CN114432333A

CN114432333A - Application of MiR-503 cluster sponge in preparation of medicine for treating type 2 diabetes

Info

Publication number: CN114432333A
Application number: CN202210186083.2A
Authority: CN
Inventors: 朱云霞; 韩晓; 刘可容; 周云财; 张艳; 唐伟; 李雅婷; 常晓嫒
Original assignee: Nanjing Medical University
Current assignee: Nanjing Medical University
Priority date: 2022-02-28
Filing date: 2022-02-28
Publication date: 2022-05-06
Anticipated expiration: 2042-02-28
Also published as: CN114432333B

Abstract

The invention discloses application of a miR-503 cluster sponge in preparation of a medicine for treating type 2 diabetes, wherein the miR-503 cluster sponge is used for inhibiting miR-503 and miR-424 in a targeted manner (called miR-322 in a mouse), the miR-503 cluster sponge is used for sealing the expression of miR-503 and miR-424/miR-322 in beta cells, and the miR-503 cluster sponge is further applied to preparation of the medicine for treating type 2 diabetes so as to solve the problems of lack of the current treatment method for type 2 diabetes and high treatment cost.

Description

Application of MiR-503 cluster sponge in preparation of medicine for treating type 2 diabetes

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of miR-503 cluster sponge in preparation of a medicine for treating type 2 diabetes.

Background

Diabetes Mellitus (DM) is a systemic metabolic disorder syndrome characterized primarily by chronic hyperglycemia due to relative or absolute insulin deficiency. According to the latest report of the international diabetes union, about 4.63 hundred million 20-79 years old adults suffer from diabetes in 2019 globally; by 2030, the number of diabetics can reach 5.784 hundred million, which accounts for about 8% of the world's general population, and not only affects the physical and mental health of the diabetics, but also causes a significant burden to the medical expenditure of society. Diabetes can be classified into type 1, type 2, gestational type and other types of diabetes, wherein the number of patients with type 2 diabetes (T2DM) accounts for more than 95%. Therefore, the prevention, diagnosis and treatment of type 2 diabetes have been an important direction for research and development of medical field in all countries of the world.

Type 2 diabetes is etiologically diverse, and in addition to genetic factors such as familial inheritance, obesity, lack of exercise, and natural age increase are considered to be major factors leading to the development of diabetes. Under these pathological conditions, chronic low-grade inflammation develops in local tissues or in the systemic range, resulting in a decrease in endogenous insulin levels, i.e., beta cell dysfunction, and a decrease in insulin action, i.e., the onset of insulin resistance. Insulin resistance and beta cell dysfunction act together, which disturbs glycolipid metabolism and causes various complications in patients, and is a typical characteristic of type 2 diabetes. The treatment means of type 2 diabetes mellitus comprises two modes of sugar-reducing drug treatment and metabolic surgery treatment, and weight-reducing surgery has a remarkable effect but is only developed in extremely obese patients due to large trauma, so that drug treatment is the main means for treating type 2 diabetes mellitus.

At present, a plurality of medicines can respectively treat insulin resistance and beta cell dysfunction, the medicines capable of improving the insulin resistance comprise metformin, thiazolidinediones and the like, and the medicines capable of promoting insulin secretion comprise GLP-1 receptor agonist and DPP-4 inhibitor; in addition, there are α -glucosidase inhibitors which inhibit glucose absorption, sodium-glucose cotransporter 2 inhibitors which promote glucose excretion, insulin, and the like. Insulin resistance and beta cell dysfunction often exist in a patient body at the same time, and during treatment, multiple medicaments are usually required to be used together for a long time, so that the life quality of the patient is influenced, and adverse reactions such as hypoglycemia, obesity or excessive emaciation can be caused. Therefore, it is important to develop and provide a new therapeutic method capable of simultaneously improving insulin resistance and beta cell dysfunction.

MiRNAs are a class of single-stranded non-coding RNAs that have been highly conserved evolutionarily, are about 22-23 bases long, and have nearly 2500 or more types of miRNAs found in humans. The classical mode of action of mirnas is to bind to the 3 '-untranslated region (3' -UTR) of its target gene mRNA, inhibit its translation or promote its degradation, and is a major executive molecule of negative regulation after gene transcription, participating in processes such as cell proliferation, differentiation, and function maintenance. In recent years, it has been found that mirnas not only act intracellularly but also are secreted extracellularly to take on the role of intercellular signaling, and the diversity of functions is determined by the diversity of target genes and modes of action.

The MiR-503 cluster is located at the 26.3 site of the long arm of the X chromosome, and comprises miR-503 and miR-424 (a mouse is called miR-322), and the miR-503 cluster and the miR-424 have the same germplasm sequence (CGACGA). Research finds that miR-503 high expression in the pancreas in the embryonic period is related to pancreas development, and the miR-503 high expression in the pancreas and the pancreas islet gradually decrease after birth. In an adult individual, the miR-503 cluster is only highly expressed in the lung, and the miR-503 cluster is re-expressed in a pathological condition in an open mode, so that various diseases can be promoted, such as diabetic gangrene and the like.

MiRNA sponge (miRNA sponge) is a high-efficiency method developed by Phillip Sharp and colleagues of the science and technology of Massachusetts for inhibiting miRNA genes for a long time. A MiRNA sponge is an mRNA whose 3 '-untranslated region (3' -UTR) contains several MiRNA targeting sites. More importantly, these targeted sites have some mismatches at the RISC cleavage site. Thus, the inhibitor mRNA is not degraded and stably binds to RISC, keeping it away from the native mRNA target.

Disclosure of Invention

The invention provides a miR-503 cluster sponge which is an inhibitor of a miR-503 cluster and is combined with endogenous miR-503 and miR-424 (a mouse is called miR-322) in a targeted manner so as to inhibit the function of the miR-503 cluster sponge. The miR-503 cluster sponge seals the expression of the miR-503 cluster in the islet beta cells, and is further applied to the preparation of the medicine for treating type 2 diabetes, so that the problems of lack of the current treatment method for type 2 diabetes and high treatment cost are solved.

Specifically, the nucleotide sequence of the miR-503 cluster sponge is shown in SEQ ID No.1, and specifically comprises the following steps:

GCGATCGCCAGGCTCAAACCCTCCTCAGGGAGGGTCCCCAGGCTCAAACCCTCCTCAGGGAGGGTCCCCAGGCTCAAACCCTCCTCAGGGAACGCGTCTGCAGTACTAACCCGCTGCTAGGGTCCCCTGCAGTACTAACCCGCTGCTAGGGTCCCCTGCAGTACTAACCCGCTGCTATCCAAAACATTTCTGCTGCTGGGGTCCCTCCAAAACATTTCTGCTGCTGGGGTCCCTCCAAAACATTTCTGCTGCTCTCGAG。

furthermore, the miR-503 cluster with increased expression in pancreatic islet beta cells can damage the function of the beta cells and can also promote the generation of insulin resistance, and the miR-503 cluster sponge can improve the phenotype of impaired glucose tolerance of senile diabetic mice.

Specifically, in application, the miR-503 cluster sponge is effectively connected with an expression vector. The term "effective connection" refers to the connection of the miR-503 cluster sponge and an expression vector, so that the generated nucleic acid construct can transcribe the miR-503 cluster sponge in cells or animals.

Preferably, the expression vector is an adeno-associated virus 8 vector, and preferably, an insulin gene promoter is selected to promote sequence expression. In a specific embodiment, a pAAV-MCS vector is used.

The MiR-503 cluster nucleic acid construct can be used for synthesizing a forward sequence and a reverse sequence by adding enzyme cutting sites matched with an expression vector at two ends of a miR-503 cluster sponge sequence so as to be effectively connected with the expression vector.

In one embodiment, a miR-503 cluster nucleic acid construct (also known as miR-503 cluster sponge adeno-associated virus) can be prepared by:

1) selecting an adeno-associated virus vector pAAV-MCS; helper plasmid pAAV-RC; adenovirus plasmid phepper; the competent cells are AAV-293 cells; resistance, Amp; the promoter is an insulin promoter and is connected to the 5' end of the miR-503 cluster sponge sequence, and the promoter can ensure that the specificity of the miR-503 cluster sponge is expressed in islet beta cells;

2) synthesizing miR-503 cluster sponge aiming at a target gene, then constructing an adeno-associated virus expression vector, and amplifying the adeno-associated virus expression vector, helper plasmid and adenovirus plasmid in a large quantity; the three plasmids are transfected into AAV-293 cells simultaneously, the adeno-associated virus expression vector is packaged in a large quantity, the adeno-associated virus is concentrated and purified, and finally the virus titer is determined (not less than 10^12 VG/ml).

The above construction method can also be directly completed by a commercial synthesis company.

The invention selects the aged mice with obvious impaired glucose tolerance, and respectively injects Mouse insulin1(MIP1) -GFP or MIP1-mmu-miR-503-424-Sponge virus vectors through tail veins to observe the change of the metabolic phenotype of the aged mice, thereby providing a novel method for treating type 2 diabetes.

Has the advantages that: according to the invention, the miR-503 cluster is knocked out, so that the function damage of insulin secretion (GSIS) stimulated by insulin glucose in the pancreatic islet caused by high-fat feeding and the insulin resistance of peripheral tissues can be effectively relieved. Meanwhile, according to the action principle of the miR-503 cluster in beta cells and peripheral tissues, MIP1-GFP or MIP1-mmu-miR-503-424-Sponge virus is injected into the tail vein of an aged diabetic mouse, the glucose tolerance of the mouse in a treatment group is improved after 4 weeks of treatment, the function of the beta cell GSIS is improved, and the insulin sensitivity of the peripheral tissues is slightly recovered after 7 weeks of treatment.

Drawings

FIG. 1 shows the changes in the expression of miRNAs in beta cells after treatment with inflammatory factors. FIG. 1A is a graph showing a Wien analysis of miRNAs with significant differences in expression among different groups after treatment with IL-1 β at 10ng/ml for various periods of time; fig. 1B shows a heat map of specific changes in miRNAs whose expression was significantly different in at least three groups in fig. a; FIG. 1C is the change in cell viability of over-expressing miRNAs with increased expression into INS-1 cells.

FIG. 2 shows the transcriptional level changes of miR-503 in metabolism-related organs of mice of 4 months and 2 years of age after high-fat feeding. Fig. 2A is the result of measurement of a high-fat mouse, and fig. 2B is the result of measurement of an aged mouse.

FIG. 3 shows the metabolic phenotype of high-fat fed miR-503 cluster whole-body knockout mice (KO). Fig. 3A is a record of the body weights of WT and KO mice during high-fat feeding, fig. 3B is fasting and postprandial blood glucose levels of the mice three months after high-fat feeding, fig. 3C is the results of glucose tolerance test of the mice, fig. 3D is the results of in vitro perfusion of islets of the mice, and fig. 3E is the results of insulin tolerance test of the mice.

FIG. 4 shows the statistics of islets mass three months after high fat feeding of KO mice. FIGS. 4A and 4B show the statistics of the percentage of islet area to pancreatic area and the statistics of the islet ratios of different sizes, respectively, after three months of high-fat feeding of WT and KO mice.

FIG. 5 shows the metabolic phenotype of geriatric diabetic mice prior to treatment. Fig. 5A and 5B are the results of measurement of body weight and fasting blood glucose levels of mice of 10 weeks of age and old age, respectively, and fig. 5C and 5D are the results of measurement of sugar tolerance and insulin tolerance of mice of 10 weeks of age and old age, respectively.

FIG. 6 shows the metabolic phenotype of aged mice after MIP1-miR-503-424-Sponge virus treatment. Fig. 6A is a strategy diagram for treatment and testing of mice, fig. 6B is fasting and postprandial blood glucose levels of mice after 4 weeks of treatment, fig. 6C is glucose tolerance test of mice after 4 weeks of treatment, fig. 6D is sugar-stimulated insulin secretion test in vivo, and fig. 6E is insulin tolerance test of mice after 7 weeks of treatment.

FIG. 7 shows the statistics of islets mass after MIP1-miR-503-424-Sponge virus treatment. Figures 7A and 7B show the statistics of the percentage of islet area to pancreatic area and the statistics of the ratios of islets of different sizes, respectively, after treatment.

Detailed Description

Example 1 expression rules of miR-503 in tissues of mice, a model of chronic inflammation.

Experimental animals: male C57BL/6J mice were purchased from Nanjing university model animal institute. All animal experiments were approved by the laboratory animal administration committee of the university of medical Nanjing, all the experimental animals were housed in the laboratory animal center barrier facility of the university of medical Nanjing, and were housed in a clean environment at a temperature of (21 + -2) ° C, a humidity of (35 + -2)%, 12h with intermittent illumination around the clock and 12h, with free access to drinking water, which was sterile water prepared by the laboratory animal center.

The experimental results are as follows: as shown in fig. 1, in order to screen miRNAs that change and have significant effects in cells under the study of chronic inflammation conditions, we treated INS-1 cells with 10ng/ml of IL-1 β and collected four groups of samples at different time points to prepare miRNA chips, and as a result, the expression of 305 miRNAs in total in the four groups was significantly different as shown in fig. 1A; subsequently, we performed venn analysis of these miRNAs, screened miRNAs with significant differences in expression in at least three groups, and heat mapped 106 miRNAs analyzed, as shown in fig. 1B, where most of the miRNAs were reduced in expression and only 7 were increased in expression. We over-express these miRNAs into INS-1 cells respectively, and find that they can reduce cell viability, but only over-expressing miR-503 cells have cell viability which is not reduced continuously after IL-1 beta is added on the basis (figure 1C), which shows that miR-503 can completely simulate the injury effect of chronic inflammation on beta cells. Research shows that under the conditions of obesity and natural age increase, chronic inflammation is generated in the body in a local or whole body range, therefore, the transcriptional level of miR-503 in two metabolic related organs of high fat mice and old mice, such as liver, muscle, fat and pancreatic islets, is examined, and the miR-503 is mainly expressed and increased in the pancreatic islets (fig. 2A and B), which indicates that miR-503 cluster plays an important role in the pathogenesis of T2DM and mainly plays a role in the pancreatic islets.

Example 22 role of miR-503 cluster in vivo during development of diabetes.

Experimental animals: to explore the role of the miR-503 cluster in the development of diabetes, we used miR-503 cluster systemic Knockout (KO) mice.

The experimental method comprises the following steps:

1) construction of miR-503 cluster whole-body knockout mice, 10 each of WT and KO, were fed with normal diet (NCD) and High Fat Diet (HFD), and fasting and postprandial blood glucose levels were monitored monthly. When fasting blood glucose is detected, the mice are fasted for 12-16h in advance; the postprandial blood glucose test is that after fasting, the food is fed again, and the blood glucose level is tested after 2 hours of food feeding.

2) When differences in fasting or postprandial blood glucose levels are detected, mice are subjected to glucose tolerance (GTT), in vitro islet perfusion, and insulin tolerance (ITT) experiments. The GTT detection method comprises starving mice for 12-16 hr, injecting 1g/kg body weight glucose into abdominal cavity, and measuring blood glucose value at 0, 5, 15, 30, 60, and 120 min; in vitro islet perfusion was used to evaluate one and two functions of GSIS and Potassium-stimulated insulin secretion (KSIS) function of primary islets. The ITT detection method comprises the steps of after 4-6 hours of hungry of mice, injecting 0.8U/kg body weight insulin into abdominal cavities, and measuring blood sugar values at 0, 15, 30, 60 and 120 minutes respectively.

The experimental results are as follows: as shown in fig. 3, there was no significant difference in body weight between WT and KO mice during HFD (fig. 3A); as shown in fig. 3B, the postprandial blood glucose of KO mice was significantly lower than WT mice at three months in HFD, followed by GTT experiments, and the blood glucose of KO mice was found to be significantly lower than WT mice at 5min, 15min, 60min compared to WT mice (fig. 3C), indicating that the KO mouse glucose clearance rate was significantly improved. As shown in fig. 3D, in vitro islet perfusion results of islets at three months of HFD showed improved insulin secretory capacity in phase 2 in KO mice, with significant better insulin tolerance detected in KO mice than WT mice at four months of HFD (fig. 3E). However, there was no significant difference in islets mass (fig. 4A) and islet size distribution (fig. 4B) in mice after three months of high fat age.

From the above experimental results, it can be seen that, after the miR-503 cluster is knocked out systemically, compared with WT mice, KO mice have significantly improved glucose tolerance under metabolic stress, enhanced insulin sensitivity, and recovery of beta cell glucose-stimulated 2-phase insulin secretion function.

Example 3 blocking the effect of the beta cell-derived miR-503 cluster can reverse the diabetic phenotype in aged mice.

Experimental drugs: MIP 1-mmu-miR-503-424-span, negative control MIP1-NC-GFP, entrust the Weizhen biotechnology company to prepare, all utilize 8 type adeno-associated virus vector pAAV-MCS to construct recombinant plasmid; the auxiliary plasmid is pAAV-RC; selecting pHelper as adenovirus plasmid; the competent cells are AAV-293 cells; amp, insulin promoter for promoter, specifically mouse insulin1promoter (mouse insulin1promoter, MIP1) was used.

The experimental method comprises the following steps:

1) selecting 13 mice with the age of 60 weeks, detecting the weight, fasting blood glucose level, glucose tolerance and insulin tolerance of the mice by taking the mice with the age of 10 weeks as a control, dividing the mice into two batches, injecting recombinant viruses into the two batches, dividing 6 mice into two groups in the first batch, respectively injecting control viruses and miR-503 cluster spongiviruses, injecting 3 mice in the second batch, injecting 4 mice in the second batch into miR-503 cluster spongiviruses, injecting the control viruses into caudal vein, and injecting 10^12 VG.

2) Fasting and postprandial blood glucose levels, as well as glucose tolerance, were measured at 4 weeks post-injection.

3) The first group of mice was subjected to in vivo glucose-stimulated insulin secretion test at 5 weeks of injection, with a glucose injection dose of 3g/kg body weight, and blood was taken at 0min, 10min, and 30min to test serum insulin levels.

4) At 7 weeks of injection, two groups of mice were each tested for insulin tolerance. After the mice were starved for 12-16 hours, the blood glucose values were measured at 0, 15, 30, 60, and 120 minutes after 1U/kg body weight of insulin was intraperitoneally injected.

The experimental results are as follows: as shown in fig. 5, the body weight of the 60-week-old mice used in the experiment was significantly increased (fig. 5A), the fasting blood glucose was significantly increased (fig. 5B), and impaired glucose tolerance and significantly decreased insulin sensitivity were found in the mice by GTT and ITT tests (fig. 5C).

As shown in fig. 6, one month after miR-503 cluster sponge treatment, fasting plasma glucose was significantly decreased (fig. 6B), glucose tolerance was significantly improved (fig. 6C), β -cell glucose-stimulated insulin secretion function was improved (fig. 6D), and corrected insulin sensitivity was slightly improved (fig. 6E) in the group of mice. Statistical results showed that there was no significant difference in islets mass (FIG. 7A) and islet size distribution (FIG. 7B) after treatment in mice.

In conclusion, the invention discovers that the miR-503 cluster is mainly expressed and increased in pancreatic islets in the process of diabetes occurrence caused by obesity and natural age increase, and the miR-503 cluster plays an important role in the pathogenesis of T2DM and mainly plays a role in the pancreatic islets.

According to the invention, by utilizing a miR-503 cluster whole-body knockout mouse model, the fact that the miR-503 cluster is knocked out whole-body can be found, and the pancreatic islet function and peripheral tissue insulin sensitivity of a mouse can be well improved. In addition, using 60 week old C57BL/6J mice, the improvement in metabolic phenotype of the mice could be monitored 1 month after treatment by tail vein injection of MIP 1-mmu-miR-503-424-span or control virus.

Sequence listing

<110> Nanjing university of medical science

Application of <120> MiR-503 cluster sponge in preparation of medicine for treating type 2 diabetes

<160> 1

<170> SIPOSequenceListing 1.0

<210> 1

<211> 259

<212> DNA

<213> miR-503 cluster sponge (Artificial Sequence)

<400> 1

gcgatcgcca ggctcaaacc ctcctcaggg agggtcccca ggctcaaacc ctcctcaggg 60

agggtcccca ggctcaaacc ctcctcaggg aacgcgtctg cagtactaac ccgctgctag 120

ggtcccctgc agtactaacc cgctgctagg gtcccctgca gtactaaccc gctgctatcc 180

aaaacatttc tgctgctggg gtccctccaa aacatttctg ctgctggggt ccctccaaaa 240

catttctgct gctctcgag 259

Claims

The application of the MiR-503 cluster sponge in preparing the medicines for treating type 2 diabetes mellitus is disclosed, wherein the nucleotide sequence of the miR-503 cluster sponge is shown as SEQ ID No. 1.
2. The use according to claim 1, wherein said type 2 diabetes is obesity and natural age-related type 2 diabetes.
3. The use of claim 1, wherein the miR-503 cluster sponge improves glucose tolerance under metabolic stress, enhances insulin sensitivity, restores beta-cell glucose-stimulated 2-phase insulin secretion function, reverses the phenotype of impaired glucose tolerance in aged diabetic mice.
4. The use of claim 1, wherein the miR-503 cluster sponge, when applied, is present in the form of a nucleic acid construct.
5. The use of claim 4, wherein the nucleic acid construct is obtained by operably linking a miR-503 cluster sponge sequence to an expression vector.
6. The use according to claim 5, wherein the expression vector is adeno-associated virus type 8 and the promoter used is the insulin promoter.
7. The use of claim 4, wherein the miR-503 cluster nucleic acid construct is prepared by:

1) the adeno-associated virus vector is pAAV-MCS, the helper plasmid is pAAV-RC, and the adenovirus plasmid is pHelper; the competent cells are AAV-293 cells; amp is selected as resistance; the promoter is an insulin promoter and is connected to the 5' end of the miR-503 cluster sponge sequence;

2) synthesizing miR-503 cluster sponge aiming at a target gene, then constructing an adeno-associated virus expression vector, and amplifying the adeno-associated virus expression vector, helper plasmid and adenovirus plasmid; the three plasmids are transfected into AAV-293 cells simultaneously, and a large amount of adeno-associated virus expression vectors are packaged, and then adeno-associated virus is concentrated and purified.