CN114129732B

CN114129732B - Use of NADPH oxidase 2 inhibitors for the production of medicaments

Info

Publication number: CN114129732B
Application number: CN202111492031.XA
Authority: CN
Inventors: 王钊; 高钰琪
Original assignee: Tsinghua University
Current assignee: Tsinghua University
Priority date: 2021-12-08
Filing date: 2021-12-08
Publication date: 2022-10-25
Anticipated expiration: 2041-12-08
Also published as: CN114129732A

Abstract

The invention relates to application of an NADPH oxidase 2 inhibitor in preparing a medicament, in particular to application of the NADPH oxidase 2 inhibitor in preparing a medicament for preventing and/or treating NAFLD. The medicament is used for preventing and/or treating non-alcoholic fatty liver disease; the medicament is used for preventing and/or treating non-alcoholic fatty liver disease induced and/or aggravated by high carbohydrate. According to the invention, the NADPH oxidase 2 inhibitor is adopted, so that the non-alcoholic fatty liver disease can be effectively prevented and/or treated.

Description

Use of NADPH oxidase 2 inhibitors for the production of medicaments

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to application of an NADPH oxidase 2 inhibitor in preparation of a medicament, and more particularly relates to application of the NADPH oxidase 2 inhibitor in preparation of a medicament for preventing and/or treating NAFLD.

Background

Non-alcoholic fatty liver disease (NAFLD for short) is a metabolic disorder characterized by the accumulation of a large amount of lipids in the liver. Current studies indicate that increased liver inflammation is an important marker for the development of NAFLD and that this process is closely related to body insulin resistance. It can directly cause decompensated liver cirrhosis, hepatocellular carcinoma, and relapse of transplanted liver, and also affect the progress of other chronic liver diseases, and participate in the onset of type 2 diabetes and atherosclerosis. Currently, the harm of non-alcoholic fatty liver disease to human health continues to increase. For this reason, the search for new drugs for the treatment of non-alcoholic fatty liver disease is a key and new challenge in the contemporary medical field.

Therefore, there is a great need to find a method for effectively treating NAFLD.

Disclosure of Invention

The present invention aims to solve at least to some extent at least one of the technical problems of the prior art. Therefore, the invention provides the application of the NADPH oxidase 2 inhibitor in preparing the medicaments, and the NADPH oxidase 2 inhibitor can effectively prevent and/or treat the non-alcoholic fatty liver disease.

The present invention has been completed based on the following findings of the inventors:

NADPH oxidase 2 (also called NOX 2) is a peroxide complex enzyme, and can further regulate and control downstream gene expression by catalyzing substrate NADH/NADPH to generate Reactive Oxygen Species (ROS). NOX2 is widely found in various tissues of the body, including the liver, heart, kidneys, vascular endothelium, and adipose tissue. NOX2 is reported to have a key regulatory role in metabolic diseases related to oxidative stress, such as diabetes, hypertension, angiosclerosis and the like, and the increase of NOX2 can cause the aggravation and the worsening of the diseases. In addition, research shows that NOX2 is closely related to the function of islet beta cells and the insulin sensitivity of a body, and the NOX2 has a potential regulation function in diseases related to inflammatory injury caused by metabolism and oxidative stress.

At present, studies indicate that high lipid is the main cause of and aggravates NAFLD, but neglects that high carbohydrate can induce and aggravate NAFLD as well, and the induction mechanism of the two is different. Also, the inventors have unexpectedly discovered through experimentation that NOX2 inhibitors can be used to prevent and/or treat NAFLD, and in particular, can act on high carbohydrate exacerbated NAFLD; and, it has been found that NOX2 inhibitors are effective in reducing inflammatory factors in the liver and reducing the degree of liver fibrosis in individuals with high carbohydrate induced and/or exacerbated NAFLD, thereby effectively preventing and/or treating high carbohydrate induced and/or exacerbated NAFLD.

In one aspect of the invention, the invention provides the use of a NOX2 inhibitor for the manufacture of a medicament. According to an embodiment of the invention, the medicament is for the prevention and/or treatment of non-alcoholic fatty liver disease.

The inventor has found through a great deal of experiments that the NOX2 inhibitor can effectively reduce the inflammatory factors in the liver, reduce the degree of liver fibrosis, reduce the lipid accumulation in the liver and/or cells, and effectively prevent and/or treat NAFLD, in particular prevent and/or treat NAFLD induced and/or aggravated by high carbohydrate.

According to an embodiment of the present invention, the above-mentioned use may further include at least one of the following technical features:

according to an embodiment of the invention, the medicament is for the prevention and/or treatment of high carbohydrate induced and/or exacerbated non-alcoholic fatty liver disease.

The non-alcoholic fatty liver disease can be induced or worsened by taking high carbohydrate or high fat compounds, and the inventor finds through a large number of experiments that the NOX2 inhibitor is more suitable for the non-alcoholic fatty liver disease induced or worsened by the high carbohydrate and has better prevention or treatment effect compared with the non-alcoholic fatty liver disease induced or worsened by the high fat.

According to an embodiment of the invention, the medicament is for reducing inflammation in the liver.

According to an embodiment of the invention, the medicament is for reducing intrahepatic lipid accumulation.

According to an embodiment of the invention, the medicament is for reducing inflammatory factors; wherein the inflammatory factor is at least one selected from IL-1 beta and TNF alpha.

According to an embodiment of the invention, the medicament is for reducing liver fibrosis.

According to an embodiment of the invention, the medicament is for reducing intracellular lipid accumulation.

According to an embodiment of the invention, the NOX2 inhibitors include inhibitors that inhibit expression of the encoding NOX2 gene, inhibitors that inhibit NOX2 assembly, inhibitors that inhibit activation of NOX2, and inhibitors that inhibit NOX2 activity. Wherein the inhibitor for inhibiting the expression of the NOX2 gene can reduce the production of NOX2 by inhibiting the expression of the NOX2 gene. Thus, the use of the above-described NOX2 inhibitors can prevent and/or treat NAFLD, particularly NAFLD induced and/or exacerbated by high carbohydrate.

According to an embodiment of the invention, the NOX2 inhibitor is selected from at least one of: GSK2795039, diphenyl iodonium chloride salt, and an adeno-associated virus solution, wherein the adeno-associated virus comprises shRNA sequences targeting the NOX2 gene. Thus, the use of the above-described NOX2 inhibitors can prevent and/or treat NAFLD, particularly NAFLD induced and/or exacerbated by high carbohydrate.

According to the embodiment of the invention, the adeno-associated virus is specifically constructed as follows: screening to obtain siRNA sequence for knocking down NOX2 gene expression: AGCCATTGAGGTCATTCATAA; using the GV681 vector, the sequence of elements is: TBGp-EGFP-MIR155 (MCS) -SV40 PolyA, and constructing a target gene overexpression vector to obtain the gene with the titer of 1.20 multiplied by 10 ¹³ virus solution at titer/ml. The adeno-associated virus can be injected through tail vein to play a role in endogenous reduction of NOX2 expression.

The term "treating" as used herein is intended to mean obtaining a desired pharmacological and/or physiological effect. The effect may be prophylactic in terms of complete or partial prevention of the disease or symptoms thereof, and/or may be therapeutic in terms of a partial or complete cure for the disease and/or adverse effects caused by the disease. As used herein, "treatment" encompasses diseases in mammals, particularly humans, including: (a) Preventing the occurrence of a disease or disorder in an individual susceptible to the disease but not yet diagnosed; (b) inhibiting a disease, e.g., arresting disease progression; or (c) alleviating the disease, e.g., alleviating symptoms associated with the disease. As used herein, "treatment" encompasses any administration of a drug or compound to an individual to treat, cure, alleviate, ameliorate, reduce or inhibit a disease in the individual, including but not limited to the administration of a drug containing a compound described herein to an individual in need thereof.

The term "medicament" as used herein includes those suitable for oral, nasal, topical, buccal, sublingual, rectal and/or parenteral administration. The formulations may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. The amount of active ingredient that can be combined with the carrier materials to produce a single dosage form is generally that amount of the compound which produces a therapeutic effect. Generally, the amount is from about 1% to about 99% active ingredient, preferably from about 5% to about 70%, most preferably from about 10 to about 30%, in units of one percent.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a pathological section of liver of a mouse in example 1 of the present invention;

FIG. 2 is a statistical chart of the content of reactive oxygen species and inflammatory factors in the liver of the mouse in example 1 of the present invention;

FIG. 3 is a graph showing the oil red staining of cells in example 2 of the present invention.

Detailed Description

The scheme of the invention will be explained with reference to the following examples. It will be appreciated by those skilled in the art that the following examples are illustrative of the invention only and should not be taken as limiting the scope of the invention. The examples, where specific techniques or conditions are not indicated, are to be construed according to the techniques or conditions described in the literature in the art or according to the product specifications. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products commercially available.

Example 1:

a mouse model of NAFLD was constructed by selecting 6-week-old wild-type mice with genetic background C57BL/6J and feeding the mice on a high-fat diet (Table 1) for 16 weeks. The adeno-associated virus is utilized to knock down mouse intrahepatic NOX2 expression, and the adeno-associated virus is used as a target for NOX2 key subunit p47 ^phox The virus (Shanghai Jikai Gene medicine science and technology Co., ltd.).

Successfully constructed NAFLD mice were randomized into 5 groups of 10 mice each, of which the first group (Normal-HCD): injecting normal saline, feeding with high carbohydrate diet; second group (AAV-sh-Ctrl-HCD): injecting empty virus, and feeding on high carbohydrate diet; third group (AAV-sh-p 47) ^phox -HCD): knock-down by injection p47 ^phox The virus of (4), high carbohydrate diet; fourth group (AAV-sh-Ctrl-HFD): injection knockdown of p47 ^phox The virus of (4), high-fat diet feeding; fifth group (HFD): high fat diet was maintained throughout the same month of age. After 8 weeks of intervention, mice livers were pathologically sectioned for observation of liver lipid accumulation, inflammatory infiltration, and fibrosis, as shown in figure 1. The liver active oxygen marker 4-HNE, inflammation related factors IL-1 beta and TNF alpha are measured by real-time fluorescence quantitative PCR, and beta-actin is used as an internal reference for calibration to evaluate the liver inflammation level, which is specifically shown in figure 2.

As can be seen from fig. 1, the third group was effective in improving high carbohydrate deteriorated NAFLD, and the fourth group was less effective in improving high lipid deteriorated NAFLD; at the same time, knock-down of p47 ^phox The virus can effectively reduce the infiltration of inflammatory factors in the liver of mice, reduce the expression of the inflammatory factors and reduce the degree of liver fibrosis. Thus, the results indicate that p47 was knocked down by injection ^phox The virus NAFLD mouse can effectively improve NAFLD, p47 caused by high carbohydrate ^phox Show inhibition of high carbohydrate contentThe effect of improving the specificity of the NAFLD is achieved.

TABLE 1 specific feed formulations for High Fat Diet (HFD) and High Carbohydrate Diet (HCD)

Example 2:

the experiment of this example used AML12 mouse normal hepatocytes (purchased from synergetics cell bank) to construct NAFLD model cells in high lipid medium (DMEM/F12 medium containing 100. Mu.M palmitic acid and 200. Mu.M oleic acid). First group (I): AML12 mouse normal hepatocytes were used as a control group; a second group (II) using NAFLD model cells as a model group; a third group (III) in which NAFLD model cells were cultured by diphenyl iodonium chloride salt (DPI); a fourth group (IV) in which NAFLD model cells were cultured by GSK 2795039; a fifth group (V) in which NAFLD model cells are cultured in a high-sugar medium; a sixth group (VI) in which the NAFLD model cells are cultured in a high sugar medium plus diphenyliodonium chloride (DPI); seventh group (vii), NAFLD model cells were cultured on high sugar medium + GSK 2795039. After culturing for 48 hours, the intracellular triglyceride content was measured, and the cells were stained with oil red, as shown in FIG. 3, wherein the intracellular triglyceride content of each group is shown in the bar chart, the grouping condition and the treatment condition of each group are shown in the table, the oil red staining result corresponding to each group is shown in the staining chart, and the positive part is the lipid drop. The results show that cells with added inhibitors can effectively resist the intracellular lipid increase of NAFLD model cells.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are exemplary and not to be construed as limiting the present invention, and that changes, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

Claims

Use of a NOX2 inhibitor for the manufacture of a medicament for the prevention and/or treatment of high carbohydrate induced and/or exacerbated non-alcoholic fatty liver disease;

the NOX2 inhibitor is selected from at least one of:

GSK2795039, diphenyl iodonium chloride salt and an adeno-associated virus solution, wherein the adeno-associated virus solution comprises shRNA sequences targeting NOX2 genes.
2. The use according to claim 1, wherein the medicament is for reducing inflammation in the liver.
3. Use according to claim 1, wherein the medicament is for reducing intrahepatic lipid accumulation.
4. The use according to claim 1, wherein the medicament is for reducing inflammatory factors.
5. Use according to claim 1, wherein the medicament is for reducing liver fibrosis.
6. Use according to claim 1, wherein the medicament is for reducing intracellular lipid accumulation.