint-UNE2 are used following primer amplification respectively

1) primer Loy415-attB1 ^*-fwd-b and Loy416-attB2rev-b

2) primer Loy449-attB1 ^*Fwd-b-inv and Loy450-attB2rev-b-inv

Two kinds of PCR products that produce are recombined into the pDONR carrier Lo351-pDONR221-mod (B) of modification respectively, obtain four kinds of pENTR carriers shown in the table 1 hereinafter.

Loy415-attB1 ^*-fwd-b(SEQ ID NO：24)：

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTGGTACCCGGGGATCCTCTA-3’

Loy416-attB2 ^*rev-b(SEQ ID NO：25)：

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTCCATGATTACGCCAAGCTTGCA-3’

Primer Loy449-attB1 ^*Fwd-b-inv (SEQ ID NO:26):

5’-GGGGACAAGTTTGTACAAAAAAGCAGGCTCCATGATTACGCCAAGCTTGCA-3’

Loy450-attB2 ^*rev-b-inv(SEQ ID NO：27)：

5’-GGGGACCACTTTGTACAAGAAAGCTGGGTGGTACCCGGGGATCCTCTA-3’

2.3.3 the generation of attB-PCR-C product:

Lo372-pUC-poly joint-UNE1 and Lo373-pUC-poly joint-UNE2 use following primer amplification respectively

3) primer Loy417-attB2 ^*Fwd-c and Loy418-attB3rev-c

4) primer Loy451-attB2 ^*Fwd-c-inv and Loy452-attB3rev-c-inv

Two kinds of PCR products that produce are recombined into the pDONR carrier Lo348-pDONR-P4P1R-mod (C) of modification respectively, obtain four kinds of pENTR carriers shown in the table 1 hereinafter.

Loy417-attB2 ^*fwd-c(SEQ ID NO：28)：

5’-GGGGACAGCTTTCTTGTACAAAGTGGGGTACCCGGGGATCCTCTA-3’

Loy418-attB3 ^*rev-c(SEQ ID NO：29)：

5’-GGGGACAACTTTGTATAATAAAGTTGCCATGATTACGCCAAGCTTGCA-3’

Loy451-attB2 ^*fwd-c-inv(SEQ ID NO：30)：

5’-GGGGACAGCTTTCTTGTACAAAGTGGCCATGATTACGCCAAGCTTGCA-3’

Loy452-attB3 ^*rev-c-inv(SEQ ID NO：31)

5’-GGGGACAACTTTGTATAATAAAGTTGGGTACCCGGGGATCCTCTA-3’

2.4 produce one group of pENTR with new MCS

Be to produce the pENTR carrier, recombinate at as shown in table 1 below modified separately pDONR carrier by the PCR product (comprising flank is the multiple clone site of adhering to the limit, and the described limit of adhering to is used for carrying out the BP reaction with the pDONR carrier of modifying) that obtains in above 2.3.Specification sheets according to manufacturers (Invitrogen) carries out recombining reaction.

The pDONR-carrier

With PCR-product (educt 2)

The pENTR of gained

The site of pENTR

(educt 1)	Reorganization	(product)	Tissue
(educt 1)	Reorganization	(product)	Tissue	Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-UNE1-attB1 ^*-rev-a	Lo391-pENTR- A1 SEQ ID NO： 32	attL4 ^UNE2 attR1 ^
Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-inv-UNE1-att B1 ^*-rev-a-inv	Lo394-pENTR- A1-inv SEQ ID NO： 35	attL4 ^UNE2-inv attR1 ^	Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-UNE1-attB1 ^*-rev-a	Lo391-pENTR- A1 SEQ ID NO： 32	attL4 ^UNE2 attR1 ^
Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-inv-UNE1-att B1 ^*-rev-a-inv	Lo394-pENTR- A1-inv SEQ ID NO： 35	attL4 ^UNE2-inv attR1 ^	Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-UNE2-attB1 ^*-rev-a	Lo375-pENTR- A2 SEQ ID NO： 38	attL4 ^UNE1 attR1 ^
Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-inv-UNE2-att B1 ^*-rev-a-inv	Lo397-pENTR- A2-inv SEQ ID NO： 41	attL4 ^UNE1-inv attR1 ^	Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-UNE2-attB1 ^*-rev-a	Lo375-pENTR- A2 SEQ ID NO： 38	attL4 ^UNE1 attR1 ^
Lo347-pDON R-P2R-P3-mo d(A)	attb4-fwd-a-inv-UNE2-att B1 ^*-rev-a-inv	Lo397-pENTR- A2-inv SEQ ID NO： 41	attL4 ^UNE1-inv attR1 ^	Lo351-pDON R221-mod(B)	attB1-fwd-b-UNE2-attB2 ^*-rev-b	Lo376-pENTR- B2 SEQ ID NO： 39	attL1 ^-UNE2-at tL2 ^
Lo351-pDON R221-mod(B)	attB1-fwd-b-inv-UNE2-att B2 ^*-rev-b-inv	Lo398-pENTR- B2-inv SEQ ID NO： 42	attL1 ^-UNE2-in v-attL2 ^	Lo351-pDON R221-mod(B)	attB1-fwd-b-UNE2-attB2 ^*-rev-b	Lo376-pENTR- B2 SEQ ID NO： 39	attL1 ^-UNE2-at tL2 ^
Lo351-pDON R221-mod(B)	attB1-fwd-b-inv-UNE2-att B2 ^*-rev-b-inv	Lo398-pENTR- B2-inv SEQ ID NO： 42	attL1 ^-UNE2-in v-attL2 ^	Lo351-pDON R221-mod(B)	attB1-fwd-b-UNE1-attB2 ^*-rev-b	Lo392-pENTR- B1 SEQ ID NO： 33	attL1 ^-UNE1-at tL2 ^
Lo351-pDON R221-mod(B)	attB1-fwd-b-inv-UNE1-att B2 ^*-rev-b-inv	Lo395p-ENTR- B1-inv	attL1 ^-UNE1-in v-attL2 ^	Lo351-pDON R221-mod(B)	attB1-fwd-b-UNE1-attB2 ^*-rev-b	Lo392-pENTR- B1 SEQ ID NO： 33	attL1 ^-UNE1-at tL2 ^

		SEQ ID NO： 36
		SEQ ID NO： 36		Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-UNE2-attB3 ^*rev-c	Lo377-pENTR- C2 SEQ ID NO： 40	attR2 ^-UNE2-at tL3 ^
Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-inv-UNE2-att B3 ^*rev-c-inv	Lo399-pENTR- C2-inv SEQ ID NO： 43	attR2 ^-UNE2-in v-attL3 ^	Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-UNE2-attB3 ^*rev-c	Lo377-pENTR- C2 SEQ ID NO： 40	attR2 ^-UNE2-at tL3 ^
Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-inv-UNE2-att B3 ^*rev-c-inv	Lo399-pENTR- C2-inv SEQ ID NO： 43	attR2 ^-UNE2-in v-attL3 ^	Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-UNE1-attB3 ^*rev-c	Lo393-pENTR- C1 SEQ ID NO： 34	attR2 ^-UNE1-at tL3 ^
Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-inv-UNE1-att B3 ^*rev-c-inv	Lo396-pENTR- C1-inv SEQ ID NO： 37	attR2 ^-UNE1-in v-attL3 ^	Lo348-pDON R-P4P1R-mo d(C)	attb2-fwd-c-UNE1-attB3 ^*rev-c	Lo393-pENTR- C1 SEQ ID NO： 34	attR2 ^-UNE1-at tL3 ^

Table 1: the summary that is used for the multiple pENTR vector construction body of expression cassette insertion.The pDONR carrier of modifying (educt 1) and flank have multiple clone site (being respectively UNE1 or the 2) reorganization of recombination site (educt 2), produce multiple pENTR carrier (product), its comprise flank be multiple clone site shown in recombination site.

3. provide and insert the fragment donor molecule

3.1 the clone of pENTR-A-USP ∷ NAN ∷ A7t

USP promotor, NAN reporter gene (the codon optimized form of the nanH of aerogenesis capsule clostridium (Clostridium perfringens), people (2002) PlantJ.32 (3): 391-400 such as Kirby J by unknown seed protein (broad bean (Vicia faba)); WO 03/052104) and A7t terminator (people (1990) Curr Genet 17:473-479 such as Hirt H; Be derived from carrier pCAMBIA-1300; GenBankAcc.-No.AF234296) expression cassette of Zu Chenging is inserted into Lo375-pENTR-A2, produces pENTR-A-USP ∷ NAN ∷ A7t carrier (SEQ ID NO:44).

3.2 the clone of pENTR-B-L1-LuFad3-GUS-E9-L2

Will be by flax promotor Fad3 (GenBank Acc.-No.:AX771967; Sequence 11 from WO02/102970), GUS (glucuronidase) gene and E9 terminator are (from the terminator of pea RUBP small subunit; Genbank Acc.-No.:X00806) expression cassette of forming inserts Lo394-pENTR-A1-inv, produces pENTR-B-L1-LuFad3-GUS-E9-L2 (SEQ IDNO:45).

3.3 the clone of pENTR-C-R2-LeB4-700 ∷ GFP ∷ LeB3t-L3

To stop molecular expression cassette insertion Lo394-pENTR-A by Aequoreavictoria gene and the broad bean legumin B3 of broad bean LeB4-700 promotor, egfp GFP5er, produce pENTR-C-R2-LeB4-700 ∷ GFP ∷ LeB3t-L3 (SEQ IDNO:46).

4. provide and insert sheet receptor seq (carrier donor) molecule

4.1 the clone of double base Plant Transformation pDEST, pSUN2-GW R4R3

Use primer Lo277 and Lo278 via pcr amplification at Gateway ^TMThe dna fragmentation of attachment site R4 and R3 flank.

Loy277 attR4 ^*EcoRV(SEQ ID NO：47)：

5′-AAAAAAGATATCGATTACGCCAAGCTATCAACT-3’

Loy278 attR3 ^*EcoRV(SEQ ID NO：48)：

5′-AAAAAAGATATCCGGCCAGTGAATTATCAACT-3’

This dna fragmentation is inserted pTopo, produce pTopo R4R3.Cut binary vector pSUN2 with HindIII/EcoRI, mend the life end DNA that shows no increases in output with the Pfu polymeric enzyme reaction.Isolate from pTOPO R4R3 by EcoRV digestion and to contain the dna fragmentation that flank is the DNA district of attachment site, and be connected to linearizing pSUN2 carrier segments.The purpose carrier that produces is named as Lo338-pSUN2-GW-R4R3 (SEQ ID NO:49) and Lo339-pSUN2-GW-R3R4 (inserts segmental opposite direction; SEQ ID NO:50).These carriers contain the anti-selective marker of ccdB and will influence standard coli strain (as DH5 α) toxigenicity.Therefore, these plasmids must transform in coli strain such as DB2 or DB3.1 and breed.DB2 or DB3.1 cell contain the gyrA462 sudden change, thereby insensitive to rotatory enzyme inhibitor ccdB.

5. be used to produce the LR reaction of binary expression vector pSUN2-GW-R3R4

Use LR Clonase ^TMPlus-Enzym (Invitrogen) carries out the LR recombining reaction with plasmid pENTR-C-R2-LeB4-700 ∷ GFP5er ∷ LeB3t-attL3, pENTR-B-L1-E9-Gus-LuFad3-L2, pENTR-A-L4-USP ∷ NAN ∷ A7t-R1, pSUN2-GW-R3R4.

Carry out the recombinase reaction according to business directory.In brief, enzyme and damping fluid are remained on-80 ℃ until preparing to be used for the LR reaction.LR reacts used plasmid (pENTR and pDEST) and is diluted to required final concentration (20-25fmol plasmid/LR reaction with the TE damping fluid; Should not surpass peak concentration 30fmol/ plasmid, the DNA total amount that exists in the LR reaction should be less than 250ng DNA).The μ g that uses DNA (plasmid) size can calculate corresponding to the molar weight that will use measures:

Prepare the LR reaction according to order shown in the following table.

	Size [kb]	Cm [μg/μl ]	Dilution factor	Final C _n[fmol/μ l]	LR-reacts [μ L]
					LR-reacts [μ L]			Reaction	Over against photograph	Negative contrast
					pSUN2 R4R3	9.2	1	Reaction	Over against photograph	Negative contrast	1∶7.5	～22	1	1	1
pENTR-A-L4- USP∷NAN∷A7 t-R1	4.8	1	1∶14.5	～22	pSUN2 R4R3	9.2	1	1	0	0	1∶7.5	～22	1	1	1
pENTR-A-L4- USP∷NAN∷A7 t-R1	4.8	1	1∶14.5	～22	Lo391-pENTR -A1	2.7	0.05	1	0	0	-	～22	0	1	0
pENTR-B-L1- E9-Gus-LuFad 3-L2	6.3	1	1∶11	～22	Lo391-pENTR -A1	2.7	0.05	1	0	0	-	～22	0	1	0
pENTR-B-L1- E9-Gus-LuFad 3-L2	6.3	1	1∶11	～22	Lo392-pENTR -B2	2.7	0.05	1	0	0	-	～22		1
pENTR-C-R2- LeB4-700∷GF P5er∷LeB3t-at tL3	4.6	1	1∶15	～22	Lo392-pENTR -B2	2.7	0.05	1	0	0	-	～22		1
pENTR-C-R2- LeB4-700∷GF P5er∷LeB3t-at tL3	4.6	1	1∶15	～22	Lo393-pENTR -C1	2.7	0.05	1	0	0	-	～22	0	1	0
The 5xLR-damping fluid	-	-	-	-	Lo393-pENTR -C1	2.7	0.05	4	4	4	-	～22	0	1	0
The 5xLR-damping fluid	-	-	-	-	TE	-	-	4	4	4	-	-	8	8	11
Amount to					TE	-	-	16μl	16μl	16μl	-	-	8	8	11

With described LR-Clonase ^TM-enzyme mixture places on the dry ice and transports.During use the LR mixture was thawed on ice about 2 minutes, and gentle vortex 2 seconds.Add 4 μ l LRClonase to each reaction tubes ^TMMixture, gentle vortex 2 times, each 2 seconds, and be incubated overnight (16 hours) at 25 ℃ (little desk-top incubator is enough).Add 2 μ l Proteinase Ks (2 μ g/ μ l) termination reaction, and 37 ℃ of incubations 10 minutes.

The reaction mixture of 2 μ l is used for transformed into escherichia coli DH5 α cell.Containing the LB substratum upper flat plate inoculation cell transformed of suitable selective marker.For the pSUN2 derivative, selective marker is Streptomycin sulphate (100 μ g/ml).Because DH5 α is the ccdB sensitive strain, thus only contain based on the plasmid of carrier donor molecule but since with insert the segmental intestinal bacteria bacterium colony of ccdB that displacement that segmental reorganization mediates lacks described molecule and can grow.

Some bacterium colony incubated overnight of picking are used for clonal analysis.Prepare plasmid DNA according to manual of standards.By to cloning the correct assembling of restriction analysis and the many expression cassettes of sequence verification completely.The product that produces is pSUN2-B4-USP-NAN-pa7-E9-GUS-FAD3-LeB4-GFP-LeB3 (SEQ IDNO:51).

Sequence table

＜110〉BASF Plant Science AG

＜120〉method of assembling multiple expression constructs

<130>AE20040296

<160>67

＜170〉PatentIn version 3 .1

<210>1

<211>25

<212>DNA

＜213〉recombination site m-att

<220>

<221>misc_feature

<222>(18)..(18)

＜223〉B=C, G or T/U

<400>1

rkycwgcttt yktrtacnaa stsgb 25

<210>2

<211>25

<212>DNA

＜213〉recombination site m-attB

<220>

<221>misc_feature

<222>(18)..(18)

＜223〉B=C, G or T/U

<400>2

agccwgcttt yktrtacnaa ctsgb 25

<210>3

<211>25

<212>DNA

＜213〉recombination site m-attR

<220>

<221>misc_feature

<222>(18)..(18)

＜223〉B=C, G or T/U

<400>3

gttcagcttt cktrtacnaa ctsgb 25

<210>4

<211>25

<212>DNA

＜213〉recombination site m-attL

<220>

<221>misc_feature

<222>(18)..(18)

＜223〉B=C, G or T/U

<400>4

agccwgcttt cktrtacnaa gtsgb 25

<210>5

<211>25

<212>DNA

＜213〉recombination site m-attP1

<220>

<221>misc_feature

<222>(18)..(18)

＜223〉B=C, G or T/U

<400>5

gttcagcttt yktrtacnaa gtsgb 25

<210>6

<211>25

<212>DNA

＜213〉recombination site attB1

<400>6

agcctgcttt tttgtacaaa cttgt 25

<210>7

<211>25

<212>DNA

＜213〉recombination site attB2

<400>7

agcctgcttt cttgtacaaa cttgt 25

<210>8

<211>25

<212>DNA

＜213〉recombination site attB3

<400>8

acccagcttt cttgtacaaa cttgt 25

<210>9

<211>25

<212>DNA

＜213〉recombination site attR1

<400>9

gttcagcttt tttgtacaaa cttgt 25

<210>10

<211>25

<212>DNA

＜213〉recombination site attR2

<400>10

gttcagcttt cttgtacaaa cttgt 25

<210>11

<211>25

<212>DNA

＜213〉recombination site attR3

<400>11

gttcagcttt cttgtacaaa gttgg 25

<210>12

<211>25

<212>DNA

＜213) recombination site attL1

<400>12

agcctgcttt tttgtacaaa gttgg 25

<210>13

<211>25

<212>DNA

＜213〉recombination site attL2

<400>13

agcctgcttt cttgtacaaa gttgg 25

<210>14

<211>25

<212>DNA

＜213〉recombination site attL3

<400>14

acccagcttt cttgtacaaa gttgg 25

<210>15

<211>25

<212>DNA

＜213〉recombination site attP1

<400>15

gttcagcttt tttgtacaaa gttgg 25

<210>16

<211>25

<212>DNA

＜213〉recombination site attP2, P3

<400>16

gttcagcttt cttgtacaaa gttgg 25

<210>17

<211>40

<212>DNA

＜213〉the oligonucleotide Loy344 of phosphorylation

<220>

<221>misc_feature

<222>(1)..(1)

＜223〉5 '-phosphorylation

<400>17

gtcgaccaga tctgatatct gcggccgcct cgagcatatg 40

<210>18

<211>40

<212>DNA

＜213〉the oligonucleotide Loy345 of phosphorylation

<220>

<221>misc_feature

<222>(1)..(1)

＜223〉5 '-phosphorylation

<400>18

gtcgaccaga tctgatatct gcggccgcct cgagcatatg 40

<210>19

<211>35

<212>DNA

＜213〉the double-stranded stuffer of intestinal bacteria hisA-gene

<400>19

ccggtgcagg ttggcggcgg cgtgcgtagc gaaga 35

<210>20

<211>45

<212>DNA

＜213〉Oligonucleolide primers Loy 413-attB4*fwd-a

<400>20

ggggacaact ttgtatagaa aagttgggta cccggggatc ctcta 45

<210>21

<211>48

<212>DNA

＜213〉Oligonucleolide primers Loy 414-attB1*rev-a

<400>21

ggggactgct tttttgtaca aacttgccat gattacgcca agcttgca 48

<210>22

<211>48

<212>DNA

＜213〉Oligonucleolide primers Loy447-attB4*fwd-a-inv

<400>22

ggggacaact ttgtatagaa aagttgccat gattacgcca agcttgca 48

<210>23

<211>45

<212>DNA

＜213〉Oligonucleolide primers Loy448-attB1*rev-a-inv

<400>23

ggggactgct tttttgtaca aacttgggta cccggggatc ctcta 45

<210>24

<211>48

<212>DNA

＜213〉Oligonucleolide primers Loy415-attB1*-fwd-b

<400>24

ggggacaagt ttgtacaaaa aagcaggctg gtacccgggg atcctcta 48

<210>25

<211>51

<212>DNA

＜213〉Oligonucleolide primers Loy416-attB2*rev-b

<400>25

ggggaccact ttgtacaaga aagctgggtc catgattacg ccaagcttgc a 51

<210>26

<211>51

<212>DNA

＜213〉Oligonucleolide primers Loy449-attB1*fwd-b-inv

<400>26

ggggacaagt ttgtacaaaa aagcaggctc catgattacg ccaagcttgc a 51

<210>27

<211>48

<212>DNA

＜213〉Oligonucleolide primers Loy450-attB2*rev-b-inv

<400>27

ggggaccact ttgtacaaga aagctgggtg gtacccgggg atcctcta 48

<210>28

<211>45

<212>DNA

＜213〉Oligonucleolide primers Loy417-attB2*fwd-c

<400>28

ggggacagct ttcttgtaca aagtggggta cccggggatc ctcta 45

<210>29

<211>48

<212>DNA

＜213〉Oligonucleolide primers Loy418-attB3*rev-c

<400>29

ggggacaact ttgtataata aagttgccat gattacgcca agcttgca 48

<210>30

<211>48

<212>DNA

＜213〉Oligonucleolide primers Loy451-attB2*fwd-c-inv

<400>30

ggggacagct ttcttgtaca aagtggccat gattacgcca agcttgca 48

<210>31

<211>45

<212>DNA

＜213〉Oligonucleolide primers Loy452-attB3*rev-c-inv

<400>31

ggggacaact ttgtataata aagttgggta cccggggatc ctcta 45

<210>32

<211>2724

<212>DNA

＜213〉insert fragment donor molecule carrier Lo391-pENTR-A1

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉comp1ement:rrnb T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnb T1 transcribe stop

<220>

<221>misc_feature

<222>(593)..(687)

＜223〉attL4* recombination site

<220>

<221>misc_feature

<222>(775)..(931)

＜223〉complement:attR1* recombination site

<220>

<221>misc_feature

<222>(1118)..(1927)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2048)..(2721)

＜223〉pUC starting point

<400>32

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccga gttaacgcta ccatggagct ccaaataatg 600

attttatttt gactgatagt gacctgttcg ttgcaacaaa ttgataagca atgctttttt 660

ataatgccaa ctttgtatag aaaagttggg tacccgggga tcctctagca tatgctcgag 720

gcggccgcag atatcagatc tggtcgacgg catgcaagct tggcgtaatc atggcaagtt 780

tgtacaaaaa agttgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga 840

ttttgcataa aaaacagact acataatact gtaaaacaca acatatgcag tcactatgaa 900

ccaactactt agatggtatt agtgacctgt agaattcgag ctctagagct gcagggcggc 960

catcccctat agtgagtcgt attacatggt catagctgtt tcctggcagc tctggcccgt 1020

gtctcaaaat ctctgatgtt acattgcaca agataaaaat atatcatcat gaacaataaa 1080

actgtctgct tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac 1140

gtcgaggccg cgattaaatt ccaacatgga tgctgattta tatgggtata aatgggctcg 1200

cgataatgtc gggcaatcag gtgcgacaat ctatcgcttg tatgggaagc ccgatgcgcc 1260

agagttgttt ctgaaacatg gcaaaggtag cgttgccaat gatgttacag atgagatggt 1320

cagactaaac tggctgacgg aatttatgcc tcttccgacc atcaagcatt ttatccgtac 1380

tcctgatgat gcatggttac tcaccactgc gatccccgga aaaacagcat tccaggtatt 1440

agaagaatat cctgattcag gtgaaaatat tgttgatgcg ctggcagtgt tcctgcgccg 1500

gttgcattcg attcctgttt gtaattgtcc ttttaacagc gatcgcgtat ttcgtctcgc 1560

tcaggcgcaa tcacgaatga ataacggttt ggttgatgcg agtgattttg atgacgagcg 1620

taatggctgg cctgttgaac aagtctggaa agaaatgcat aaacttttgc cattctcacc 1680

ggattcagtc gtcactcatg gtgatttctc acttgataac cttatttttg acgaggggaa 1740

attaataggt tgtattgatg ttggacgagt cggaatcgca gaccgatacc aggatcttgc 1800

catcctatgg aactgcctcg gtgagttttc tccttcatta cagaaacggc tttttcaaaa 1860

atatggtatt gataatcctg atatgaataa attgcagttt catttgatgc tcgatgagtt 1920

tttctaatca gaattggtta attggttgta acactggcag agcattacgc tgacttgacg 1980

ggacggcgca agctcatgac caaaatccct taacgtgagt tacgcgtcgt tccactgagc 2040

gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat 2100

ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga 2160

gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt 2220

tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata 2280

cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac 2340

cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg 2400

ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg 2460

tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag 2520

cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct 2580

ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc 2640

aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt 2700

ttgctggcct tttgctcaca tgtt 2724

<210>33

<211>2665

<212>DNA

＜213〉insert fragment donor molecule carrier Lo392-pENTR-B1

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(569)..(668)

＜223〉attL1* recombination site

<220>

<221>misc_feature

<222>(755)..(853)

＜223〉complement:attL2* recombination site

<220>

<221>misc_feature

<222>(1059)..(1868)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(1989)..(2662)

＜223〉pUC starting point

<400>33

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac 600

ctgttcgttg caacaaattg atgagcaatg cttttttata atgccaactt tgtacaaaaa 660

agcaggctgg tacccgggga tcctctagca tatgctcgag gcggccgcag atatcagatc 720

tggtcgacgg catgcaagct tggcgtaatc atggacccag ctttcttgta caaagttggc 780

attataagaa agcattgctt atcaatttgt tgcaacgaac aggtcactat cagtcaaaat 840

aaaatcatta tttgccatcc agctgatccg gtgcaggttg gcggcggcgt gcgtagcgaa 900

gaatccccta tagtgagtcg tattacatgg tcatagctgt ttcctggcag ctctggcccg 960

tgtctcaaaa tctctgatgt tacattgcac aagataaaaa tatatcatca tgaacaataa 1020

aactgtctgc ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa 1080

cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc 1140

gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag cccgatgcgc 1200

cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg 1260

tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta 1320

ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca ttccaggtat 1380

tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc 1440

ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg 1500

ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc 1560

gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg ccattctcac 1620

cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga 1680

aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg 1740

ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa 1800

aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt 1860

ttttctaatc agaattggtt aattggttgt aacactggca gagcattacg ctgacttgac 1920

gggacggcgc aagctcatga ccaaaatccc ttaacgtgag ttacgcgtcg ttccactgag 1980

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 2040

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 2100

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 2160

tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 2220

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 2280

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 2340

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 2400

gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 2460

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 2520

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 2580

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 2640

tttgctggcc ttttgctcac atgtt 2665

<210>34

<211>2720

<212>DNA

＜213〉insert fragment donor molecule carrier Lo393-pENTR-C1

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(591)..(747)

＜223〉attR2* recombination site

<220>

<221>misc_feature

<222>(834)..(929)

＜223〉complement:attL3* recombination site

<220>

<221>misc_feature

<222>(1114)..(1923)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2044)..(2717)

＜223〉pUC starting point

<40D>34

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggccctg cagctctaga gctcgaattc tacaggtcac 600

taataccatc taagtagttg gttcatagtg actgcatatg ttgtgtttta cagtattatg 660

tagtctgttt tttatgcaaa atctaattta atatattgat atttatatca ttttacgttt 720

ctcgttcaac tttcttgtac aaagtggggt acccggggat cctctagcat atgctcgagg 780

cggccgcaga tatcagatct ggtcgacggc atgcaagctt ggcgtaatca tggcaacttt 840

attatacaaa gttggcatta taaaaaagca ttgcttatca atttgttgca acgaacaggt 900

cactatcagt caaaataaaa tcattatttg gagctccatg gtagcgttaa cgcggccatc 960

ccctatagtg agtcgtatta catggtcata gctgtttcct ggcagctctg gcccgtgtct 1020

caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 1080

tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtcg 1140

aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg ggctcgcgat 1200

aatgtcgggc aatcaggtgc gacaatctat cgcttgtatg ggaagcccga tgcgccagag 1260

tgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga gatggtcaga 1320

ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat ccgtactcct 1380

gatgatgcat ggttactcac cactgcgatc cccggaaaaa cagcattcca ggtattagaa 1440

gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct gcgccggttg 1500

cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg tctcgctcag 1560

gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga cgagcgtaat 1620

ggctggcctg ttgaacaagt ctggaaagaa atgcataaac ttttgccatt ctcaccggat 1680

tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga ggggaaatta 1740

ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga tcttgccatc 1800

ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt tcaaaaatat 1860

ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga tgagtttttc 1920

taatcagaat tggttaattg gttgtaacac tggcagagca ttacgctgac ttgacgggac 1980

ggcgcaagct catgaccaaa atcccttaac gtgagttacg cgtcgttcca ctgagcgtca 2040

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 2100

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 2160

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt 2220

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 2280

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 2340

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 2400

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 2460

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 2520

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 2580

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 2640

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 2700

tggccttttg ctcacatgtt 2720

<210>35

<211>2724

<212>DNA

＜213〉insert fragment donor molecule carrier Lo394-pENTR-A1-inv

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(593)..(687)

＜223〉attL4* recombination site

<220>

<221>misc_feature

<222>(775)..(931)

＜223〉complement:attR1* recombination site

<220>

<221>misc_feature

<222>(1118)..(1927)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2048)..(2721)

＜223〉pUC starting point

<400>35

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccga gttaacgcta ccatggagct ccaaataatg 600

attttatttt gactgatagt gacctgttcg ttgcaacaaa ttgataagca atgctttttt 660

ataatgccaa ctttgtatag aaaagttgcc atgattacgc caagcttgca tgccgtcgac 720

cagatctgat atctgcggcc gcctcgagca tatgctagag gatccccggg tacccaagtt 780

tgtacaaaaa agttgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga 840

ttttgcataa aaaacagact acataatact gtaaaacaca acatatgcag tcactatgaa 900

ccaactactt agatggtatt agtgacctgt agaattcgag ctctagagct gcagggcggc 960

catcccctat agtgagtcgt attacatggt catagctgtt tcctggcagc tctggcccgt 1020

gtctcaaaat ctctgatgtt acattgcaca agataaaaat atatcatcat gaacaataaa 1080

actgtctgct tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac 1140

gtcgaggccg cgattaaatt ccaacatgga tgctgattta tatgggtata aatgggctcg 1200

cgataatgtc gggcaatcag gtgcgacaat ctatcgcttg tatgggaagc ccgatgcgcc 1260

agagttgttt ctgaaacatg gcaaaggtag cgttgccaat gatgttacag atgagatggt 1320

cagactaaac tggctgacgg aatttatgcc tcttccgacc atcaagcatt ttatccgtac 1380

tcctgatgat gcatggttac tcaccactgc gatccccgga aaaacagcat tccaggtatt 1440

agaagaatat cctgattcag gtgaaaatat tgttgatgcg ctggcagtgt tcctgcgccg 1500

gttgcattcg attcctgttt gtaattgtcc ttttaacagc gatcgcgtat ttcgtctcgc 1560

tcaggcgcaa tcacgaatga ataacggttt ggttgatgcg agtgattttg atgacgagcg 1620

taatggctgg cctgttgaac aagtctggaa agaaatgcat aaacttttgc cattctcacc 1680

ggattcagtc gtcactcatg gtgatttctc acttgataac cttatttttg acgaggggaa 1740

attaataggt tgtattgatg ttggacgagt cggaatcgca gaccgatacc aggatcttgc 1800

catcctatgg aactgcctcg gtgagttttc tccttcatta cagaaacggc tttttcaaaa 1860

atatggtatt gataatcctg atatgaataa attgcagttt catttgatgc tcgatgagtt 1920

tttctaatca gaattggtta attggttgta acactggcag agcattacgc tgacttgacg 1980

ggacggcgca agctcatgac caaaatccct taacgtgagt tacgcgtcgt tccactgagc 2040

gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat 2100

ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga 2160

gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt 2220

tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata 2280

cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac 2340

cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg 2400

ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg 2460

tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag 2520

cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct 2580

ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc 2640

aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt 2700

ttgctggcct tttgctcaca tgtt 2724

<210>36

<211>2665

<212>DNA

＜213〉insert fragment donor molecule carrier Lo395-pENTR-B1-inv

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(569)..(668)

＜223〉attL1* recombination site

<220>

<221>misc_feature

<222>(755)..(853)

＜223〉complement:attL2* recombination site

<220>

<221>misc_feature

<222>(1059)..(1868)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(1989)..(2662)

＜223〉pUC starting point

<400>36

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac 600

ctgttcgttg caacaaattg atgagcaatg cttttttata atgccaactt tgtacaaaaa 660

agcaggctcc atgattacgc caagcttgca tgccgtcgac cagatctgat atctgcggcc 720

gcctcgagca tatgctagag gatccccggg taccacccag ctttcttgta caaagttggc 780

attataagaa agcattgctt atcaatttgt tgcaacgaac aggtcactat cagtcaaaat 840

aaaatcatta tttgccatcc agctgatccg gtgcaggttg gcggcggcgt gcgtagcgaa 900

gaatccccta tagtgagtcg tattacatgg tcatagctgt ttcctggcag ctctggcccg 960

tgtctcaaaa tctctgatgt tacattgcac aagataaaaa tatatcatca tgaacaataa 1020

aactgtctgc ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa 1080

cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc 1140

gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag cccgatgcgc 1200

cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg 1260

tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta 1320

ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca ttccaggtat 1380

tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc 1440

ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg 1500

ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc 1560

gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg ccattctcac 1620

cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga 1680

aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg 1740

ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa 1800

aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt 1860

ttttctaatc agaattggtt aattggttgt aacactggca gagcattacg ctgacttgac 1920

gggacggcgc aagctcatga ccaaaatccc ttaacgtgag ttacgcgtcg ttccactgag 1980

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 2040

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 2100

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 2160

tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 2220

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 2280

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 2340

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 2400

gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 2460

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 2520

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 2580

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 2640

tttgctggcc ttttgctcac atgtt 2665

<210>37

<211>2720

<212>DNA

＜213〉insert fragment donor molecule carrier Lo396-pENTR-Cl-inv

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(591)..(747)

＜223〉attR2* recombination site

<220>

<221>misc_feature

<222>(834)..(929)

＜223〉complement:attL3* recombination site

<220>

<221>misc_feature

<222>(1114)..(1923)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2044)..(2717)

＜223〉pUC starting point

<400>37

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggccctg cagctctaga gctcgaattc tacaggtcac 600

taataccatc taagtagttg gttcatagtg actgcatatg ttgtgtttta cagtattatg 660

tagtctgttt tttatgcaaa atctaattta atatattgat atttatatca ttttacgttt 720

ctcgttcaac tttcttgtac aaagtggcca tgattacgcc aagcttgcat gccgtcgacc 780

agatctgata tctgcggccg cctcgagcat atgctagagg atccccgggt acccaacttt 840

attatacaaa gttggcatta taaaaaagca ttgcttatca atttgttgca acgaacaggt 900

cactatcagt caaaataaaa tcattatttg gagctccatg gtagcgttaa cgcggccatc 960

ccctatagtg agtcgtatta catggtcata gctgtttcct ggcagctctg gcccgtgtct 1020

caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 1080

tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtcg 1140

aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg ggctcgcgat 1200

aatgtcgggc aatcaggtgc gacaatctat cgcttgtatg ggaagcccga tgcgccagag 1260

ttgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga gatggtcaga 1320

ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat ccgtactcct 1380

gatgatgcat ggttactcac cactgcgatc cccggaaaaa cagcattcca ggtattagaa 1440

gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct gcgccggttg 1500

cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg tctcgctcag 1560

gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga cgagcgtaat 1620

ggctggcctg ttgaacaagt ctggaaagaa atgcataaac ttttgccatt ctcaccggat 1680

tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga ggggaaatta 1740

ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga tcttgccatc 1800

ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt tcaaaaatat 1860

ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga tgagtttttc 1920

taatcagaat tggttaattg gttgtaacac tggcagagca ttacgctgac ttgacgggac 1980

ggcgcaagct catgaccaaa atcccttaac gtgagttacg cgtcgttcca ctgagcgtca 2040

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 2100

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 2160

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt 2220

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 2280

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 2340

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 2400

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 2460

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 2520

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 2580

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 2640

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 2700

tggccttttg ctcacatgtt 2720

<210>38

<211>2724

<212>DNA

＜213〉insert fragment donor molecule carrier Lo375-pENTR-A2

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(593)..(687)

＜223〉attL4* recombination site

<220>

<221>misc_feature

<222>(775)..(931)

＜223〉complement:attR1* recombination site

<220>

<221>misc_feature

<222>(1118)..(1927)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2048)..(2721)

＜223〉pUC starting point

<400>38

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccga gttaacgcta ccatggagct ccaaataatg 600

attttatttt gactgatagt gacctgttcg ttgcaacaaa ttgataagca atgctttttt 660

ataatgccaa ctttgtatag aaaagttggg tacccgggga tcctctaggt cgaccagatc 720

tgatatctgc ggccgcctcg agcatatggg catgcaagct tggcgtaatc atggcaagtt 780

tgtacaaaaa agttgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga 840

ttttgcataa aaaacagact acataatact gtaaaacaca acatatgcag tcactatgaa 900

ccaactactt agatggtatt agtgacctgt agaattcgag ctctagagct gcagggcggc 960

catcccctat agtgagtcgt attacatggt catagctgtt tcctggcagc tctggcccgt 1020

gtctcaaaat ctctgatgtt acattgcaca agataaaaat atatcatcat gaacaataaa 1080

actgtctgct tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac 1140

gtcgaggccg cgattaaatt ccaacatgga tgctgattta tatgggtata aatgggctcg 1200

cgataatgtc gggcaatcag gtgcgacaat ctatcgcttg tatgggaagc ccgatgcgcc 1260

agagttgttt ctgaaacatg gcaaaggtag cgttgccaat gatgttacag atgagatggt 1320

cagactaaac tggctgacgg aatttatgcc tcttccgacc atcaagcatt ttatccgtac 1380

tcctgatgat gcatggttac tcaccactgc gatccccgga aaaacagcat tccaggtatt 1440

agaagaatat cctgattcag gtgaaaatat tgttgatgcg ctggcagtgt tcctgcgccg 1500

gttgcattcg attcctgttt gtaattgtcc ttttaacagc gatcgcgtat ttcgtctcgc 1560

tcaggcgcaa tcacgaatga ataacggttt ggttgatgcg agtgattttg atgacgagcg 1620

taatggctgg cctgttgaac aagtctggaa agaaatgcat aaacttttgc cattctcacc 1680

ggattcagtc gtcactcatg gtgatttctc acttgataac cttatttttg acgaggggaa 1740

attaataggt tgtattgatg ttggacgagt cggaatcgca gaccgatacc aggatcttgc 1800

catcctatgg aactgcctcg gtgagttttc tccttcatta cagaaacggc tttttcaaaa 1860

atatggtatt gataatcctg atatgaataa attgcagttt catttgatgc tcgatgagtt 1920

tttctaatca gaattggtta attggttgta acactggcag agcattacgc tgacttgacg 1980

ggacggcgca agctcatgac caaaatccct taacgtgagt tacgcgtcgt tccactgagc 2040

gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat 2100

ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga 2160

gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt 2220

tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata 2280

cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac 2340

cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg 2400

ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg 2460

tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag 2520

cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct 2580

ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc 2640

aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt 2700

ttgctggcct tttgctcaca tgtt 2724

<210>39

<211>2665

<212>DNA

＜213〉insert fragment donor molecule carrier Lo376-pENTR-B2

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(569)..(668)

＜223〉attL1* recombination site

<220>

<221>misc_feature

<222>(755)..(853)

＜223〉complement:attL2* recombination site

<220>

<221>misc_feature

<222>(1059)..(1868)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(1989)..(2662)

＜223〉pUC starting point

<400>39

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac 600

ctgttcgttg caacaaattg atgagcaatg cttttttata atgccaactt tgtacaaaaa 660

agcaggctgg tacccgggga tcctctaggt cgaccagatc tgatatctgc ggccgcctcg 720

agcatatggg catgcaagct tggcgtaatc atggacccag ctttcttgta caaagttggc 780

attataagaa agcattgctt atcaatttgt tgcaacgaac aggtcactat cagtcaaaat 840

aaaatcatta tttgccatcc agctgatccg gtgcaggttg gcggcggcgt gcgtagcgaa 900

gaatccccta tagtgagtcg tattacatgg tcatagctgt ttcctggcag ctctggcccg 960

tgtctcaaaa tctctgatgt tacattgcac aagataaaaa tatatcatca tgaacaataa 1020

aactgtctgc ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa 1080

cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc 1140

gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag cccgatgcgc 1200

cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg 1260

tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta 1320

ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca ttccaggtat 1380

tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc 1440

ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg 1500

ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc 1560

gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg ccattctcac 1620

cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga 1680

aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg 1740

ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa 1800

aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt 1860

ttttctaatc agaattggtt aattggttgt aacactggca gagcattacg ctgacttgac 1920

gggacggcgc aagctcatga ccaaaatccc ttaacgtgag ttacgcgtcg ttccactgag 1980

cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 2040

tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 2100

agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 2160

ttcttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 2220

acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 2280

ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 2340

gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 2400

gtgagctatg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 2460

gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 2520

tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 2580

caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 2640

tttgctggcc ttttgctcac atgtt 2665

<210>40

<211>2720

<212>DNA

＜213〉insert fragment donor molecule carrier Lo377-pENTR-C2

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(591)..(747)

＜223〉attR2* recombination site

<220>

<221>misc_feature

<222>(834)..(929)

＜223〉complement:attL3* recombination site

<220>

<221>misc_feature

<222>(1114)..(1923)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2044)..(2717)

＜223〉pUC starting point

<400>40

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggccctg cagctctaga gctcgaattc tacaggtcac 600

taataccatc taagtagttg gttcatagtg actgcatatg ttgtgtttta cagtattatg 660

tagtctgttt tttatgcaaa atctaattta atatattgat atttatatca ttttacgttt 720

ctcgttcaac tttcttgtac aaagtggggt acccggggat cctctaggtc gaccagatct 780

gatatctgcg gccgcctcga gcatatgggc atgcaagctt ggcgtaatca tggcaacttt 840

attatacaaa gttggcatta taaaaaagca ttgcttatca atttgttgca acgaacaggt 900

cactatcagt caaaataaaa tcattatttg gagctccatg gtagcgttaa cgcggccatc 960

ccctatagtg agtcgtatta catggtcata gctgtttcct ggcagctctg gcccgtgtct 1020

caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 1080

tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtcg 1140

aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg ggctcgcgat 1200

aatgtcgggc aatcaggtgc gacaatctat cgcttgtatg ggaagcccga tgcgccagag 1260

ttgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga gatggtcaga 1320

ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat ccgtactcct 1380

gatgatgcat ggttactcac cactgcgatc cccggaaaaa cagcattcca ggtattagaa 1440

gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct gcgccggttg 1500

cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg tctcgctcag 1560

gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga cgagcgtaat 1620

ggctggcctg ttgaacaagt ctggaaagaa atgcataaac ttttgccatt ctcaccggat 1680

tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga ggggaaatta 1740

ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga tcttgccatc 1800

ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt tcaaaaatat 1860

ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga tgagtttttc 1920

taatcagaat tggttaattg gttgtaacac tggcagagca ttacgctgac ttgacgggac 1980

ggcgcaagct catgaccaaa atcccttaac gtgagttacg cgtcgttcca ctgagcgtca 2040

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 2100

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 2160

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt 2220

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 2280

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 2340

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 2400

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 2460

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 2520

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 2580

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 2640

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 2700

tggccttttg ctcacatgtt 2720

<210>41

<211>2724

<212>DNA

＜213〉insert fragment donor molecule carrier Lo397-pENTR-A2-inv

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(593)..(687)

＜223〉complement:rrnB the hole transcribe stop

<220>

<221>misc_feature

<222>(775)..(931)

＜223〉complement:attR1* recombination site

<220>

<221>misc_feature

<222>(593)..(687)

＜223〉attL4* recombination site

<220>

<221>misc_feature

<222>(1118)..(1927)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2048)..(2721)

＜223〉pUC starting point

<400>41

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccga gttaacgcta ccatggagct ccaaataatg 600

attttatttt gactgatagt gacctgttcg ttgcaacaaa ttgataagca atgctttttt 660

ataatgccaa ctttgtatag aaaagttgcc atgattacgc caagcttgca tgcccatatg 720

ctcgaggcgg ccgcagatat cagatctggt cgacctagag gatccccggg tacccaagtt 780

tgtacaaaaa agttgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga 840

ttttgcataa aaaacagact acataatact gtaaaacaca acatatgcag tcactatgaa 900

ccaactactt agatggtatt agtgacctgt agaattcgag ctctagagct gcagggcggc 960

catcccctat agtgagtcgt attacatggt catagctgtt tcctggcagc tctggcccgt 1020

gtctcaaaat ctctgatgtt acattgcaca agataaaaat atatcatcat gaacaataaa 1080

actgtctgct tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac 1140

gtcgaggccg cgattaaatt ccaacatgga tgctgattta tatgggtata aatgggctcg 1200

cgataatgtc gggcaatcag gtgcgacaat ctatcgcttg tatgggaagc ccgatgcgcc 1260

agagttgttt ctgaaacatg gcaaaggtag cgttgccaat gatgttacag atgagatggt 1320

cagactaaac tggctgacgg aatttatgcc tcttccgacc atcaagcatt ttatccgtac 1380

tcctgatgat gcatggttac tcaccactgc gatccccgga aaaacagcat tccaggtatt 1440

agaagaatat cctgattcag gtgaaaatat tgttgatgcg ctggcagtgt tcctgcgccg 1500

gttgcattcg attcctgttt gtaattgtcc ttttaacagc gatcgcgtat ttcgtctcgc 1560

tcaggcgcaa tcacgaatga ataacggttt ggttgatgcg agtgattttg atgacgagcg 1620

taatggctgg cctgttgaac aagtctggaa agaaatgcat aaacttttgc cattctcacc 1680

ggattcagtc gtcactcatg gtgatttctc acttgataac cttatttttg acgaggggaa 1740

attaataggt tgtattgatg ttggacgagt cggaatcgca gaccgatacc aggatcttgc 1800

catcctatgg aactgcctcg gtgagttttc tccttcatta cagaaacggc tttttcaaaa 1860

atatggtatt gataatcctg atatgaataa attgcagttt catttgatgc tcgatgagtt 1920

tttctaatca gaattggtta attggttgta acactggcag agcattacgc tgacttgacg 1980

ggacggcgca agctcatgac caaaatccct taacgtgagt tacgcgtcgt tccactgagc 2040

gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat 2100

ctgctgcttg caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga 2160

gctaccaact ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt 2220

tcttctagtg tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata 2280

cctcgctctg ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac 2340

cgggttggac tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg 2400

ttcgtgcaca cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg 2460

tgagctatga gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag 2520

cggcagggtc ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct 2580

ttatagtcct gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc 2640

aggggggcgg agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt 2700

ttgctggcct tttgctcaca tgtt 2724

<210>42

<211>2667

<212>DNA

＜213〉insert fragment donor molecule carrier Lo398-pENTR-B2-inv

<220>

＜221〉terminator

<222>(270)..(297)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(429)..(472)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(571)..(670)

＜223〉attL1* recombination site

<220>

<221>misc_feature

<222>(757)..(855)

＜223〉complement:attL2* recombination site

<220>

<221>misc_feature

<222>(1061)..(1870)

＜223〉CDS: coding kalamycin resistance

<400>42

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctgatg 180

cacgacaggt ttcccgactg gaaagcgggc agtgagcgca acgcaattaa tacgcgtacc 240

gctagccagg aagagtttgt agaaacgcaa aaaggccatc cgtcaggatg gccttctgct 300

tagtttgatg cctggcagtt tatggcgggc gtcctgcccg ccaccctccg ggccgttgct 360

tcacaacgtt caaatccgct cccggcggat ttgtcctact caggagagcg ttcaccgaca 420

aacaacagat aaaacgaaag gcccagtctt ccgactgagc ctttcgtttt atttgatgcc 480

tggcagttcc ctactctcgc gttaacgcta gcatggatgt tttcccagtc acgacgttgt 540

aaaacgacgg ccagtcttaa gctcgggccc caaataatga ttttattttg actgatagtg 600

acctgttcgt tgcaacaaat tgatgagcaa tgctttttta taatgccaac tttgtacaaa 660

aaagcaggct ccatgattac gccaagcttg catgcccata tgctcgaggc ggccgcagat 720

atcagatctg gtcgacctag aggatccccg ggtaccaccc agctttcttg tacaaagttg 780

gcattataag aaagcattgc ttatcaattt gttgcaacga acaggtcact atcagtcaaa 840

ataaaatcat tatttgccat ccagctgatc cggtgcaggt tggcggcggc gtgcgtagcg 900

aagaatcccc tatagtgagt cgtattacat ggtcatagct gtttcctggc agctctggcc 960

cgtgtctcaa aatctctgat gttacattgc acaagataaa aatatatcat catgaacaat 1020

aaaactgtct gcttacataa acagtaatac aaggggtgtt atgagccata ttcaacggga 1080

aacgtcgagg ccgcgattaa attccaacat ggatgctgat ttatatgggt ataaatgggc 1140

tcgcgataat gtcgggcaat caggtgcgac aatctatcgc ttgtatggga agcccgatgc 1200

gccagagttg tttctgaaac atggcaaagg tagcgttgcc aatgatgtta cagatgagat 1260

ggtcagacta aactggctga cggaatttat gcctcttccg accatcaagc attttatccg 1320

tactcctgat gatgcatggt tactcaccac tgcgatcccc ggaaaaacag cattccaggt 1380

attagaagaa tatcctgatt caggtgaaaa tattgttgat gcgctggcag tgttcctgcg 1440

ccggttgcat tcgattcctg tttgtaattg tccttttaac agcgatcgcg tatttcgtct 1500

cgctcaggcg caatcacgaa tgaataacgg tttggttgat gcgagtgatt ttgatgacga 1560

gcgtaatggc tggcctgttg aacaagtctg gaaagaaatg cataaacttt tgccattctc 1620

accggattca gtcgtcactc atggtgattt ctcacttgat aaccttattt ttgacgaggg 1680

gaaattaata ggttgtattg atgttggacg agtcggaatc gcagaccgat accaggatct 1740

tgccatccta tggaactgcc tcggtgagtt ttctccttca ttacagaaac ggctttttca 1800

aaaatatggt attgataatc ctgatatgaa taaattgcag tttcatttga tgctcgatga 1860

gtttttctaa tcagaattgg ttaattggtt gtaacactgg cagagcatta cgctgacttg 1920

acgggacggc gcaagctcat gaccaaaatc ccttaacgtg agttacgcgt cgttccactg 1980

agcgtcagac cccgtagaaa agatcaaagg atcttcttga gatccttttt ttctgcgcgt 2040

aatctgctgc ttgcaaacaa aaaaaccacc gctaccagcg gtggtttgtt tgccggatca 2100

agagctacca actctttttc cgaaggtaac tggcttcagc agagcgcaga taccaaatac 2160

tgtccttcta gtgtagccgt agttaggcca ccacttcaag aactctgtag caccgcctac 2220

atacctcgct ctgctaatcc tgttaccagt ggctgctgcc agtggcgata agtcgtgtct 2280

taccgggttg gactcaagac gatagttacc ggataaggcg cagcggtcgg gctgaacggg 2340

gggttcgtgc acacagccca gcttggagcg aacgacctac accgaactga gatacctaca 2400

gcgtgagcat tgagaaagcg ccacgcttcc cgaagggaga aaggcggaca ggtatccggt 2460

aagcggcagg gtcggaacag gagagcgcac gagggagctt ccagggggaa acgcctggta 2520

tctttatagt cctgtcgggt ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc 2580

gtcagggggg cggagcctat ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc 2640

cttttgctgg ccttttgctc acatgtt 2667

<210>43

<211>2720

<212>DNA

＜213〉insert fragment donor molecule carrier Lo399-pENTR-C2-inv

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(591)..(747)

＜223〉attR2* recombination site

<220>

<221>misc_feature

<222>(834)..(929)

＜223〉complement:attL3* recombination site

<220>

<221>misc_feature

<222>(1114)..(1923)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(2044)..(2717)

＜223〉pUC starting point

<400>43

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggccctg cagctctaga gctcgaattc tacaggtcac 600

taataccatc taagtagttg gttcatagtg actgcatatg ttgtgtttta cagtattatg 660

tagtctgttt tttatgcaaa atctaattta atatattgat atttatatca ttttacgttt 720

ctcgttcaac tttcttgtac aaagtggcca tgattacgcc aagcttgcat gcccatatgc 780

tcgaggcggc cgcagatatc agatctggtc gacctagagg atccccgggt acccaacttt 840

attatacaaa gttggcatta taaaaaagca ttgcttatca atttgttgca acgaacaggt 900

cactatcagt caaaataaaa tcattatttg gagctccatg gtagcgttaa cgcggccatc 960

ccctatagtg agtcgtatta catggtcata gctgtttcct ggcagctctg gcccgtgtct 1020

caaaatctct gatgttacat tgcacaagat aaaaatatat catcatgaac aataaaactg 1080

tctgcttaca taaacagtaa tacaaggggt gttatgagcc atattcaacg ggaaacgtcg 1140

aggccgcgat taaattccaa catggatgct gatttatatg ggtataaatg ggctcgcgat 1200

aatgtcgggc aatcaggtgc gacaatctat cgcttgtatg ggaagcccga tgcgccagag 1260

ttgtttctga aacatggcaa aggtagcgtt gccaatgatg ttacagatga gatggtcaga 1320

ctaaactggc tgacggaatt tatgcctctt ccgaccatca agcattttat ccgtactcct 1380

gatgatgcat ggttactcac cactgcgatc cccggaaaaa cagcattcca ggtattagaa 1440

gaatatcctg attcaggtga aaatattgtt gatgcgctgg cagtgttcct gcgccggttg 1500

cattcgattc ctgtttgtaa ttgtcctttt aacagcgatc gcgtatttcg tctcgctcag 1560

gcgcaatcac gaatgaataa cggtttggtt gatgcgagtg attttgatga cgagcgtaat 1620

ggctggcctg ttgaacaagt ctggaaagaa atgcataaac ttttgccatt ctcaccggat 1680

tcagtcgtca ctcatggtga tttctcactt gataacctta tttttgacga ggggaaatta 1740

ataggttgta ttgatgttgg acgagtcgga atcgcagacc gataccagga tcttgccatc 1800

ctatggaact gcctcggtga gttttctcct tcattacaga aacggctttt tcaaaaatat 1860

ggtattgata atcctgatat gaataaattg cagtttcatt tgatgctcga tgagtttttc 1920

taatcagaat tggttaattg gttgtaacac tggcagagca ttacgctgac ttgacgggac 1980

ggcgcaagct catgaccaaa atcccttaac gtgagttacg cgtcgttcca ctgagcgtca 2040

gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg cgtaatctgc 2100

tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga tcaagagcta 2160

ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa tactgttctt 2220

ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc tacatacctc 2280

gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg tcttaccggg 2340

ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac ggggggttcg 2400

tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct acagcgtgag 2460

ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc ggtaagcggc 2520

agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg gtatctttat 2580

agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg ctcgtcaggg 2640

gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct ggccttttgc 2700

tggccttttg ctcacatgtt 2720

<210>44

<211>4832

<212>DNA

＜213〉insert fragment donor molecule pENTR-A-USP ∷ NAN ∷ A7t

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(593)..(687)

＜223〉attL4* recombination site

<220>

<221>misc_feature

<222>(2883)..(3039)

＜223〉complement:attR1* recombination site

<220>

<221>misc_feature

<222>(3226)..(4035)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(4156)..(4829)

＜223〉pUC starting point

<220>

＜221〉promotor

<222>(710)..(1388)

＜223〉USP promotor

<220>

＜221〉terminator

<222>(2624)..(2845)

＜223〉35S terminator A7T

<220>

<221>misc_feature

<222>(2624)..(2845)

＜223〉CDS: coding NAN reporter gene

<400>44

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggcccga gttaacgcta ccatggagct ccaaataatg 600

attttatttt gactgatagt gacctgttcg ttgcaacaaa ttgataagca atgctttttt 660

ataatgccaa ctttgtatag aaaagttggg tacccgggga tcctcctcga gcaaatttac 720

acattgccac taaacgtcta aacccttgta atttgttttt gttttactat gtgtgttatg 780

tatttgattt gcgataaatt tttatatttg gtactaaatt tataacacct tttatgctaa 840

cgtttgccaa cacttagcaa tttgcaagtt gattaattga ttctaaatta tttttgtctt 900

ctaaatacat atactaatca actggaaatg taaatatttg ctaatatttc tactatagga 960

gaattaaagt gagtgaatat ggtaccacaa ggtttggaga tttaattgtt gcaatgatgc 1020

atggatggca tatacaccaa acattcaata attcttgagg ataataatgg taccacacaa 1080

gatttgaggt gcatgaacgt cacgtggaca aaaggtttag taatttttca agacaacaat 1140

gttaccacac acaagttttg aggtgcatgc atggatgccc tgtggaaagt ttaaaaatat 1200

tttggaaatg atttgcatgg aagccatgtg taaaaccatg acatccactt ggaggatgca 1260

ataatgaaga aaactacaaa tttacatgca actagttatg catgtagtct atataatgag 1320

gattttgcaa tactttcatt catacacact cactaagttt tacacgatta taatttcttc 1380

atagccagcg gatctgatat ctgcggccgc ggcgcgccaa ttgactagta gggatccgtt 1440

aacaatgtgt aacaagaaca acaccttcga gaagaacctc gacatctcac acaagcctga 1500

accacttatc ctctttaaca aggataacaa catctggaat tctaagtact tcaggattcc 1560

taacatccag ttgcttaatg acggtacaat ccttaccttc tctgacatca ggtacaacgg 1620

gcccgatgac cacgcttaca ttgatatcgc ttctgctaga tctactgaat tcggtaagac 1680

ctggtcttac aacatcgcta tgaagaacaa caggatcgac tcaacctact cacgtgtgat 1740

ggattctacc actgtgatca ctaacaccgg ccggatcatt cttatcgctg gatcttggaa 1800

cactaacgga aactgggcta tgaccacttc taccagaagg tctgattggt ctgtgcagat 1860

gatctactct gatgacaacg gacttacttg gtctaacaag atcgatctca ctaaggactc 1920

ttcaaaagtg aagaaccagc cttctaacac aattggatgg ctcggaggtg ttggatctgg 1980

aatcgttatg gacgatggaa ccatcgttat gcctgctcag atctccttaa gagaaaacaa 2040

cgagaacaac tactattcac tcatcatata ttccaaggat aacggcgaga cttggactat 2100

ggggaacaag gtgccgaatt ccaatacgtc cgagaatatg gtcattgaac tcgacggagc 2160

attgatcatg tctactaggt acgattactc aggctacaga gcggcataca taagtcatga 2220

cctcgggaca acttgggaaa tctacgagcc acttaatggc aagattctca caggcaaagg 2280

ttccggatgt caaggatcat tcatcaaagc cacaacgagc aatggacatc gtattggact 2340

cattagtgca cctaagaaca caaaaggtga gtacattaga gataatatcg ccgtctacat 2400

gatcgatttt gacgatctga gcaaaggtgt tcaagagatc tgcattccat atccagagga 2460

tggtaacaag ctcggtggag gatactcctg tctgagtttt aagaacaacc acttgggtat 2520

tgtttacgaa gctaatggta atatcgagta tcaggacttg acaccatact atagtcttat 2580

taacaagcag tgagagccta tcgattaatt aaggccgcct cgaatcctga attaacgccg 2640

aattaattcg ggggatctgg attttagtac tggattttgg ttttaggaat tagaaatttt 2700

attgatagaa gtattttaca aatacaaata catactaagg gtttcttata tgctcaacac 2760

atgagcgaaa ccctatagga accctaattc ccttatctgg gaactactca cacattatta 2820

tggagaaact cgagcttgtc gagattcgag catatgggca tgcaagcttg gcgtaatcat 2880

ggcaagtttg tacaaaaaag ttgaacgaga aacgtaaaat gatataaata tcaatatatt 2940

aaattagatt ttgcataaaa aacagactac ataatactgt aaaacacaac atatgcagtc 3000

actatgaacc aactacttag atggtattag tgacctgtag aattcgagct ctagagctgc 3060

agggcggcca tcccctatag tgagtcgtat tacatggtca tagctgtttc ctggcagctc 3120

tggcccgtgt ctcaaaatct ctgatgttac attgcacaag ataaaaatat atcatcatga 3180

acaataaaac tgtctgctta cataaacagt aatacaaggg gtgttatgag ccatattcaa 3240

cgggaaacgt cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa 3300

tgggctcgcg ataatgtcgg gcaatcaggt gcgacaatct atcgcttgta tgggaagccc 3360

gatgcgccag agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat 3420

gagatggtca gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt 3480

atccgtactc ctgatgatgc atggttactc accactgcga tccccggaaa aacagcattc 3540

caggtattag aagaatatcc tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc 3600

ctgcgccggt tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt 3660

cgtctcgctc aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat 3720

gacgagcgta atggctggcc tgttgaacaa gtctggaaag aaatgcataa acttttgcca 3780

ttctcaccgg attcagtcgt cactcatggt gatttctcac ttgataacct tatttttgac 3840

gaggggaaat taataggttg tattgatgtt ggacgagtcg gaatcgcaga ccgataccag 3900

gatcttgcca tcctatggaa ctgcctcggt gagttttctc cttcattaca gaaacggctt 3960

tttcaaaaat atggtattga taatcctgat atgaataaat tgcagtttca tttgatgctc 4020

gatgagtttt tctaatcaga attggttaat tggttgtaac actggcagag cattacgctg 4080

acttgacggg acggcgcaag ctcatgacca aaatccctta acgtgagtta cgcgtcgttc 4140

cactgagcgt cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg 4200

cgcgtaatct gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg 4260

gatcaagagc taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca 4320

aatactgttc ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg 4380

cctacatacc tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg 4440

tgtcttaccg ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga 4500

acggggggtt cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac 4560

ctacagcgtg agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat 4620

ccggtaagcg gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc 4680

tggtatcttt atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga 4740

tgctcgtcag gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc 4800

ctggcctttt gctggccttt tgctcacatg tt 4832

<210>45

<211>6323

<212>DNA

＜213〉insert fragment donor molecule pENTR-B-L1-LuFad3-GUS-E9-L2

<220>

＜221〉terminator

<222>(6042)..(6069)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(6201)..(6244)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(20)..(119)

＜223〉attL1* recombination site

<220>

<221>misc_feature

<222>(3864)..(3962)

＜223〉complement:attL2* recombination site

<220>

<221>primer bind

<222>(4039)..(4055)

<223>M13\reverse\primer

<220>

<221>misc_feature

<222>(4039)..(4055)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(5098)..(5771)

＜223〉pUC starting point

<220>

＜221〉terminator

<222>(395)..(685)

＜223〉complement:E9 the core terminator

<220>

＜221〉promotor

<222>(2784)..(3849)

＜223〉coplement:LuFAD3 promotor

<220>

＜221〉terminator

<222>(120)..(789)

＜223〉complement:rbsc E9 terminator

<220>

<221>misc_feature

<222>(886)..(2697)

＜223〉complement:GUS reporter gene

<400>45

cagtcttaag ctcgggcccc aaataatgat tttattttga ctgatagtga cctgttcgtt 60

gcaacaaatt gatgagcaat gcttttttat aatgccaact ttgtacaaaa aagcaggctg 120

gtacccggtc gattgatgca tgttgtcaat caattggcaa gtcataaaat gcattaaaaa 180

atattttcat actcaactac aaatccatga gtataactat aattataaag caatgattag 240

aatctgacaa ggattctgga aaattacata aaggaaagtt cataaatgtc taaaacacaa 300

gaggacatac ttgtattcag taacatttgc agcttttcta ggtctgaaaa tatatttgtt 360

gcctagtgaa taagcataat ggtacaacta caagtgtttt actcctcata ttaacttcgg 420

tcattagagg ccacgatttg acacattttt actcaaaaca aaatgtttgc atatctctta 480

taatttcaaa ttcaacacac aacaaataag agaaaaaaca aataatatta atttgagaat 540

gaacaaaagg accatatcat tcattaactc ttctccatcc atttccattt cacagttcga 600

tagcgaaaac cgaataaaaa acacagtaaa ttacaagcac aacaaatggt acaagaaaaa 660

cagttttccc aatgccataa tactcaaact cagtaggatt ctggtgtgtg cgcaatgaaa 720

ctgatgcatt gaacttgacg aacgttgtcg aaaccgatga tacgaacgaa agctctagct 780

agaggatcct ctagcatatg ctcgaggcgg ccttaattaa tcgataggct cggtagcaat 840

tcccgaggct gtagccgacg atggtgcgcc aggagagttg ttgattcatt gtttgcctcc 900

ctgctgcggt ttttcaccga agttcatgcc agtccagcgt ttttgcagca gaaaagccgc 960

cgacttcggt ttgcggtcgc gagtgaagat ccctttcttg ttaccgccaa cgcgcaatat 1020

gccttgcgag gtcgcaaaat cggcgaaatt ccatacctgt tcaccgacga cggcgctgac 1080

gcgatcaaag acgcggtgat acatatccag ccatgcacac tgatactctt cactccacat 1140

gtcggtgtac attgagtgca gcccggctaa cgtatccacg ccgtattcgg tgatgataat 1200

cggctgatgc agtttctcct gccaggccag aagttctttt tccagtacct tctctgccgt 1260

ttccaaatcg ccgctttgga cataccatcc gtaataacgg ttcaggcaca gcacatcaaa 1320

gagatcgctg atggtatcgg tgtgagcgtc gcagaacatt acattgacgc aggtgatcgg 1380

acgcgtcggg tcgagtttac gcgttgcttc cgccagtggc gcgaaatatt cccgtgcacc 1440

ttgcggacgg gtatccggtt cgttggcaat actccacatc accacgcttg ggtggttttt 1500

gtcacgcgct atcagctctt taatcgcctg taagtgcgct tgctgagttt ccccgttgac 1560

tgcctcttcg ctgtacagtt ctttcggctt gttgcccgct tcgaaaccaa tgcctaaaga 1620

gaggttaaag ccgacagcag cagtttcatc aatcaccacg atgccatgtt catctgccca 1680

gtcgagcatc tcttcagcgt aagggtaatg cgaggtacgg taggagttgg ccccaatcca 1740

gtccattaat gcgtggtcgt gcaccatcag cacgttatcg aatcctttgc cacgcaagtc 1800

cgcatcttca tgacgaccaa agccagtaaa gtagaacggt ttgtggttaa tcaggaactg 1860

ttcgcccttc actgccactg accggatgcc gacgcgaagc gggtagatat cacactctgt 1920

ctggcttttg gctgtgacgc acagttcata gagataacct tcacccggtt gccagaggtg 1980

cggattcacc acttgcaaag tcccgctagt gccttgtcca gttgcaacca cctgttgatc 2040

cgcatcacgc agttcaacgc tgacatcacc attggccacc acctgccagt caacagacgc 2100

gtggttacag tcttgcgcga catgcgtcac cacggtgata tcgtccaccc aggtgttcgg 2160

cgtggtgtag agcattacgc tgcgatggat tccggcatag ttaaagaaat catggaagta 2220

agactgcttt ttcttgccgt tttcgtcggt aatcaccatt cccggcggga tagtctgcca 2280

gttcagttcg ttgttcacac aaacggtgat acgtacactt ttcccggcaa taacatacgg 2340

cgtgacatcg gcttcaaatg gcgtatagcc gccctgatgc tccatcactt cctgattatt 2400

gacccacact ttgccgtaat gagtgaccgc atcgaaacgc agcacgatac gctggcctgc 2460

ccaacctttc ggtataaaga cttcgcgctg ataccagacg ttgcccgcat aattacgaat 2520

atctgcatcg gcgaactgat cgttaaaact gcctggcaca gcaattgccc ggctttcttg 2580

taacgcgctt tcccaccaac gctgatcaat tccacagttt tcgcgatcca gactgaatgc 2640

ccacaggccg tcgagttttt tgatttcacg ggttggggtt tctacaggac gtaacataag 2700

ggactgacct acccggggat ccgttaacac ctaggtaccc gggactagtc aattggcgcg 2760

ccgcggccgc agatatcaga tccgtcgtgc agagccacag ttttgaagtc actgtaatct 2820

gcaccaaaca aacccaatat atatttttga ataataatga atagactgag tggcctttgg 2880

tttcagcctc acagtattta taaccgaaga gtatgtaggt tggtgagaac taacgaagaa 2940

gaagtaatgc aggatgccaa gtggatggag aagagtaaat ggaaatgcaa aatgtacact 3000

gatttcagac aaactagcct acaccaccca accccttttt ttttgctctt tattgggttt 3060

cagtttaggc aacggttgtt gttacttgct ctgttgaaag acaaatgaaa aggagccgtt 3120

gctggctgct aggttcttca atttcagtat caatggtggt gggcaaatct ttgattcaaa 3180

cacatggcaa cttccttcaa tggtatctag gaaacctatg tgcatgcatg agttaccaca 3240

aatgtgatga tatcaactta ttagttcttt taattaagga ttagtgattt ggcggagtcg 3300

caacgggcac tgctgagttc gcgggagcta gggtggaatc gactaatcaa ctcatgtgac 3360

tcaagtgggc atcggtctta gggagtaagt tcgggcaagt ttcgggcaga gggatttgtg 3420

catgtgttta ggatcacaag gggggtattg gttgtccttc ggtccgagaa tgtgaagtac 3480

gaggtcttcc agatgctatg tagtgggttg ggaacaaggc agagatatgg acgagcttga 3540

ctttgttttc acaaactgat gatcaaactt tgggctccat ttgaacttag tcgaaactct 3600

tacaactctc ttgctttgca atcgaataat agatggatta ttgaattgca aagtgaacac 3660

taatgaaagt gagtgcatag aaaactaagg attaatgatg ctgatgatga tgagtgatgc 3720

tggtaacaac tgtggtaaag aatggcactg taaaggtgaa caaaacatcc acccacgtac 3780

tgatcaataa actttagcag acaatcagac cattttcctt ttgtttggac ccttttgtgg 3840

gaataagctt ggcgtaatca tggacccagc tttcttgtac aaagttggca ttataagaaa 3900

gcattgctta tcaatttgtt gcaacgaaca ggtcactatc agtcaaaata aaatcattat 3960

ttgccatcca gctgatccgg tgcaggttgg cggcggcgtg cgtagcgaag aatcccctat 4020

agtgagtcgt attacatggt catagctgtt tcctggcagc tctggcccgt gtctcaaaat 4080

ctctgatgtt acattgcaca agataaaaat atatcatcat gaacaataaa actgtctgct 4140

tacataaaca gtaatacaag gggtgttatg agccatattc aacgggaaac gtcgaggccg 4200

cgattaaatt ccaacatgga tgctgattta tatgggtata aatgggctcg cgataatgtc 4260

gggcaatcag gtgcgacaat ctatcgcttg tatgggaagc ccgatgcgcc agagttgttt 4320

ctgaaacatg gcaaaggtag cgttgccaat gatgttacag atgagatggt cagactaaac 4380

tggctgacgg aatttatgcc tcttccgacc atcaagcatt ttatccgtac tcctgatgat 4440

gcatggttac tcaccactgc gatccccgga aaaacagcat tccaggtatt agaagaatat 4500

cctgattcag gtgaaaatat tgttgatgcg ctggcagtgt tcctgcgccg gttgcattcg 4560

attcctgttt gtaattgtcc ttttaacagc gatcgcgtat ttcgtctcgc tcaggcgcaa 4620

tcacgaatga ataacggttt ggttgatgcg agtgattttg atgacgagcg taatggctgg 4680

cctgttgaac aagtctggaa agaaatgcat aaacttttgc cattctcacc ggattcagtc 4740

gtcactcatg gtgatttctc acttgataac cttatttttg acgaggggaa attaataggt 4800

tgtattgatg ttggacgagt cggaatcgca gaccgatacc aggatcttgc catcctatgg 4860

aactgcctcg gtgagttttc tccttcatta cagaaacggc tttttcaaaa atatggtatt 4920

gataatcctg atatgaataa attgcagttt catttgatgc tcgatgagtt tttctaatca 4980

gaattggtta attggttgta acactggcag agcattacgc tgacttgacg ggacggcgca 5040

agctcatgac caaaatccct taacgtgagt tacgcgtcgt tccactgagc gtcagacccc 5100

gtagaaaaga tcaaaggatc ttcttgagat cctttttttc tgcgcgtaat ctgctgcttg 5160

caaacaaaaa aaccaccgct accagcggtg gtttgtttgc cggatcaaga gctaccaact 5220

ctttttccga aggtaactgg cttcagcaga gcgcagatac caaatactgt ccttctagtg 5280

tagccgtagt taggccacca cttcaagaac tctgtagcac cgcctacata cctcgctctg 5340

ctaatcctgt taccagtggc tgctgccagt ggcgataagt cgtgtcttac cgggttggac 5400

tcaagacgat agttaccgga taaggcgcag cggtcgggct gaacgggggg ttcgtgcaca 5460

cagcccagct tggagcgaac gacctacacc gaactgagat acctacagcg tgagcattga 5520

gaaagcgcca cgcttcccga agggagaaag gcggacaggt atccggtaag cggcagggtc 5580

ggaacaggag agcgcacgag ggagcttcca gggggaaacg cctggtatct ttatagtcct 5640

gtcgggtttc gccacctctg acttgagcgt cgatttttgt gatgctcgtc aggggggcgg 5700

agcctatgga aaaacgccag caacgcggcc tttttacggt tcctggcctt ttgctggcct 5760

tttgctcaca tgttctttcc tgcgttatcc cctgattctg tggataaccg tattaccgcc 5820

tttgagtgag ctgataccgc tcgccgcagc cgaacgaccg agcgcagcga gtcagtgagc 5880

gaggaagcgg aagagcgccc aatacgcaaa ccgcctctcc ccgcgcgttg gccgattcat 5940

taatgcagct ggcacgacag gtttcccgac tggaaagcgg gcagtgagcg caacgcaatt 6000

aatacgcgta ccgctagcca ggaagagttt gtagaaacgc aaaaaggcca tccgtcagga 6060

tggccttctg cttagtttga tgcctggcag tttatggcgg gcgtcctgcc cgccaccctc 6120

cgggccgttg cttcacaacg ttcaaatccg ctcccggcgg atttgtccta ctcaggagag 6180

cgttcaccga caaacaacag ataaaacgaa aggcccagtc ttccgactga gcctttcgtt 6240

ttatttgatg cctggcagtt ccctactctc gcgttaacgc tagcatggat gttttcccag 6300

tcacgacgtt gtaaaacgac ggc 6323

<210>46

<211>4586

<212>DNA

＜213〉insert fragment donor molecule pENTR-C-R2-LeB4-700 ∷ GFP ∷ LeB3t-L3

<220>

＜221〉terminator

<222>(268)..(295)

＜223〉complement:rrnB T2 transcribe stop

<220>

＜221〉terminator

<222>(427)..(470)

＜223〉complement:rrnB T1 transcribe stop

<220>

<221>misc_feature

<222>(591)..(747)

＜223〉attR2* recombination site

<220>

<221>misc_feature

<222>(2700)..(2795)

＜223〉complement:attL3* recombination site

<220>

<221>misc_feature

<222>(2980)..(3789)

＜223〉CDS: coding kalamycin resistance

<220>

<221>misc_feature

<222>(3910)..(4583)

＜223〉PUC starting point

<220>

＜221〉terminator

<222>(2372)..(2668)

＜223〉LeB3 ' UT terminator

<220>

<221>misc_feature

<222>(1544)..(2361)

＜223〉CDS:coding for GFP the 5er reporter gene

<220>

＜221〉promotor

<222>(777)..(1540)

＜223〉LeB4-700 promotor

<400>46

ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60

taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120

gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180

cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240

tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300

gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360

acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420

caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480

gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540

aacgacggcc agtcttaagc tcgggccctg cagctctaga gctcgaattc tacaggtcac 600

taataccatc taagtagttg gttcatagtg actgcatatg ttgtgtttta cagtattatg 660

tagtctgttt tttatgcaaa atctaattta atatattgat atttatatca ttttacgttt 720

ctcgttcaac tttcttgtac aaagtggggt acccggggat cctctagcat atgctcgagt 780

taccatttct ttttcctgca tctcaatagt atatagggta tcaaatagtg attatccaaa 840

cttaaataag ttagaggaaa caccaagata tgccatatac tctcaaattt gacactatga 900

ttcaaagttg cacttgcata aaacttatta attcaatagt aaaaccaaac ttgtgcgtga 960

tacagttaaa atgactaaac tactaattaa ggtccctccc attagtaaat aagttatttt 1020

tttagaaaaa gaaaataata aaaagaatga cgagtctatc taaatcatat taacaagtaa 1080

tacatattga ttcattcgat ggaggaggcc aataattgta gtaaacaagc agtgccgagg 1140

ttaatatatg ctcaagacag taaataatct aaatgaatta agacagtgat ttgcaaagag 1200

tagatgcaga gaagagaact aaagatttgc tgctacacgt atataagaat agcaacagat 1260

attcattctg tctctttgtg gaatatggat atctactaat catcatctat ctgtgaagaa 1320

taaaagaagc ggccacaagc gcagcgtcgc acatatgatg tgtatcaaat taggactcca 1380

tagccatgca tgctgaagaa tgtcacacac gttctgtcac acgtgttact ctctcactgt 1440

tctcctcttc ctataaatca ccgcgccaca gcttctccac ttcaccactt caccacttca 1500

ctcacaatcc ttcattagtt gtttactatc acagtcacag atccaaggag atataacaat 1560

gaagactaat ctttttctct ttctcatctt ttcacttctc ctatcattat cctcggccga 1620

attcagtaaa ggagaagaac ttttcactgg agttgtccca attcttgttg aattagatgg 1680

tgatgttaat gggcacaaat tttctgtcag tggagagggt gaaggtgatg caacatacgg 1740

aaaacttacc cttaaattta tttgcactac tggaaaacta cctgttccat ggccaacact 1800

tgtcactact ttctcttatg gtgttcaatg cttttcaaga tacccagatc atatgaagcg 1860

gcacgacttc ttcaagagcg ccatgcctga gggatacgtg caggagagga ccatcttctt 1920

caaggacgac gggaactaca agacacgtgc tgaagtcaag tttgagggag acaccctcgt 1980

caacaggatc gagcttaagg gaatcgattt caaggaggac ggaaacatcc tcggccacaa 2040

gttggaatac aactacaact cccacaacgt atacatcatg gccgacaagc aaaagaacgg 2100

catcaaagcc aacttcaaga cccgccacaa catcgaagac ggcggcgtgc aactcgctga 2160

tcattatcaa caaaatactc caattggcga tggccctgtc cttttaccag acaaccatta 2220

cctgtccaca caatctgccc tttcgaaaga tcccaacgaa aagagagacc acatggtcct 2280

tcttgagttt gtaacagctg ctgggattac acatggcatg gatgaactat acaaacatga 2340

tgagctttaa gagaacggat ctggtcgacc gatcctgcaa tagaatgttg aggtgaccac 2400

tttctgtaat aaaataatta taaaataaat ttagaattgc tgtagtcaag aacatcagtt 2460

ctaaaatatt aataaagtta tggccttttg acatatgtgt ttcgataaaa aaatcaaaat 2520

aaattgagat ttattcgaaa tacaatgaaa gtttgcagat atgagatatg tttctacaaa 2580

ataataactt aaaactcaac tatatgctaa tgtttttctt ggtgtgtttc atagaaaatt 2640

gtatccgttt cttagaaaat gctcgtaagg atcggcatgc aagcttggcg taatcatggc 2700

aactttatta tacaaagttg gcattataaa aaagcattgc ttatcaattt gttgcaacga 2760

acaggtcact atcagtcaaa ataaaatcat tatttggagc tccatggtag cgttaacgcg 2820

gccatcccct atagtgagtc gtattacatg gtcatagctg tttcctggca gctctggccc 2880

gtgtctcaaa atctctgatg ttacattgca caagataaaa atatatcatc atgaacaata 2940

aaactgtctg cttacataaa cagtaataca aggggtgtta tgagccatat tcaacgggaa 3000

acgtcgaggc cgcgattaaa ttccaacatg gatgctgatt tatatgggta taaatgggct 3060

cgcgataatg tcgggcaatc aggtgcgaca atctatcgct tgtatgggaa gcccgatgcg 3120

ccagagttgt ttctgaaaca tggcaaaggt agcgttgcca atgatgttac agatgagatg 3180

gtcagactaa actggctgac ggaatttatg cctcttccga ccatcaagca ttttatccgt 3240

actcctgatg atgcatggtt actcaccact gcgatccccg gaaaaacagc attccaggta 3300

ttagaagaat atcctgattc aggtgaaaat attgttgatg cgctggcagt gttcctgcgc 3360

cggttgcatt cgattcctgt ttgtaattgt ccttttaaca gcgatcgcgt atttcgtctc 3420

gctcaggcgc aatcacgaat gaataacggt ttggttgatg cgagtgattt tgatgacgag 3480

cgtaatggct ggcctgttga acaagtctgg aaagaaatgc ataaactttt gccattctca 3540

ccggattcag tcgtcactca tggtgatttc tcacttgata accttatttt tgacgagggg 3600

aaattaatag gttgtattga tgttggacga gtcggaatcg cagaccgata ccaggatctt 3660

gccatcctat ggaactgcct cggtgagttt tctccttcat tacagaaacg gctttttcaa 3720

aaatatggta ttgataatcc tgatatgaat aaattgcagt ttcatttgat gctcgatgag 3780

tttttctaat cagaattggt taattggttg taacactggc agagcattac gctgacttga 3840

cgggacggcg caagctcatg accaaaatcc cttaacgtga gttacgcgtc gttccactga 3900

gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag atcctttttt tctgcgcgta 3960

atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg tggtttgttt gccggatcaa 4020

gagctaccaa ctctttttcc gaaggtaact ggcttcagca gagcgcagat accaaatact 4080

gttcttctag tgtagccgta gttaggccac cacttcaaga actctgtagc accgcctaca 4140

tacctcgctc tgctaatcct gttaccagtg gctgctgcca gtggcgataa gtcgtgtctt 4200

accgggttgg actcaagacg atagttaccg gataaggcgc agcggtcggg ctgaacgggg 4260

ggttcgtgca cacagcccag cttggagcga acgacctaca ccgaactgag atacctacag 4320

cgtgagctat gagaaagcgc cacgcttccc gaagggagaa aggcggacag gtatccggta 4380

agcggcaggg tcggaacagg agagcgcacg agggagcttc cagggggaaa cgcctggtat 4440

ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc gtcgattttt gtgatgctcg 4500

tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg cctttttacg gttcctggcc 4560

ttttgctggc cttttgctca catgtt 4586

<210>47

<211>33

<212>DNA

＜213〉Oligonucleolide primers Loy277 attR4 EcoRV

<400>47

aaaaaagata tcgattacgc caagctatca act 33

<210>48

<211>32

<212>DNA

＜213〉Oligonucleolide primers Loy278 attR3 EcoRV

<400>48

aaaaaagata tccggccagt gaattatcaa ct 32

<210>49

<211>9227

<212>DNA

＜213〉insert sheet receptor seq (carrier donor) molecular vehicle L0338-pSUN2-GW-R4R3

<220>

<221>misc_feature

<222>(24)..(148)

＜223〉attR4* recombination site

<220>

<221>misc_feature

<222>(1601)..(1725)

＜223〉complement:attR3* recombination site

<220>

<221>misc_feature

<222>(188)..(493)

＜223〉the anti-selective marker of complement:CDS-coding ccdB

<220>

<221>misc_feature

<222>(813)..(1493)

＜223〉complement:CDS-coding chlorampenicol resistant var

<220>

<221>misc_feature

<222>(9044)..(9189)

＜223〉agrobatcerium T-DNA right hand edge (RB)

<220>

<221>misc_feature

<222>(3285)..(3499)

＜223〉complement: agrobatcerium T-DNA left hand edge (LB)

<220>

＜221〉promotor

<222>(1788)..(2124)

＜223〉no promotor

<220>

<221>misc_feature

<222>(2145)..(2923)

＜223〉CDS: coding ntpII kalamycin resistance

<220>

＜221〉terminator

<222>(3016)..(3271)

＜223〉no terminator (nosT)

<220>

<221>misc_feature

<222>(8079)..(8870)

＜223〉complement:CDS-coding spectinomycin/streptomycin resistance (aadA)

<220>

<221>rep_origin

<222>(7064)..(7910)

＜223〉ColE1 replication orgin

<400>49

agctatcgat tacgccaagc tatcaacttt gtatagaaaa gttgaacgag aaacgtaaaa 60

tgatataaat atcaatatat taaattagat tttgcataaa aaacagacta cataatactg 120

taaaacacaa catatccagt cactatggtc gacctgcaga ctggctgtgt ataagggagc 180

ctgacattta tattccccag aacatcaggt taatggcgtt tttgatgtca ttttcgcggt 240

ggctgagatc agccacttct tccccgataa cggagaccgg cacactggcc atatcggtgg 300

tcatcatgcg ccagctttca tccccgatat gcaccaccgg gtaaagttca cgggggactt 360

tatctgacag cagacgtgca ctggccaggg ggatcaccat ccgtcgcccg ggcgtgtcaa 420

taatatcact ctgtacatcc acaaacagac gataacggct ctctctttta taggtgtaaa 480

ccttaaactg catttcacca gcccctgttc tcgtcggcaa aagagccgtt catttcaata 540

aaccgggcga cctcagccat cccttcctga ttttccgctt tccagcgttc ggcacgcaga 600

cgacgggctt cattctgcat ggttgtgctt accgaaccgg agatattgac atcatatatg 660

ccttgagcaa ctgatagctg tcgctgtcaa ctgtcactgt aatacgctgc ttcatagcat 720

acctcttttt gacatacttc gggtatacat atcagtatat attcttatac cgcaaaaatc 780

agcgcgcaaa tacgcatact gttatctggc ttttagtaag ccggatcctc tagattacgc 840

cccgcctgcc actcatcgca gtactgttgt aattcattaa gcattctgcc gacatggaag 900

ccatcacaaa cggcatgatg aacctgaatc gccagcggca tcagcacctt gtcgccttgc 960

gtataatatt tgcccatggt gaaaacgggg gcgaagaagt tgtccatatt ggccacgttt 1020

aaatcaaaac tggtgaaact cacccaggga ttggctgaga cgaaaaacat attctcaata 1080

aaccctttag ggaaataggc caggttttca ccgtaacacg ccacatcttg cgaatatatg 1140

tgtagaaact gccggaaatc gtcgtggtat tcactccaga gcgatgaaaa cgtttcagtt 1200

tgctcatgga aaacggtgta acaagggtga acactatccc atatcaccag ctcaccgtct 1260

ttcattgcca tacggaattc cggatgagca ttcatcaggc gggcaagaat gtgaataaag 1320

gccggataaa acttgtgctt atttttcttt acggtcttta aaaaggccgt aatatccagc 1380

tgaacggtct ggttataggt acattgagca actgactgaa atgcctcaaa atgttcttta 1440

cgatgccatt gggatatatc aacggtggta tatccagtga tttttttctc cattttagct 1500

tccttagctc ctgaaaatct cgacggatcc taactcaaaa tccacacatt atacgagccg 1560

gaagcataaa gtgtaaagcc tggggtgcct aatgcggccg ccatagtgac tggatatgtt 1620

gtgttttaca gtattatgta gtctgttttt tatgcaaaat ctaatttaat atattgatat 1680

ttatatcatt ttacgtttct cgttcaactt tattatacat agttgataat tcactggccg 1740

gataattcac tggccgtcgt tttacaacga ctcaggatcc tgtcaaacac tgatagttta 1800

aactgaaggc gggaaacgac aatctgatca tgagcggaga attaagggag tcacgttatg 1860

acccccgccg atgacgcggg acaagccgtt ttacgtttgg aactgacaga accgcaacgt 1920

tgaaggagcc actcagccgc gggtttctgg agtttaatga gctaagcaca tacgtcagaa 1980

accattattg cgcgttcaaa agtcgcctaa ggtcactatc agctagcaaa tatttcttgt 2040

caaaaatgct ccactgacgt tccataaatt cccctcggta tccaattaga gtctcatatt 2100

cactctcaat ccaaataatc tgcaccggat ctggatcgtt tcgcatgatt gaacaagatg 2160

gattgcacgc aggttctccg gccgcttggg tggagaggct attcggctat gactgggcac 2220

aacagacaat cggctgctct gatgccgccg tgttccggct gtcagcgcag gggcgcccgg 2280

ttctttttgt caagaccgac ctgtccggtg ccctgaatga actgcaggac gaggcagcgc 2340

ggctatcgtg gctggccacg acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg 2400

aagcgggaag ggactggctg ctattgggcg aagtgccggg gcaggatctc ctgtcatctc 2460

accttgctcc tgccgagaaa gtatccatca tggctgatgc aatgcggcgg ctgcatacgc 2520

ttgatccggc tacctgccca ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta 2580

ctcggatgga agccggtctt gtcgatcagg atgatctgga cgaagagcat caggggctcg 2640

cgccagccga actgttcgcc aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg 2700

tgacccatgg cgatgcctgc ttgccgaata tcatggtgga aaatggccgc ttttctggat 2760

tcatcgactg tggccggctg ggtgtggcgg accgctatca ggacatagcg ttggctaccc 2820

gtgatattgc tgaagagctt ggcggcgaat gggctgaccg cttcctcgtg ctttacggta 2880

tcgccgctcc cgattcgcag cgcatcgcct tctatcgcct tcttgacgag ttcttctgag 2940

cgggacccaa gctctagatc ttgctgcgtt cggatatttt cgtggagttc ccgccacaga 3000

cccggatgat ccccgatcgt tcaaacattt ggcaataaag tttcttaaga ttgaatcctg 3060

ttgccggtct tgcgatgatt atcatataat ttctgttgaa ttacgttaag catgtaataa 3120

ttaacatgta atgcatgacg ttatttatga gatgggtttt tatgattaga gtcccgcaat 3180

tatacattta atacgcgata gaaaacaaaa tatagcgcgc aaactaggat aaattatcgc 3240

gcgcggtgtc atctatgtta ctagatcggg cctcctgtca agctctgctt ggtaataatt 3300

gtcattagat tgtttttatg catagatgca ctcgaaatca gccaatttta gacaagtatc 3360

aaacggatgt taattcagta cattaaagac gtccgcaatg tgttattaag ttgtctaagc 3420

gtcaatttgt ttacaccaca atatatcctg ccaccagcca gccaacagct ccccgaccgg 3480

cagctcggca caaaatcacc acgcgttacc accacgccgg ccggccgcat ggtgttgacc 3540

gtgttcgccg gcattgccga gttcgagcgt tccctaatca tcgaccgcac ccggagcggg 3600

cgcgaggccg ccaaggcccg aggcgtgaag tttggccccc gccctaccct caccccggca 3660

cagatcgcgc acgcccgcga gctgatcgac caggaaggcc gcaccgtgaa agaggcggct 3720

gcactgcttg gcgtgcatcg ctcgaccctg taccgcgcac ttgagcgcag cgaggaagtg 3780

acgcccaccg aggccaggcg gcgcggtgcc ttccgtgagg acgcattgac cgaggccgac 3840

gccctggcgg ccgccgagaa tgaacgccaa gaggaacaag catgaaaccg caccaggacg 3900

gccaggacga accgtttttc attaccgaag agatcgaggc ggagatgatc gcggccgggt 3960

acgtgttcga gccgcccgcg cacgtctcaa ccgtgcggct gcatgaaatc ctggccggtt 4020

tgtctgatgc caagctggcg gcctggccgg ccagcttggc cgctgaagaa accgagcgcc 4080

gccgtctaaa aaggtgatgt gtatttgagt aaaacagctt gcgtcatgcg gtcgctgcgt 4140

atatgatgcg atgagtaaat aaacaaatac gcaaggggaa cgcatgaagg ttatcgctgt 4200

acttaaccag aaaggcgggt caggcaagac gaccatcgca acccatctag cccgcgccct 4260

gcaactcgcc ggggccgatg ttctgttagt cgattccgat ccccagggca gtgcccgcga 4320

ttgggcggcc gtgcgggaag atcaaccgct aaccgttgtc ggcatcgacc gcccgacgat 4380

tgaccgcgac gtgaaggcca tcggccggcg cgacttcgta gtgatcgacg gagcgcccca 4440

ggcggcggac ttggctgtgt ccgcgatcaa ggcagccgac ttcgtgctga ttccggtgca 4500

gccaagccct tacgacatat gggccaccgc cgacctggtg gagctggtta agcagcgcat 4560

tgaggtcacg gatggaaggc tacaagcggc ctttgtcgtg tcgcgggcga tcaaaggcac 4620

gcgcatcggc ggtgaggttg ccgaggcgct ggccgggtac gagctgccca ttcttgagtc 4680

ccgtatcacg cagcgcgtga gctacccagg cactgccgcc gccggcacaa ccgttcttga 4740

atcagaaccc gagggcgacg ctgcccgcga ggtccaggcg ctggccgctg aaattaaatc 4800

aaaactcatt tgagttaatg aggtaaagag aaaatgagca aaagcacaaa cacgctaagt 4860

gccggccgtc cgagcgcacg cagcagcaag gctgcaacgt tggccagcct ggcagacacg 4920

ccagccatga agcgggtcaa ctttcagttg ccggcggagg atcacaccaa gctgaagatg 4980

tacgcggtac gccaaggcaa gaccattacc gagctgctat ctgaatacat cgcgcagcta 5040

ccagagtaaa tgagcaaatg aataaatgag tagatgaatt ttagcggcta aaggaggcgg 5100

catggaaaat caagaacaac caggcaccga cgccgtggaa tgccccatgt gtggaggaac 5160

gggcggttgg ccaggcgtaa gcggctgggt tgtctgccgg ccctgcaatg gcactggaac 5220

ccccaagccc gaggaatcgg cgtgagcggt cgcaaaccat ccggcccggt acaaatcggc 5280

gcggcgctgg gtgatgacct ggtggagaag ttgaaggccg cgcaggccgc ccagcggcaa 5340

cgcatcgagg cagaagcacg ccccggtgaa tcgtggcaag cggccgctga tcgaatccgc 5400

aaagaatccc ggcaaccgcc ggcagccggt gcgccgtcga ttaggaagcc gcccaagggc 5460

gacgagcaac cagatttttt cgttccgatg ctctatgacg tgggcacccg cgatagtcgc 5520

agcatcatgg acgtggccgt tttccgtctg tcgaagcgtg accgacgagc tggcgaggtg 5580

atccgctacg agcttccaga cgggcacgta gaggtttccg cagggccggc cggcatggcc 5640

agtgtgtggg attacgacct ggtactgatg gcggtttccc atctaaccga atccatgaac 5700

cgataccggg aagggaaggg agacaagccc ggccgcgtgt tccgtccaca cgttgcggac 5760

gtactcaagt tctgccggcg agccgatggc ggaaagcaga aagacgacct ggtagaaacc 5820

tgcattcggt taaacaccac gcacgttgcc atgcagcgta cgaagaaggc caagaacggc 5880

cgcctggtga cggtatccga gggtgaagcc ttgattagcc gctacaagat cgtaaagagc 5940

gaaaccgggc ggccggagta catcgagatc gagctagctg attggatgta ccgcgagatc 6000

acagaaggca agaacccgga cgtgctgacg gttcaccccg attacttttt gatcgatccc 6060

ggcatcggcc gttttctcta ccgcctggca cgccgcgccg caggcaaggc agaagccaga 6120

tggttgttca agacgatcta cgaacgcagt ggcagcgccg gagagttcaa gaagttctgt 6180

ttcaccgtgc gcaagctgat cgggtcaaat gacctgccgg agtacgattt gaaggaggag 6240

gcggggcagg ctggcccgat cctagtcatg cgctaccgca acctgatcga gggcgaagca 6300

tccgccggtt cctaatgtac ggagcagatg ctagggcaaa ttgccctagc aggggaaaaa 6360

ggtcgaaaag gtctctttcc tgtggatagc acgtacattg ggaacccaaa gccgtacatt 6420

gggaaccgga acccgtacat tgggaaccca aagccgtaca ttgggaaccg gtcacacatg 6480

taagtgactg atataaaaga gaaaaaaggc gatttttccg cctaaaactc tttaaaactt 6540

attaaaactc ttaaaacccg cctggcctgt gcataactgt ctggccagcg cacagccgaa 6600

gagctgcaaa aagcgcctac ccttcggtcg ctgcgctccc tacgccccgc cgcttcgcgt 6660

cggcctatcg cggccgctgg ccgctcaaaa atggctggcc tacggccagg caatctacca 6720

gggcgcggac aagccgcgcc gtcgccactc gaccgccggc gcccacatca aggcaccctg 6780

cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt 6840

cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg 6900

tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac 6960

tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat gcggtgtgaa 7020

ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc ttcctcgctc 7080

actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca ctcaaaggcg 7140

gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg agcaaaaggc 7200

cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca taggctccgc 7260

ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa cccgacagga 7320

ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc tgttccgacc 7380

ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc gctttctcat 7440

agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct gggctgtgtg 7500

cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg tcttgagtcc 7560

aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag gattagcaga 7620

gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta cggctacact 7680

agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg aaaaagagtt 7740

ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt tgtttgcaag 7800

cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt ttctacgggg 7860

tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgca tgatatatct 7920

cccaatttgt gtagggctta ttatgcacgc ttaaaaataa taaaagcaga cttgacctga 7980

tagtttggct gtgagcaatt atgtgcttag tgcatctaac gcttgagtta agccgcgccg 8040

cgaagcggcg tcggcttgaa cgaatttcta gctagacatt atttgccgac taccttggtg 8100

atctcgcctt tcacgtagtg gacaaattct tccaactgat ctgcgcgcga ggccaagcga 8160

tcttcttctt gtccaagata agcctgtcta gcttcaagta tgacgggctg atactgggcc 8220

ggcaggcgct ccattgccca gtcggcagcg acatccttcg gcgcgatttt gccggttact 8280

gcgctgtacc aaatgcggga caacgtaagc actacatttc gctcatcgcc agcccagtcg 8340

ggcggcgagt tccatagcgt taaggtttca tttagcgcct caaatagatc ctgttcagga 8400

accggatcaa agagttcctc cgccgctgga cctaccaagg caacgctatg ttctcttgct 8460

tttgtcagca agatagccag atcaatgtcg atcgtggctg gctcgaagat acctgcaaga 8520

atgtcattgc gctgccattc tccaaattgc agttcgcgct tagctggata acgccacgga 8580

atgatgtcgt cgtgcacaac aatggtgact tctacagcgc ggagaatctc gctctctcca 8640

ggggaagccg aagtttccaa aaggtcgttg atcaaagctc gccgcgttgt ttcatcaagc 8700

cttacggtca ccgtaaccag caaatcaata tcactgtgtg gcttcaggcc gccatccact 8760

gcggagccgt acaaatgtac ggccagcaac gtcggttcga gatggcgctc gatgacgcca 8820

actacctctg atagttgagt cgatacttcg gcgatcaccg cttcccccat gatgtttaac 8880

tttgttttag ggcgactgcc ctgctgcgta acatcgttgc tgctccataa catcaaacat 8940

cgacccacgg cgtaacgcgc ttgctgcttg gatgcccgag gcatagactg taccccaaaa 9000

aaacagtcat aacaagccat gaaaaccgcc actgcgttcc atggacatac aaatggacga 9060

acggataaac cttttcacgc ccttttaaat atccgattat tctaataaac gctcttttct 9120

cttaggttta cccgccaata tatcctgtca aacactgata gtttaaactg aaggcgggaa 9180

acgacaatca gatctagtag gaaacagcta tgaccatgat tacgcca 9227

<210>50

<211>9227

<212>DNA

＜213〉insert sheet receptor seq (carrier donor) molecular vehicle L0339-pSUN2-GW-R3R4

<220>

<221>misc_feature

<222>(9022)..(9167)

＜223〉agrobatcerium T-DNA right hand edge (RB)

<220>

<221>misc_feature

<222>(3263)..(3477)

＜223〉agrobatcerium T-DNA left hand edge (LB)

<220>

＜221〉promotor

<222>(1766)..(2102)

＜223〉no promotor (nosP)

<220>

<221>misc_feature

<222>(2123)..(2901)

＜223〉CDS-coding nptII kalamycin resistance

<220>

＜221〉terminator

<222>(2994)..(3249)

＜223〉no terminator (nosT)

<220>

<221>misc_feature

<222>(1578)..(1702)

＜223〉complement:attR4* recombination site

<220>

<221>misc_feature

<222>(1)..(125)

＜223〉attR3* recombination site

<220>

<221>misc_feature

<222>(1233)..(1538)

＜223〉the anti-selective marker of CDS-coding ccdB

<220>

<221>misc_feature

<222>(233)..(913)

＜223〉CDS-coding chlorampenicol resistant var

<400>50

caactatgta taataaagtt gaacgagaaa cgtaaaatga tataaatatc aatatattaa 60

attagatttt gcataaaaaa cagactacat aatactgtaa aacacaacat atccagtcac 120

tatggcggcc gcattaggca ccccaggctt tacactttat gcttccggct cgtataatgt 180

gtggattttg agttaggatc cgtcgagatt ttcaggagct aaggaagcta aaatggagaa 240

aaaaatcact ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga 300

ggcatttcag tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc 360

ctttttaaag accgtaaaga aaaataagca caagttttat ccggccttta ttcacattct 420

tgcccgcctg atgaatgctc atccggaatt ccgtatggca atgaaagacg gtgagctggt 480

gatatgggat agtgttcacc cttgttacac cgttttccat gagcaaactg aaacgttttc 540

atcgctctgg agtgaatacc acgacgattt ccggcagttt ctacacatat attcgcaaga 600

tgtggcgtgt tacggtgaaa acctggccta tttccctaaa gggtttattg agaatatgtt 660

tttcgtctca gccaatccct gggtgagttt caccagtttt gatttaaacg tggccaatat 720

ggacaacttc ttcgcccccg ttttcaccat gggcaaatat tatacgcaag gcgacaaggt 780

gctgatgccg ctggcgattc aggttcatca tgccgtttgt gatggcttcc atgtcggcag 840

aatgcttaat gaattacaac agtactgcga tgagtggcag gcggggcgta atctagagga 900

tccggcttac taaaagccag ataacagtat gcgtatttgc gcgctgattt ttgcggtata 960

agaatatata ctgatatgta tacccgaagt atgtcaaaaa gaggtatgct atgaagcagc 1020

gtattacagt gacagttgac agcgacagct atcagttgct caaggcatat atgatgtcaa 1080

tatctccggt tcggtaagca caaccatgca gaatgaagcc cgtcgtctgc gtgccgaacg 1140

ctggaaagcg gaaaatcagg aagggatggc tgaggtcgcc cggtttattg aaatgaacgg 1200

ctcttttgcc gacgagaaca ggggctggtg aaatgcagtt taaggtttac acctataaaa 1260

gagagagccg ttatcgtctg tttgtggatg tacagagtga tattattgac acgcccgggc 1320

gacggatggt gatccccctg gccagtgcac gtctgctgtc agataaagtc ccccgtgaac 1380

tttacccggt ggtgcatatc ggggatgaaa gctggcgcat gatgaccacc gatatggcca 1440

gtgtgccggt ctccgttatc ggggaagaag tggctgatct cagccaccgc gaaaatgaca 1500

tcaaaaacgc cattaacctg atgttctggg gaatataaat gtcaggctcc cttatacaca 1560

gccagtctgc aggtcgacca tagtgactgg atatgttgtg ttttacagta ttatgtagtc 1620

tgttttttat gcaaaatcta atttaatata ttgatattta tatcatttta cgtttctcgt 1680

tcaacttttc tatacaaagt tgatagcttg gcgtaatcga taattcactg gccgtcgttt 1740

tacaacgact caggatcctg tcaaacactg atagtttaaa ctgaaggcgg gaaacgacaa 1800

tctgatcatg agcggagaat taagggagtc acgttatgac ccccgccgat gacgcgggac 1860

aagccgtttt acgtttggaa ctgacagaac cgcaacgttg aaggagccac tcagccgcgg 1920

gtttctggag tttaatgagc taagcacata cgtcagaaac cattattgcg cgttcaaaag 1980

tcgcctaagg tcactatcag ctagcaaata tttcttgtca aaaatgctcc actgacgttc 2040

cataaattcc cctcggtatc caattagagt ctcatattca ctctcaatcc aaataatctg 2100

caccggatct ggatcgtttc gcatgattga acaagatgga ttgcacgcag gttctccggc 2160

cgcttgggtg gagaggctat tcggctatga ctgggcacaa cagacaatcg gctgctctga 2220

tgccgccgtg ttccggctgt cagcgcaggg gcgcccggtt ctttttgtca agaccgacct 2280

gtccggtgcc ctgaatgaac tgcaggacga ggcagcgcgg ctatcgtggc tggccacgac 2340

gggcgttcct tgcgcagctg tgctcgacgt tgtcactgaa gcgggaaggg actggctgct 2400

attgggcgaa gtgccggggc aggatctcct gtcatctcac cttgctcctg ccgagaaagt 2460

atccatcatg gctgatgcaa tgcggcggct gcatacgctt gatccggcta cctgcccatt 2520

cgaccaccaa gcgaaacatc gcatcgagcg agcacgtact cggatggaag ccggtcttgt 2580

cgatcaggat gatctggacg aagagcatca ggggctcgcg ccagccgaac tgttcgccag 2640

gctcaaggcg cgcatgcccg acggcgagga tctcgtcgtg acccatggcg atgcctgctt 2700

gccgaatatc atggtggaaa atggccgctt ttctggattc atcgactgtg gccggctggg 2760

tgtggcggac cgctatcagg acatagcgtt ggctacccgt gatattgctg aagagcttgg 2820

cggcgaatgg gctgaccgct tcctcgtgct ttacggtatc gccgctcccg attcgcagcg 2880

catcgccttc tatcgccttc ttgacgagtt cttctgagcg ggacccaagc tctagatctt 2940

gctgcgttcg gatattttcg tggagttccc gccacagacc cggatgatcc ccgatcgttc 3000

aaacatttgg caataaagtt tcttaagatt gaatcctgtt gccggtcttg cgatgattat 3060

catataattt ctgttgaatt acgttaagca tgtaataatt aacatgtaat gcatgacgtt 3120

atttatgaga tgggttttta tgattagagt cccgcaatta tacatttaat acgcgataga 3180

aaacaaaata tagcgcgcaa actaggataa attatcgcgc gcggtgtcat ctatgttact 3240

agatcgggcc tcctgtcaag ctctgcttgg taataattgt cattagattg tttttatgca 3300

tagatgcact cgaaatcagc caattttaga caagtatcaa acggatgtta attcagtaca 3360

ttaaagacgt ccgcaatgtg ttattaagtt gtctaagcgt caatttgttt acaccacaat 3420

atatcctgcc accagccagc caacagctcc ccgaccggca gctcggcaca aaatcaccac 3480

gcgttaccac cacgccggcc ggccgcatgg tgttgaccgt gttcgccggc attgccgagt 3540

tcgagcgttc cctaatcatc gaccgcaccc ggagcgggcg cgaggccgcc aaggcccgag 3600

gcgtgaagtt tggcccccgc cctaccctca ccccggcaca gatcgcgcac gcccgcgagc 3660

tgatcgacca ggaaggccgc accgtgaaag aggcggctgc actgcttggc gtgcatcgct 3720

cgaccctgta ccgcgcactt gagcgcagcg aggaagtgac gcccaccgag gccaggcggc 3780

gcggtgcctt ccgtgaggac gcattgaccg aggccgacgc cctggcggcc gccgagaatg 3840

aacgccaaga ggaacaagca tgaaaccgca ccaggacggc caggacgaac cgtttttcat 3900

taccgaagag atcgaggcgg agatgatcgc ggccgggtac gtgttcgagc cgcccgcgca 3960

cgtctcaacc gtgcggctgc atgaaatcct ggccggtttg tctgatgcca agctggcggc 4020

ctggccggcc agcttggccg ctgaagaaac cgagcgccgc cgtctaaaaa ggtgatgtgt 4080

atttgagtaa aacagcttgc gtcatgcggt cgctgcgtat atgatgcgat gagtaaataa 4140

acaaatacgc aaggggaacg catgaaggtt atcgctgtac ttaaccagaa aggcgggtca 4200

ggcaagacga ccatcgcaac ccatctagcc cgcgccctgc aactcgccgg ggccgatgtt 4260

ctgttagtcg attccgatcc ccagggcagt gcccgcgatt gggcggccgt gcgggaagat 4320

caaccgctaa ccgttgtcgg catcgaccgc ccgacgattg accgcgacgt gaaggccatc 4380

ggccggcgcg acttcgtagt gatcgacgga gcgccccagg cggcggactt ggctgtgtcc 4440

gcgatcaagg cagccgactt cgtgctgatt ccggtgcagc caagccctta cgacatatgg 4500

gccaccgccg acctggtgga gctggttaag cagcgcattg aggtcacgga tggaaggcta 4560

caagcggcct ttgtcgtgtc gcgggcgatc aaaggcacgc gcatcggcgg tgaggttgcc 4620

gaggcgctgg ccgggtacga gctgcccatt cttgagtccc gtatcacgca gcgcgtgagc 4680

tacccaggca ctgccgccgc cggcacaacc gttcttgaat cagaacccga gggcgacgct 4740

gcccgcgagg tccaggcgct ggccgctgaa attaaatcaa aactcatttg agttaatgag 4800

gtaaagagaa aatgagcaaa agcacaaaca cgctaagtgc cggccgtccg agcgcacgca 4860

gcagcaaggc tgcaacgttg gccagcctgg cagacacgcc agccatgaag cgggtcaact 4920

ttcagttgcc ggcggaggat cacaccaagc tgaagatgta cgcggtacgc caaggcaaga 4980

ccattaccga gctgctatct gaatacatcg cgcagctacc agagtaaatg agcaaatgaa 5040

taaatgagta gatgaatttt agcggctaaa ggaggcggca tggaaaatca agaacaacca 5100

ggcaccgacg ccgtggaatg ccccatgtgt ggaggaacgg gcggttggcc aggcgtaagc 5160

ggctgggttg tctgccggcc ctgcaatggc actggaaccc ccaagcccga ggaatcggcg 5220

tgagcggtcg caaaccatcc ggcccggtac aaatcggcgc ggcgctgggt gatgacctgg 5280

tggagaagtt gaaggccgcg caggccgccc agcggcaacg catcgaggca gaagcacgcc 5340

ccggtgaatc gtggcaagcg gccgctgatc gaatccgcaa agaatcccgg caaccgccgg 5400

cagccggtgc gccgtcgatt aggaagccgc ccaagggcga cgagcaacca gattttttcg 5460

ttccgatgct ctatgacgtg ggcacccgcg atagtcgcag catcatggac gtggccgttt 5520

tccgtctgtc gaagcgtgac cgacgagctg gcgaggtgat ccgctacgag cttccagacg 5580

ggcacgtaga ggtttccgca gggccggccg gcatggccag tgtgtgggat tacgacctgg 5640

tactgatggc ggtttcccat ctaaccgaat ccatgaaccg ataccgggaa gggaagggag 5700

acaagcccgg ccgcgtgttc cgtccacacg ttgcggacgt actcaagttc tgccggcgag 5760

ccgatggcgg aaagcagaaa gacgacctgg tagaaacctg cattcggtta aacaccacgc 5820

acgttgccat gcagcgtacg aagaaggcca agaacggccg cctggtgacg gtatccgagg 5880

gtgaagcctt gattagccgc tacaagatcg taaagagcga aaccgggcgg ccggagtaca 5940

tcgagatcga gctagctgat tggatgtacc gcgagatcac agaaggcaag aacccggacg 6000

tgctgacggt tcaccccgat tactttttga tcgatcccgg catcggccgt tttctctacc 6060

gcctggcacg ccgcgccgca ggcaaggcag aagccagatg gttgttcaag acgatctacg 6120

aacgcagtgg cagcgccgga gagttcaaga agttctgttt caccgtgcgc aagctgatcg 6180

ggtcaaatga cctgccggag tacgatttga aggaggaggc ggggcaggct ggcccgatcc 6240

tagtcatgcg ctaccgcaac ctgatcgagg gcgaagcatc cgccggttcc taatgtacgg 6300

agcagatgct agggcaaatt gccctagcag gggaaaaagg tcgaaaaggt ctctttcctg 6360

tggatagcac gtacattggg aacccaaagc cgtacattgg gaaccggaac ccgtacattg 6420

ggaacccaaa gccgtacatt gggaaccggt cacacatgta agtgactgat ataaaagaga 6480

aaaaaggcga tttttccgcc taaaactctt taaaacttat taaaactctt aaaacccgcc 6540

tggcctgtgc ataactgtct ggccagcgca cagccgaaga gctgcaaaaa gcgcctaccc 6600

ttcggtcgct gcgctcccta cgccccgccg cttcgcgtcg gcctatcgcg gccgctggcc 6660

gctcaaaaat ggctggccta cggccaggca atctaccagg gcgcggacaa gccgcgccgt 6720

cgccactcga ccgccggcgc ccacatcaag gcaccctgcc tcgcgcgttt cggtgatgac 6780

ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct gtaagcggat 6840

gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg tcggggcgca 6900

gccatgaccc agtcacgtag cgatagcgga gtgtatactg gcttaactat gcggcatcag 6960

agcagattgt actgagagtg caccatatgc ggtgtgaaat accgcacaga tgcgtaagga 7020

gaaaataccg catcaggcgc tcttccgctt cctcgctcac tgactcgctg cgctcggtcg 7080

ttcggctgcg gcgagcggta tcagctcact caaaggcggt aatacggtta tccacagaat 7140

caggggataa cgcaggaaag aacatgtgag caaaaggcca gcaaaaggcc aggaaccgta 7200

aaaaggccgc gttgctggcg tttttccata ggctccgccc ccctgacgag catcacaaaa 7260

atcgacgctc aagtcagagg tggcgaaacc cgacaggact ataaagatac caggcgtttc 7320

cccctggaag ctccctcgtg cgctctcctg ttccgaccct gccgcttacc ggatacctgt 7380

ccgcctttct cccttcggga agcgtggcgc tttctcatag ctcacgctgt aggtatctca 7440

gttcggtgta ggtcgttcgc tccaagctgg gctgtgtgca cgaacccccc gttcagcccg 7500

accgctgcgc cttatccggt aactatcgtc ttgagtccaa cccggtaaga cacgacttat 7560

cgccactggc agcagccact ggtaacagga ttagcagagc gaggtatgta ggcggtgcta 7620

cagagttctt gaagtggtgg cctaactacg gctacactag aaggacagta tttggtatct 7680

gcgctctgct gaagccagtt accttcggaa aaagagttgg tagctcttga tccggcaaac 7740

aaaccaccgc tggtagcggt ggtttttttg tttgcaagca gcagattacg cgcagaaaaa 7800

aaggatctca agaagatcct ttgatctttt ctacggggtc tgacgctcag tggaacgaaa 7860

actcacgtta agggattttg gtcatgcatg atatatctcc caatttgtgt agggcttatt 7920

atgcacgctt aaaaataata aaagcagact tgacctgata gtttggctgt gagcaattat 7980

gtgcttagtg catctaacgc ttgagttaag ccgcgccgcg aagcggcgtc ggcttgaacg 8040

aatttctagc tagacattat ttgccgacta ccttggtgat ctcgcctttc acgtagtgga 8100

caaattcttc caactgatct gcgcgcgagg ccaagcgatc ttcttcttgt ccaagataag 8160

cctgtctagc ttcaagtatg acgggctgat actgggccgg caggcgctcc attgcccagt 8220

cggcagcgac atccttcggc gcgattttgc cggttactgc gctgtaccaa atgcgggaca 8280

acgtaagcac tacatttcgc tcatcgccag cccagtcggg cggcgagttc catagcgtta 8340

aggtttcatt tagcgcctca aatagatcct gttcaggaac cggatcaaag agttcctccg 8400

ccgctggacc taccaaggca acgctatgtt ctcttgcttt tgtcagcaag atagccagat 8460

caatgtcgat cgtggctggc tcgaagatac ctgcaagaat gtcattgcgc tgccattctc 8520

caaattgcag ttcgcgctta gctggataac gccacggaat gatgtcgtcg tgcacaacaa 8580

tggtgacttc tacagcgcgg agaatctcgc tctctccagg ggaagccgaa gtttccaaaa 8640

ggtcgttgat caaagctcgc cgcgttgttt catcaagcct tacggtcacc gtaaccagca 8700

aatcaatatc actgtgtggc ttcaggccgc catccactgc ggagccgtac aaatgtacgg 8760

ccagcaacgt cggttcgaga tggcgctcga tgacgccaac tacctctgat agttgagtcg 8820

atacttcggc gatcaccgct tcccccatga tgtttaactt tgttttaggg cgactgccct 8880

gctgcgtaac atcgttgctg ctccataaca tcaaacatcg acccacggcg taacgcgctt 8940

gctgcttgga tgcccgaggc atagactgta ccccaaaaaa acagtcataa caagccatga 9000

aaaccgccac tgcgttccat ggacatacaa atggacgaac ggataaacct tttcacgccc 9060

ttttaaatat ccgattattc taataaacgc tcttttctct taggtttacc cgccaatata 9120

tcctgtcaaa cactgatagt ttaaactgaa ggcgggaaac gacaatcaga tctagtagga 9180

aacagctatg accatgatta cgccaagcta tccggccagt gaattat 9227

<210>51

<211>15506

<212>DNA

＜213〉multiple expression constructs pSUN2-B4-USP-NAN-pa7-E9-GUS-FAD3-LeB4-GFP-LeB3

<220>

<221>misc_feature

<222>(15323)..(15468)

＜223〉agrobatcerium T-DNA right hand edge (RB)

<220>

<221>misc_feature

<222>(9564)..(9778)

＜223〉complement: agrobatcerium T-DNA left hand edge (LB)

<220>

＜221〉promotor

<222>(8067)..(8403)

＜223〉no promotor (nosP)

<220>

＜221〉promotor

<222>(67)..(745)

＜223〉USP promotor

<220>

＜221〉promotor

<222>(4928)..(5993)

＜223〉complement:LuFAD3 promotor

<220>

＜221〉promotor

<222>(6061)..(6824)

＜223〉LeB4-700 promotor

<220>

＜221〉terminator

<222>(9295)..(9550)

＜223〉no terminator (nosT)

<220>

＜221〉terminator

<222>(1981)..(2202)

＜223〉pA7 terminator (pA7T)

<220>

＜221〉terminator

<222>(2264)..(2933)

＜223〉complement:rbcs the E9 terminator

<220>

＜221〉terminator

<222>(7656)..(7952)

＜223〉LeB3 ' UT terminator

<220>

<221>misc_feature

<222>(8424)..(9202)

＜223〉CDS-coding nptII kalamycin resistance

<220>

<221>misc_feature

<222>(14358)..(15149)

＜223〉complement:CDS-coding spectinomycin/streptomycin resistance (aadA)

<220>

<221>misc_feature

<222>(802)..(1947)

＜223〉CDS-coding NAN reporter gene

<220>

<221>misc_feature

<222>(3030)..(4841)

＜223〉complement:CDS-coding GUS reporter gene

<220>

<221>misc_feature

<222>(6828)..(7645)

＜223〉CDS-coding GFP reporter gene

<220>

<221>rep_origin

<222>(13343)..(14189)

＜223〉complement:ColE1 replication orgin

<220>

<221>misc_feature

<222>(7984)..(8004)

＜223〉complement: recombination site attB3*

<220>

<221>misc_feature

<222>(24)..(44)

＜223〉recombination site attB4*

<220>

<221>misc_feature

<222>(2240)..(2263)

＜223〉recombination site attB1*

<220>

<221>misc_feature

<222>(6008)..(6031)

＜223〉recombination site attB2*

<400>51

agctatcgat tacgccaagc tatcaacttt gtatagaaaa gttggggtac ccggggatcc 60

tcctcgagca aatttacaca ttgccactaa acgtctaaac ccttgtaatt tgtttttgtt 120

ttactatgtg tgttatgtat ttgatttgcg ataaattttt atatttggta ctaaatttat 180

aacacctttt atgctaacgt ttgccaacac ttagcaattt gcaagttgat taattgattc 240

taaattattt ttgtcttcta aatacatata ctaatcaact ggaaatgtaa atatttgcta 300

atatttctac tataggagaa ttaaagtgag tgaatatggt accacaaggt ttggagattt 360

aattgttgca atgatgcatg gatggcatat acaccaaaca ttcaataatt cttgaggata 420

ataatggtac cacacaagat ttgaggtgca tgaacgtcac gtggacaaaa ggtttagtaa 480

tttttcaaga caacaatgtt accacacaca agttttgagg tgcatgcatg gatgccctgt 540

ggaaagttta aaaatatttt ggaaatgatt tgcatggaag ccatgtgtaa aaccatgaca 600

tccacttgga ggatgcaata atgaagaaaa ctacaaattt acatgcaact agttatgcat 660

gtagtctata taatgaggat tttgcaatac tttcattcat acacactcac taagttttac 720

acgattataa tttcttcata gccagcggat ctgatatctg cggccgcggc gcgccaattg 780

actagtaggg atccgttaac aatgtgtaac aagaacaaca ccttcgagaa gaacctcgac 840

atctcacaca agcctgaacc acttatcctc tttaacaagg ataacaacat ctggaattct 900

aagtacttca ggattcctaa catccagttg cttaatgacg gtacaatcct taccttctct 960

gacatcaggt acaacgggcc cgatgaccac gcttacattg atatcgcttc tgctagatct 1020

actgaattcg gtaagacctg gtcttacaac atcgctatga agaacaacag gatcgactca 1080

acctactcac gtgtgatgga ttctaccact gtgatcacta acaccggccg gatcattctt 1140

atcgctggat cttggaacac taacggaaac tgggctatga ccacttctac cagaaggtct 1200

gattggtctg tgcagatgat ctactctgat gacaacggac ttacttggtc taacaagatc 1260

gatctcacta aggactcttc aaaagtgaag aaccagcctt ctaacacaat tggatggctc 1320

ggaggtgttg gatctggaat cgttatggac gatggaacca tcgttatgcc tgctcagatc 1380

tccttaagag aaaacaacga gaacaactac tattcactca tcatatattc caaggataac 1440

ggcgagactt ggactatggg gaacaaggtg ccgaattcca atacgtccga gaatatggtc 1500

attgaactcg acggagcatt gatcatgtct actaggtacg attactcagg ctacagagcg 1560

gcatacataa gtcatgacct cgggacaact tgggaaatct acgagccact taatggcaag 1620

attctcacag gcaaaggttc cggatgtcaa ggatcattca tcaaagccac aacgagcaat 1680

ggacatcgta ttggactcat tagtgcacct aagaacacaa aaggtgagta cattagagat 1740

aatatcgccg tctacatgat cgattttgac gatctgagca aaggtgttca agagatctgc 1800

attccatatc cagaggatgg taacaagctc ggtggaggat actcctgtct gagttttaag 1860

aacaaccact tgggtattgt ttacgaagct aatggtaata tcgagtatca ggacttgaca 1920

ccatactata gtcttattaa caagcagtga gagcctatcg attaattaag gccgcctcga 1980

atcctgaatt aacgccgaat taattcgggg gatctggatt ttagtactgg attttggttt 2040

taggaattag aaattttatt gatagaagta ttttacaaat acaaatacat actaagggtt 2100

tcttatatgc tcaacacatg agcgaaaccc tataggaacc ctaattccct tatctgggaa 2160

ctactcacac attattatgg agaaactcga gcttgtcgag attcgagcat atgggcatgc 2220

aagcttggcg taatcatggc aagtttgtac aaaaaagcag gctggtaccc ggtcgattga 2280

tgcatgttgt caatcaattg gcaagtcata aaatgcatta aaaaatattt tcatactcaa 2340

ctacaaatcc atgagtataa ctataattat aaagcaatga ttagaatctg acaaggattc 2400

tggaaaatta cataaaggaa agttcataaa tgtctaaaac acaagaggac atacttgtat 2460

tcagtaacat ttgcagcttt tctaggtctg aaaatatatt tgttgcctag tgaataagca 2520

taatggtaca actacaagtg ttttactcct catattaact tcggtcatta gaggccacga 2580

tttgacacat ttttactcaa aacaaaatgt ttgcatatct cttataattt caaattcaac 2640

acacaacaaa taagagaaaa aacaaataat attaatttga gaatgaacaa aaggaccata 2700

tcattcatta actcttctcc atccatttcc atttcacagt tcgatagcga aaaccgaata 2760

aaaaacacag taaattacaa gcacaacaaa tggtacaaga aaaacagttt tcccaatgcc 2820

ataatactca aactcagtag gattctggtg tgtgcgcaat gaaactgatg cattgaactt 2880

gacgaacgtt gtcgaaaccg atgatacgaa cgaaagctct agctagagga tcctctagca 2940

tatgctcgag gcggccttaa ttaatcgata ggctcggtag caattcccga ggctgtagcc 3000

gacgatggtg cgccaggaga gttgttgatt cattgtttgc ctccctgctg cggtttttca 3060

ccgaagttca tgccagtcca gcgtttttgc agcagaaaag ccgccgactt cggtttgcgg 3120

tcgcgagtga agatcccttt cttgttaccg ccaacgcgca atatgccttg cgaggtcgca 3180

aaatcggcga aattccatac ctgttcaccg acgacggcgc tgacgcgatc aaagacgcgg 3240

tgatacatat ccagccatgc acactgatac tcttcactcc acatgtcggt gtacattgag 3300

tgcagcccgg ctaacgtatc cacgccgtat tcggtgatga taatcggctg atgcagtttc 3360

tcctgccagg ccagaagttc tttttccagt accttctctg ccgtttccaa atcgccgctt 3420

tggacatacc atccgtaata acggttcagg cacagcacat caaagagatc gctgatggta 3480

tcggtgtgag cgtcgcagaa cattacattg acgcaggtga tcggacgcgt cgggtcgagt 3540

ttacgcgttg cttccgccag tggcgcgaaa tattcccgtg caccttgcgg acgggtatcc 3600

ggttcgttgg caatactcca catcaccacg cttgggtggt ttttgtcacg cgctatcagc 3660

tctttaatcg cctgtaagtg cgcttgctga gtttccccgt tgactgcctc ttcgctgtac 3720

agttctttcg gcttgttgcc cgcttcgaaa ccaatgccta aagagaggtt aaagccgaca 3780

gcagcagttt catcaatcac cacgatgcca tgttcatctg cccagtcgag catctcttca 3840

gcgtaagggt aatgcgaggt acggtaggag ttggccccaa tccagtccat taatgcgtgg 3900

tcgtgcacca tcagcacgtt atcgaatcct ttgccacgca agtccgcatc ttcatgacga 3960

ccaaagccag taaagtagaa cggtttgtgg ttaatcagga actgttcgcc cttcactgcc 4020

actgaccgga tgccgacgcg aagcgggtag atatcacact ctgtctggct tttggctgtg 4080

acgcacagtt catagagata accttcaccc ggttgccaga ggtgcggatt caccacttgc 4140

aaagtcccgc tagtgccttg tccagttgca accacctgtt gatccgcatc acgcagttca 4200

acgctgacat caccattggc caccacctgc cagtcaacag acgcgtggtt acagtcttgc 4260

gcgacatgcg tcaccacggt gatatcgtcc acccaggtgt tcggcgtggt gtagagcatt 4320

acgctgcgat ggattccggc atagttaaag aaatcatgga agtaagactg ctttttcttg 4380

ccgttttcgt cggtaatcac cattcccggc gggatagtct gccagttcag ttcgttgttc 4440

acacaaacgg tgatacgtac acttttcccg gcaataacat acggcgtgac atcggcttca 4500

aatggcgtat agccgccctg atgctccatc acttcctgat tattgaccca cactttgccg 4560

taatgagtga ccgcatcgaa acgcagcacg atacgctggc ctgcccaacc tttcggtata 4620

aagacttcgc gctgatacca gacgttgccc gcataattac gaatatctgc atcggcgaac 4680

tgatcgttaa aactgcctgg cacagcaatt gcccggcttt cttgtaacgc gctttcccac 4740

caacgctgat caattccaca gttttcgcga tccagactga atgcccacag gccgtcgagt 4800

tttttgattt cacgggttgg ggtttctaca ggacgtaaca taagggactg acctacccgg 4860

ggatccgtta acacctaggt acccgggact agtcaattgg cgcgccgcgg ccgcagatat 4920

cagatccgtc gtgcagagcc acagttttga agtcactgta atctgcacca aacaaaccca 4980

atatatattt ttgaataata atgaatagac tgagtggcct ttggtttcag cctcacagta 5040

tttataaccg aagagtatgt aggttggtga gaactaacga agaagaagta atgcaggatg 5100

ccaagtggat ggagaagagt aaatggaaat gcaaaatgta cactgatttc agacaaacta 5160

gcctacacca cccaacccct ttttttttgc tctttattgg gtttcagttt aggcaacggt 5220

tgttgttact tgctctgttg aaagacaaat gaaaaggagc cgttgctggc tgctaggttc 5280

ttcaatttca gtatcaatgg tggtgggcaa atctttgatt caaacacatg gcaacttcct 5340

tcaatggtat ctaggaaacc tatgtgcatg catgagttac cacaaatgtg atgatatcaa 5400

cttattagtt cttttaatta aggattagtg atttggcgga gtcgcaacgg gcactgctga 5460

gttcgcggga gctagggtgg aatcgactaa tcaactcatg tgactcaagt gggcatcggt 5520

cttagggagt aagttcgggc aagtttcggg cagagggatt tgtgcatgtg tttaggatca 5580

caaggggggt attggttgtc cttcggtccg agaatgtgaa gtacgaggtc ttccagatgc 5640

tatgtagtgg gttgggaaca aggcagagat atggacgagc ttgactttgt tttcacaaac 5700

tgatgatcaa actttgggct ccatttgaac ttagtcgaaa ctcttacaac tctcttgctt 5760

tgcaatcgaa taatagatgg attattgaat tgcaaagtga acactaatga aagtgagtgc 5820

atagaaaact aaggattaat gatgctgatg atgatgagtg atgctggtaa caactgtggt 5880

aaagaatggc actgtaaagg tgaacaaaac atccacccac gtactgatca ataaacttta 5940

gcagacaatc agaccatttt ccttttgttt ggaccctttt gtgggaataa gcttggcgta 6000

atcatggacc cagctttctt gtacaaagtg gggtacccgg ggatcctcta gcatatgctc 6060

gagttaccat ttctttttcc tgcatctcaa tagtatatag ggtatcaaat agtgattatc 6120

caaacttaaa taagttagag gaaacaccaa gatatgccat atactctcaa atttgacact 6180

atgattcaaa gttgcacttg cataaaactt attaattcaa tagtaaaacc aaacttgtgc 6240

gtgatacagt taaaatgact aaactactaa ttaaggtccc tcccattagt aaataagtta 6300

tttttttaga aaaagaaaat aataaaaaga atgacgagtc tatctaaatc atattaacaa 6360

gtaatacata ttgattcatt cgatggagga ggccaataat tgtagtaaac aagcagtgcc 6420

gaggttaata tatgctcaag acagtaaata atctaaatga attaagacag tgatttgcaa 6480

agagtagatg cagagaagag aactaaagat ttgctgctac acgtatataa gaatagcaac 6540

agatattcat tctgtctctt tgtggaatat ggatatctac taatcatcat ctatctgtga 6600

agaataaaag aagcggccac aagcgcagcg tcgcacatat gatgtgtatc aaattaggac 6660

tccatagcca tgcatgctga agaatgtcac acacgttctg tcacacgtgt tactctctca 6720

ctgttctcct cttcctataa atcaccgcgc cacagcttct ccacttcacc acttcaccac 6780

ttcactcaca atccttcatt agttgtttac tatcacagtc acagatccaa ggagatataa 6840

caatgaagac taatcttttt ctctttctca tcttttcact tctcctatca ttatcctcgg 6900

ccgaattcag taaaggagaa gaacttttca ctggagttgt cccaattctt gttgaattag 6960

atggtgatgt taatgggcac aaattttctg tcagtggaga gggtgaaggt gatgcaacat 7020

acggaaaact tacccttaaa tttatttgca ctactggaaa actacctgtt ccatggccaa 7080

cacttgtcac tactttctct tatggtgttc aatgcttttc aagataccca gatcatatga 7140

agcggcacga cttcttcaag agcgccatgc ctgagggata cgtgcaggag aggaccatct 7200

tcttcaagga cgacgggaac tacaagacac gtgctgaagt caagtttgag ggagacaccc 7260

tcgtcaacag gatcgagctt aagggaatcg atttcaagga ggacggaaac atcctcggcc 7320

acaagttgga atacaactac aactcccaca acgtatacat catggccgac aagcaaaaga 7380

acggcatcaa agccaacttc aagacccgcc acaacatcga agacggcggc gtgcaactcg 7440

ctgatcatta tcaacaaaat actccaattg gcgatggccc tgtcctttta ccagacaacc 7500

attacctgtc cacacaatct gccctttcga aagatcccaa cgaaaagaga gaccacatgg 7560

tccttcttga gtttgtaaca gctgctggga ttacacatgg catggatgaa ctatacaaac 7620

atgatgagct ttaagagaac ggatctggtc gaccgatcct gcaatagaat gttgaggtga 7680

ccactttctg taataaaata attataaaat aaatttagaa ttgctgtagt caagaacatc 7740

agttctaaaa tattaataaa gttatggcct tttgacatat gtgtttcgat aaaaaaatca 7800

aaataaattg agatttattc gaaatacaat gaaagtttgc agatatgaga tatgtttcta 7860

caaaataata acttaaaact caactatatg ctaatgtttt tcttggtgtg tttcatagaa 7920

aattgtatcc gtttcttaga aaatgctcgt aaggatcggc atgcaagctt ggcgtaatca 7980

tggcaacttt attatacata gttgataatt cactggccgg ataattcact ggccgtcgtt 8040

ttacaacgac tcaggatcct gtcaaacact gatagtttaa actgaaggcg ggaaacgaca 8100

atctgatcat gagcggagaa ttaagggagt cacgttatga cccccgccga tgacgcggga 8160

caagccgttt tacgtttgga actgacagaa ccgcaacgtt gaaggagcca ctcagccgcg 8220

ggtttctgga gtttaatgag ctaagcacat acgtcagaaa ccattattgc gcgttcaaaa 8280

gtcgcctaag gtcactatca gctagcaaat atttcttgtc aaaaatgctc cactgacgtt 8340

ccataaattc ccctcggtat ccaattagag tctcatattc actctcaatc caaataatct 8400

gcaccggatc tggatcgttt cgcatgattg aacaagatgg attgcacgca ggttctccgg 8460

ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc ggctgctctg 8520

atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc aagaccgacc 8580

tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg ctggccacga 8640

cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg gactggctgc 8700

tattgggcga agtgccgggg caggatctcc tgtcatctca ccttgctcct gccgagaaag 8760

tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct acctgcccat 8820

tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa gccggtcttg 8880

tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa ctgttcgcca 8940

ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt gacccatggc gatgcctgct 9000

tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt ggccggctgg 9060

gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct gaagagcttg 9120

gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc gattcgcagc 9180

gcatcgcctt ctatcgcctt cttgacgagt tcttctgagc gggacccaag ctctagatct 9240

tgctgcgttc ggatattttc gtggagttcc cgccacagac ccggatgatc cccgatcgtt 9300

caaacatttg gcaataaagt ttcttaagat tgaatcctgt tgccggtctt gcgatgatta 9360

tcatataatt tctgttgaat tacgttaagc atgtaataat taacatgtaa tgcatgacgt 9420

tatttatgag atgggttttt atgattagag tcccgcaatt atacatttaa tacgcgatag 9480

aaaacaaaat atagcgcgca aactaggata aattatcgcg cgcggtgtca tctatgttac 9540

tagatcgggc ctcctgtcaa gctctgcttg gtaataattg tcattagatt gtttttatgc 9600

atagatgcac tcgaaatcag ccaattttag acaagtatca aacggatgtt aattcagtac 9660

attaaagacg tccgcaatgt gttattaagt tgtctaagcg tcaatttgtt tacaccacaa 9720

tatatcctgc caccagccag ccaacagctc cccgaccggc agctcggcac aaaatcacca 9780

cgcgttacca ccacgccggc cggccgcatg gtgttgaccg tgttcgccgg cattgccgag 9840

ttcgagcgtt ccctaatcat cgaccgcacc cggagcgggc gcgaggccgc caaggcccga 9900

ggcgtgaagt ttggcccccg ccctaccctc accccggcac agatcgcgca cgcccgcgag 9960

ctgatcgacc aggaaggccg caccgtgaaa gaggcggctg cactgcttgg cgtgcatcgc 10020

tcgaccctgt accgcgcact tgagcgcagc gaggaagtga cgcccaccga ggccaggcgg 10080

cgcggtgcct tccgtgagga cgcattgacc gaggccgacg ccctggcggc cgccgagaat 10140

gaacgccaag aggaacaagc atgaaaccgc accaggacgg ccaggacgaa ccgtttttca 10200

ttaccgaaga gatcgaggcg gagatgatcg cggccgggta cgtgttcgag ccgcccgcgc 10260

acgtctcaac cgtgcggctg catgaaatcc tggccggttt gtctgatgcc aagctggcgg 10320

cctggccggc cagcttggcc gctgaagaaa ccgagcgccg ccgtctaaaa aggtgatgtg 10380

tatttgagta aaacagcttg cgtcatgcgg tcgctgcgta tatgatgcga tgagtaaata 10440

aacaaatacg caaggggaac gcatgaaggt tatcgctgta cttaaccaga aaggcgggtc 10500

aggcaagacg accatcgcaa cccatctagc ccgcgccctg caactcgccg gggccgatgt 10560

tctgttagtc gattccgatc cccagggcag tgcccgcgat tgggcggccg tgcgggaaga 10620

tcaaccgcta accgttgtcg gcatcgaccg cccgacgatt gaccgcgacg tgaaggccat 10680

cggccggcgc gacttcgtag tgatcgacgg agcgccccag gcggcggact tggctgtgtc 10740

cgcgatcaag gcagccgact tcgtgctgat tccggtgcag ccaagccctt acgacatatg 10800

ggccaccgcc gacctggtgg agctggttaa gcagcgcatt gaggtcacgg atggaaggct 10860

acaagcggcc tttgtcgtgt cgcgggcgat caaaggcacg cgcatcggcg gtgaggttgc 10920

cgaggcgctg gccgggtacg agctgcccat tcttgagtcc cgtatcacgc agcgcgtgag 10980

ctacccaggc actgccgccg ccggcacaac cgttcttgaa tcagaacccg agggcgacgc 11040

tgcccgcgag gtccaggcgc tggccgctga aattaaatca aaactcattt gagttaatga 11100

ggtaaagaga aaatgagcaa aagcacaaac acgctaagtg ccggccgtcc gagcgcacgc 11160

agcagcaagg ctgcaacgtt ggccagcctg gcagacacgc cagccatgaa gcgggtcaac 11220

tttcagttgc cggcggagga tcacaccaag ctgaagatgt acgcggtacg ccaaggcaag 11280

accattaccg agctgctatc tgaatacatc gcgcagctac cagagtaaat gagcaaatga 11340

ataaatgagt agatgaattt tagcggctaa aggaggcggc atggaaaatc aagaacaacc 11400

aggcaccgac gccgtggaat gccccatgtg tggaggaacg ggcggttggc caggcgtaag 11460

cggctgggtt gtctgccggc cctgcaatgg cactggaacc cccaagcccg aggaatcggc 11520

gtgagcggtc gcaaaccatc cggcccggta caaatcggcg cggcgctggg tgatgacctg 11580

gtggagaagt tgaaggccgc gcaggccgcc cagcggcaac gcatcgaggc agaagcacgc 11640

cccggtgaat cgtggcaagc ggccgctgat cgaatccgca aagaatcccg gcaaccgccg 11700

gcagccggtg cgccgtcgat taggaagccg cccaagggcg acgagcaacc agattttttc 11760

gttccgatgc tctatgacgt gggcacccgc gatagtcgca gcatcatgga cgtggccgtt 11820

ttccgtctgt cgaagcgtga ccgacgagct ggcgaggtga tccgctacga gcttccagac 11880

gggcacgtag aggtttccgc agggccggcc ggcatggcca gtgtgtggga ttacgacctg 11940

gtactgatgg cggtttccca tctaaccgaa tccatgaacc gataccggga agggaaggga 12000

gacaagcccg gccgcgtgtt ccgtccacac gttgcggacg tactcaagtt ctgccggcga 12060

gccgatggcg gaaagcagaa agacgacctg gtagaaacct gcattcggtt aaacaccacg 12120

cacgttgcca tgcagcgtac gaagaaggcc aagaacggcc gcctggtgac ggtatccgag 12180

ggtgaagcct tgattagccg ctacaagatc gtaaagagcg aaaccgggcg gccggagtac 12240

atcgagatcg agctagctga ttggatgtac cgcgagatca cagaaggcaa gaacccggac 12300

gtgctgacgg ttcaccccga ttactttttg atcgatcccg gcatcggccg ttttctctac 12360

cgcctggcac gccgcgccgc aggcaaggca gaagccagat ggttgttcaa gacgatctac 12420

gaacgcagtg gcagcgccgg agagttcaag aagttctgtt tcaccgtgcg caagctgatc 12480

gggtcaaatg acctgccgga gtacgatttg aaggaggagg cggggcaggc tggcccgatc 12540

ctagtcatgc gctaccgcaa cctgatcgag ggcgaagcat ccgccggttc ctaatgtacg 12600

gagcagatgc tagggcaaat tgccctagca ggggaaaaag gtcgaaaagg tctctttcct 12660

gtggatagca cgtacattgg gaacccaaag ccgtacattg ggaaccggaa cccgtacatt 12720

gggaacccaa agccgtacat tgggaaccgg tcacacatgt aagtgactga tataaaagag 12780

aaaaaaggcg atttttccgc ctaaaactct ttaaaactta ttaaaactct taaaacccgc 12840

ctggcctgtg cataactgtc tggccagcgc acagccgaag agctgcaaaa agcgcctacc 12900

cttcggtcgc tgcgctccct acgccccgcc gcttcgcgtc ggcctatcgc ggccgctggc 12960

cgctcaaaaa tggctggcct acggccaggc aatctaccag ggcgcggaca agccgcgccg 13020

tcgccactcg accgccggcg cccacatcaa ggcaccctgc ctcgcgcgtt tcggtgatga 13080

cggtgaaaac ctctgacaca tgcagctccc ggagacggtc acagcttgtc tgtaagcgga 13140

tgccgggagc agacaagccc gtcagggcgc gtcagcgggt gttggcgggt gtcggggcgc 13200

agccatgacc cagtcacgta gcgatagcgg agtgtatact ggcttaacta tgcggcatca 13260

gagcagattg tactgagagt gcaccatatg cggtgtgaaa taccgcacag atgcgtaagg 13320

agaaaatacc gcatcaggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 13380

gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 13440

tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 13500

aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 13560

aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 13620

ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 13680

tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc 13740

agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 13800

gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta 13860

tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct 13920

acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc 13980

tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa 14040

caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa 14100

aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa 14160

aactcacgtt aagggatttt ggtcatgcat gatatatctc ccaatttgtg tagggcttat 14220

tatgcacgct taaaaataat aaaagcagac ttgacctgat agtttggctg tgagcaatta 14280

tgtgcttagt gcatctaacg cttgagttaa gccgcgccgc gaagcggcgt cggcttgaac 14340

gaatttctag ctagacatta tttgccgact accttggtga tctcgccttt cacgtagtgg 14400

acaaattctt ccaactgatc tgcgcgcgag gccaagcgat cttcttcttg tccaagataa 14460

gcctgtctag cttcaagtat gacgggctga tactgggccg gcaggcgctc cattgcccag 14520

tcggcagcga catccttcgg cgcgattttg ccggttactg cgctgtacca aatgcgggac 14580

aacgtaagca ctacatttcg ctcatcgcca gcccagtcgg gcggcgagtt ccatagcgtt 14640

aaggtttcat ttagcgcctc aaatagatcc tgttcaggaa ccggatcaaa gagttcctcc 14700

gccgctggac ctaccaaggc aacgctatgt tctcttgctt ttgtcagcaa gatagccaga 14760

tcaatgtcga tcgtggctgg ctcgaagata cctgcaagaa tgtcattgcg ctgccattct 14820

ccaaattgca gttcgcgctt agctggataa cgccacggaa tgatgtcgtc gtgcacaaca 14880

atggtgactt ctacagcgcg gagaatctcg ctctctccag gggaagccga agtttccaaa 14940

aggtcgttga tcaaagctcg ccgcgttgtt tcatcaagcc ttacggtcac cgtaaccagc 15000

aaatcaatat cactgtgtgg cttcaggccg ccatccactg cggagccgta caaatgtacg 15060

gccagcaacg tcggttcgag atggcgctcg atgacgccaa ctacctctga tagttgagtc 15120

gatacttcgg cgatcaccgc ttcccccatg atgtttaact ttgttttagg gcgactgccc 15180

tgctgcgtaa catcgttgct gctccataac atcaaacatc gacccacggc gtaacgcgct 15240

tgctgcttgg atgcccgagg catagactgt accccaaaaa aacagtcata acaagccatg 15300

aaaaccgcca ctgcgttcca tggacataca aatggacgaa cggataaacc ttttcacgcc 15360

cttttaaata tccgattatt ctaataaacg ctcttttctc ttaggtttac ccgccaatat 15420

atcctgtcaa acactgatag tttaaactga aggcgggaaa cgacaatcag atctagtagg 15480

aaacagctat gaccatgatt acgcca 15506

<210>52

<211>25

<212>DNA

＜213〉recombination site attB1*

<400>52

agcctgcttt tttgtacaaa cttgc 25

<210>53

<211>25

<212>DNA

＜213〉recombination site attB2*

<400>53

acccagcttt cttgtacaaa gtggc 25

<210>54

<211>21

<212>DNA

＜213〉recombination site attB3*

<400>54

caactttatt atacatagtt g 21

<210>55

<211>21

<212>DNA

＜213〉recombination site attB4*

<400>55

caacttttct atacaaagtt g 21

<210>56

<211>25

<212>DNA

＜213〉recombination site attR1*

<400>56

gttcaacttt tttgtacaaa cttgc 25

<210>57

<211>24

<212>DNA

＜213〉recombination site attR2*

<400>57

ttcaactttc ttgtacaaag tggg 24

<210>58

<211>25

<212>DNA

＜213〉recombination site attR3*

<400>58

gttcaacttt attatacata gttga 25

<210>59

<211>25

<212>DNA

＜213〉recombination site attR4*

<400>59

gttcaacttt tctatacaaa gttga 25

<210>60

<211>25

<212>DNA

＜213〉recombination site attL1*

<400>60

agcctgcttt tttgtacaaa gttgg 25

<210>61

<211>25

<212>DNA

＜213〉recombination site attL2*

<400>61

acccagcttt cttgtacaaa gttgg 25

<210>62

<211>24

<212>DNA

＜213〉recombination site attL3*

<400>62

ggcaacttta ttatacaaag ttgg 24

<210>63

<211>25

<212>DNA

＜213〉recombination site attL4*

<400>63

acccaacttt tctatacaaa gttgg 25

<210>64

<211>25

<2t2>DNA

＜213〉recombination site attP1*

<400>64

gttcaacttt tttgtacaaa gttgg 25

<210>65

<211>25

<212>DNA

＜213〉recombination site attP2*

<400>65

gttcagcttt cttgtacaaa gttgg 25

<210>66

<211>25

<212>DNA

＜213〉recombination site attP3*

<400>66

gttcaacttt attatacaaa gttgg 25

<210>67

<211>25

<212>DNA

＜213〉recombination site attP4*

<400>67

gttcaacttt tctatacaaa gttgg 25

Claims

1. produce the method for the multiple expression constructs that comprises at least two different expression cassettes, described method is included in external or the interior combination of body

I) one or more insertion fragment donor molecules, described insertion fragment donor molecule comprises at least two together and inserts fragment I (n), each inserts fragment and comprises at least one expression cassette, described insertion fragment flank is two different recombination site A (2n) and A (2n+1), wherein n characterizes each to insert segmental from 1 to m integer, and m be different insert segmental sums and

Ii) insert fragment acceptor molecule IA, it comprises two different recombination site A1 and A (2m+2), and wherein m is a step I) difference insert segmental sum,

Wherein all recombination site A (1) are to A (2m+2) difference, and the re-assembly side A (2i-1) of specific i can with re-assembly side A (2i) reorganization of identical i, but substantially with another recombination site reorganization, described i be from 1 to m+1 integer and

Iii) at least a locus specificity recombinant protein, the described recombination site in its can recombinate described insertion fragment donor molecule and described insertion fragment acceptor molecule, and

2. the described method of claim 1, wherein each inserts fragment and is included in the insertion fragment donor molecule separately.

3. claim 1 or 2 described methods, at least one of wherein said insertion fragment donor dna molecule and described insertion fragment acceptor molecule is made up of ring-shaped DNA molecule.

4. each described method of claim 1 to 3, at least one of wherein said insertion fragment donor dna molecule and described insertion fragment acceptor molecule is made up of linear DNA molecule.

5. each method of claim 1 to 4, wherein said insertion fragment acceptor molecule and/or described insertion fragment donor molecule and/or described multiple expression constructs comprise protokaryon and/or eukaryotic vector.

6. the method for claim 5, wherein said eukaryotic vector is included in the carrier that duplicates in yeast cell, vegetable cell, fry cell, eukaryotic cell, mammalian cell or the insect cell.

7. the method for claim 5, wherein said prokaryotic vector is included in the carrier that duplicates in Gram-negative or the gram positive bacterium.

8. claim 5 or 7 method, wherein said prokaryotic vector is included in the carrier that duplicates in Escherichia, salmonella, bacillus, streptomyces, Agrobacterium or the Rhodopseudomonas.

9. claim 5,7 or 8 each methods, wherein said prokaryotic vector is included in the carrier that all duplicates in intestinal bacteria and the Agrobacterium.

10. the described method of each of claim 1 to 9, wherein said insertion fragment acceptor molecule and/or described insertion fragment donor molecule and/or described multiple expression constructs are the carriers that comprises at least a selective marker.

11. each described method of claim 1 to 10, wherein said insertion fragment acceptor molecule also comprises (a) virulent gene and (b) selective marker, wherein said virulent gene and described selective marker are on different dna fragmentations, and described dna fragmentation is separated from each other by at least two recombination sites.

12. the method for claim 10 or 11, wherein selective marker comprises at least one dna fragmentation, and it is selected from the group of being made up of following:

(a) dna fragmentation, its coded product provides the resistance at toxic chemical in recipient cell;

(b) dna fragmentation, its coded product lacks in recipient cell;

(c) dna fragmentation, the activity of its coded product suppressor gene product in recipient cell;

(d) dna fragmentation, the product that its coding can be identified;

(i) dna fragmentation, the susceptibility of the cell killing that specific compound caused in it directly or indirectly gave recipient cell when disappearance;

(j) dna fragmentation, it is coded in virose product in the recipient cell; With

(k) dna fragmentation, it can be used for separating or identifying desirable molecule.

13. each method of claim 10 to 12, wherein said selective marker comprises at least a mark, and this mark is selected from by antibiotics resistance gene, herbicide resistance gene, tRNA gene, nutrient defect type mark, virulent gene, phenotypic markers, antisense oligonucleotide, restriction endonuclease, restriction endonuclease cleavage site, enzyme cleavage site, protein binding site and the group formed with PCR primer sequence complementary sequence.

14. according to each method of claim 1 to 13, it also comprises the step of the multiple expression constructs of selecting to contain segmental all the described expression cassettes of described insertion.

15. each method of claim 1 to 14, wherein said recombination site is selected from the group of being made up of loxP, attB, attP, attL and attR.

16. the method for claim 15, wherein said recombination site comprises the dna sequence dna that is selected from the group of being made up of following sequence:

(a)RKYCWGCTTTYKTRTACNAASTSGB(m-att)(SEQ ID NO：1)；

(b)AGCCWGCTTTYKTRTACNAACTSGB(m-attB)(SEQ ID NO：2)；

(c)GTTCAGCTTTCKTRTACNAACTSGB(m-attR)(SEQ ID NO：3)；

(d)AGCCWGCTTTCKTRTACNAAGTSGB(m-attL)(SEQ ID NO：4)；

(e)GTTCAGCTTTYKTRTACNAAGTSGB(m-attP1)(SEQ ID NO：5)；

With correspondence or complementary DNA or RNA sequence, wherein R=A or G; K=G or T/U; Y=C or T/U; W=A or T/U; N=A, C or G or T/U; S=C or G; And B=C, G or T/U.

17. the method for claim 15 or 16, wherein said dna sequence dna comprises the sequence that is selected from the group of being made up of following sequence:

(a)AGCCTGCTTTTTTGTACAAACTTGT(attB1)(SEQ ID NO：6)；

(b)AGCCTGCTTTCTTGTACAAACTTGT(attB2)(SEQ ID NO：7)；

(c)ACCCAGCTTTCTTGTACAAACTTGT(attB3)(SEQ ID NO：8)；

(d)GTTCAGCTTTTTTGTACAAACTTGT(attR1)(SEQ ID NO：9)；

(e)GTTCAGCTTTCTTGTACAAACTTGT(attR2)(SEQ ID NO：10)；

(f)GTTCAGCTTTCTTGTACAAAGTTGG(attR3)(SEQ ID NO：11)；

(g)AGCCTGCTTTTTTGTACAAAGTTGG(attL1)(SEQ ID NO：12)；

(h)AGCCTGCTTTCTTGTACAAAGTTGG(attL2)(SEQ ID NO：13)；

(i)ACCCAGCTTTCTTGTACAAAGTTGG(attL3)(SEQ ID NO：14)；

(j)GTTCAGCTTTTTTGTACAAAGTTGG(attP1)(SEQ ID NO：15)；

(k)GTTCAGCTTTCTTGTACAAAGTTGG(attP2、P3)(SEQ ID NO：16)；

(l)AGCCTGCTTTTTTGTACAAACTTGC(attB1 ^*)(SEQ ID NO：52)；

(m)ACCCAGCTTTCTTGTACAAAGTGGC(attB2 ^*)(SEQ ID NO：53)；

(N)CAACTTTATTATACATAGTTG(attB3 ^*)(SEQ ID NO：54)

(O)CAACTTTTCTATACAAAGTTG(attB4 ^*)(SEQ ID NO：55)

(p)GTTCAACTTTTTTGTACAAACTTGC(attR1 ^*)(SEQ ID NO：56)

(q)TTCAACTTTCTTGTACAAAGTGGG(attR2 ^*)(SEQ ID NO：57)

(r)GTTCAACTTTATTATACATAGTTGA(attR3 ^*)(SEQ ID NO：58)

(s)GTTCAACTTTTCTATACAAAGTTGA(attR4 ^*)(SEQ ID NO：59)

(t)AGCCTGCTTTTTTGTACAAAGTTGG(attL1 ^*)(SEQ ID NO：60)

(u)ACCCAGCTTTCTTGTACAAAGTTGG(attL2 ^*)(SEQ ID NO：61)

(v)GGCAACTTTATTATACAAAGTTGG(attL3 ^*)(SEQ ID NO：62)

(w)ACCCAACTTTTCTATACAAAGTTGG(attL4 ^*) (SEQ ID NO：63)

(x)GTTCAACTTTTTTGTACAAAGTTGG(attP1 ^*)(SEQ ID NO：64)

(y)GTTCAGCTTTCTTGTACAAAGTTGG(attP2 ^*)(SEQ ID NO：65)

(z)GTTCAACTTTATTATACAAAGTTGG(attP3 ^*)(SEQ ID NO：66)

(aa)GTTCAACTTTTCTATACAAAGTTGG(attP4 ^*)(SEQ ID NO：67)

With correspondence or complementary DNA or RNA sequence.

18. each method of claim 1 to 17, wherein said recombinant protein is selected from the group of being made up of Int, IHF, Xis, Cre, Flp and Res.

19. each method of claim 1 to 18 wherein is included in the purpose nucleotide sequence to be expressed that described expression cassette in the described insertion fragment comprises at least one promoter sequence and effectively is connected described promoter sequence.

20. the method for claim 19, wherein said promotor be selected from can be in eucaryon or prokaryotic cell prokaryocyte or biology initial promotor of transcribing.

21. the method for claim 19 or 20, wherein said promotor be can be in vegetable cell initial promotor of transcribing.

22. each method of claim 19 to 21, the described purpose nucleic acid that wherein effectively connects described promotor is selected from coding

A) justice, antisense or double-stranded RNA,

B) polypeptide or proteinic sequence set.

23. each method of claim 19 to 21, wherein said expression cassette can give the transgenic plant that comprise described expression cassette at least a phenotype, and this phenotype is selected from the nutritive value of increase, the oil-contg of increase, the starch content of increase, the protein content of increase, the vitamin contents of increase, carotenoid content, enhanced pathogen resistance, the oil composition of change and the stress tolerance that increases of increase.

24. the multiple expression constructs that obtains by each method of claim 1 to 23.

25. the multiple expression constructs of claim 24, wherein said multiple expression constructs comprises at least two and inserts fragment I (n), each inserts fragment and comprises at least one expression cassette, and wherein each insertion fragment flank is that each of wherein said insertion fragment I (n) and described recombination site such as claim 1 to 19 defines by the sequence of re-assembly side A (2i) the reorganization generation of re-assembly side A (2i-1) and identical i.

26. the multiple expression constructs of claim 24 or 25, wherein said multiple expression constructs are each the defined carriers as claim 5 to 13.

27. comprise each the transgenic cell or the non-human being of multiple expression constructs of claim 24 to 26.

28. the transgenic cell of claim 27 or non-human being, wherein said cell or biology are selected from protokaryon and eukaryotic cell or biology.

29. the transgenic cell of claim 27 or 28 or non-human being, wherein said cell or biology are selected from vegetable cell or biology.

30. produce the method for grain or feeds product, medicine or chemical, described method comprises provides claim 27 to 29 each transgenic cell or biology, grow described cell or biology and randomly separate described grain or feed product, medicine or chemical.