CN114107462A

CN114107462A - Abortion marker and application thereof in diagnosis and prediction of recurrent abortion pathological pregnancy

Info

Publication number: CN114107462A
Application number: CN202010881249.3A
Authority: CN
Inventors: 杜晶; 刘军伟; 张兆奉; 徐建华; 顾艳; 朱伟强
Original assignee: Shanghai Institute Of Biomedical Technology
Current assignee: Shanghai Institute Of Biomedical Technology
Priority date: 2020-08-27
Filing date: 2020-08-27
Publication date: 2022-03-01

Abstract

The invention relates to abortion markers and application thereof in diagnosis and prediction of recurrent abortion pathological pregnancy. Specifically, the invention provides an RSA marker circular RNA hsa _ circ _0008362 and application of a detection reagent thereof in diagnosis and prediction of recurrent abortion (RSA), and comprises a diagnostic reagent or a kit for preparing diagnosis/prediction RSA. Research shows that the RSA marker of the present invention may be used as marker for diagnosing RSA and predicting RSA generation, and has high sensitivity and specificity.

Description

Abortion marker and application thereof in diagnosis and prediction of recurrent abortion pathological pregnancy

Technical Field

The present invention relates to the field of biotechnology and medicine, and more specifically to abortion markers and their use in the diagnosis and prediction of recurrent abortion (RSA) pathological pregnancy.

Background

Recurrent Spontaneous Abortion (RSA) refers to the recurrent spontaneous abortionSpontaneous abortion of at least 2 times in women with the same sexual partner^[1]. Most RSA occurs early in pregnancy, typically within 10 weeks of pregnancy^[2]. Causes of RSA are diverse and complex, and known causes include endocrine dysfunction, anatomical factors, genetic factors, immunological factors, infectious diseases, and advanced age of both parents; another reason for about 50% of RSA is unclear^[3]. Clinical studies on how to diagnose and/or predict the occurrence of RSA remain blank.

Circular RNAs (circular RNAs) are a novel competitive endogenous non-coding RNAs molecules with a regulating effect and are widely present in eukaryotic cytoplasm. Unlike traditional linear RNA (containing 5 'and 3' ends), circRNAs have a closed ring structure, are not easily degraded by exonuclease, are more stable in expression, and have the characteristics of high abundance, stable structure, tissue specificity and the like^[4]. Functionally, recent researches show that circRNA molecules are rich in microrna (miRNA) binding sites and play a role of miRNA sponge (miRNA sponge) in cells, so that the inhibition of miRNA on target genes of the miRNA is relieved, and the expression level of the target genes is increased, wherein the action mechanism is called competitive endogenous rna (cerana) mechanism^[4,5]。

circRNA plays an important regulatory role in disease through the interaction with disease-associated mirnas. With clinical application in treating diabetes, cancer, cardiovascular diseases and nervous system diseases^[6-9]The circRNA provides an important new research idea and a treatment target for disease treatment. Meanwhile, the circRNA has the characteristics of universality, conservation, tissue specificity, stability and the like, so that the circRNA has great potential as a marker for disease screening and treatment, and is predicted to become a novel biomarker in the future along with the rapid development of high-throughput sequencing and molecular bioinformatics technologies. The research shows that the expression of circRNAs in the embryonic development process shows obvious dynamic change, and host genes of the circRNAs are rich in human embryos and closely related to the processes of DNA damage repair, organelle and chromosome structures, cell cycle process, metabolic regulation and the like^[10]The circRNAs mayCan participate in the pathological process of embryo implantation failure^[11]There was a significant difference in circRNAs between RSA patients and normal villous tissue^[12]. Several studies suggest that circRNAs may have unique and important functions in embryonic development and pregnancy establishment. Although the exact mechanism of action remains to be elucidated, the use of circRNAs as candidate molecules for RSA identification has revealed a wide prospect in clinical applications.

In summary, it can be seen from the existing studies that the diagnostic and/or prognostic methods for RSA are currently poorly understood. Therefore, there is a great need in the art for molecular markers that can be used for RSA diagnosis and/or prediction, while also providing a new perspective for the study of RSA pathogenesis and the screening and identification of its biomarker molecules.

Disclosure of Invention

The object of the present invention is to provide specific markers and detection methods for diagnosing and/or predicting recurrent abortion (RSA) with high sensitivity and high specificity.

Specifically, the invention provides the application of circular RNA hsa _ circ _0008362 as a marker in diagnosing and/or predicting recurrent abortion pathological pregnancy.

In a first aspect of the invention, the invention provides an application of a recurrent abortion (RSA) pathological pregnancy marker circular RNA or a detection reagent thereof, wherein the circular RNA is hsa _ circ _0008362, and is used for preparing a diagnostic reagent or a kit, and the diagnostic reagent or the kit is used for (a) diagnosing recurrent abortion RSA and/or (b) predicting occurrence of recurrent abortion RSA.

In another preferred embodiment, the detection reagent comprises:

(a) RSA marker circular RNA hsa _ circ _0008362 or cDNA thereof; and/or

(b) Primers or primer pairs, probes or chips (e.g.nucleic acid chips) for specific amplification of the RSA marker circular RNA hsa _ circ _ 0008362.

In another preferred embodiment, the diagnosis includes early diagnosis, auxiliary diagnosis, or a combination thereof.

In another preferred embodiment, the RSA marker circular RNA hsa _ circ _0008362 is of mammalian origin.

In another preferred embodiment, the mammal includes human and non-human mammals, preferably primates (e.g., humans).

In another preferred embodiment, the RSA marker circular RNA hsa _ circ _0008362 is of human origin.

In another preferred embodiment, the nucleotide sequence of the RSA marker circular RNA hsa _ circ _0008362 is shown in SEQ ID NO: 1.

In another preferred example, the test is a test on an ex vivo sample.

In another preferred embodiment, the ex vivo sample is selected from the group consisting of: a serum sample, a tissue sample, or a combination thereof.

In another preferred example, the tissue sample is a villus tissue sample.

In another preferred embodiment, the detection is the detection of the presence, absence and/or amount of expression of circular RNA hsa _ circ _0008362 in a serum and/or tissue sample.

In another preferred example, if the expression level of the marker is significantly higher than that of the normal population, the test subject is indicated to have RSA.

In another preferred example, if the concentration of the RSA marker C1 in the test sample is significantly higher than the control reference value C0, the subject has a greater chance of RSA than the general population.

In another preferred embodiment, the expression "significantly higher" means that the ratio of C1/C0 is 1.5 or more, preferably 2 or more, and more preferably 3 or more.

In another preferred embodiment, the detection reagent is a PCR primer pair.

In another preferred embodiment, the PCR primer pair is:

5'-GTCCATTGCTATCAGCCCATTA-3', SEQ ID NO: 2; and

5'-TCCACTTCAGCAGAATCCC-3'，SEQ ID NO：3。

in another preferred embodiment, the GC content of the upstream primer is 45.5%, and the TM value is 59.5.

In another preferred embodiment, the GC content of the downstream primer is 52.6%, and the TM value is 55.2.

Wherein the GC content is the ratio of guanine to cytosine among 4 bases in DNA.

In a second aspect of the invention, there is provided a kit for the diagnosis of recurrent abortion (RSA), said kit comprising a detection reagent for detecting the RSA marker circular RNA hsa _ circ _ 0008362; and instructions, wherein the instructions state that the kit is useful for (a) diagnosing RSA, and/or (b) predicting RSA development.

In another preferred embodiment, the kit contains the RSA marker circular RNA hsa _ circ _0008362 as a control or quality control.

In another preferred embodiment, the control or quality control is RNA or DNA.

In another preferred embodiment, the control or quality control is selected from the group consisting of: full-length SEQ ID No. 1 or fragment P1 thereof, full-length SEQ ID No. 4 or fragment P2 thereof, wherein both fragments P1 and P2 contain a splicing site (preferably containing TCA)GGATG, wherein GG is a nucleotide of the splice site).

In another preferred embodiment, the reference substance or quality control substance is SEQ ID No. 5.

In another preferred embodiment, the reagents are PCR primer pairs and the primer pairs are used to amplify circular RNA hsa _ circ _ 0008362.

In another preferred embodiment, the detection reagent is a PCR primer pair, and the primer pair is SEQ ID No. 2 and SEQ ID No. 3.

In another preferred embodiment, the description comprises the following: if the expression level of the circular RNA hsa _ circ _0008362 in the serum and/or tissue sample of the test object is significantly higher than the reference value of the control, the test object can be preliminarily judged as the RSA patient or the possibility of RSA generation is higher than that of the general population.

In another preferred embodiment, the control reference value is the expression level of circular RNA hsa _ circ _0008362 in serum and/or tissue samples of healthy people and/or general induced abortion people.

In a third aspect of the present invention, there is provided a detection method comprising the steps of:

(a) providing an ex vivo test sample from a test subject, wherein the test sample is a serum sample and/or a tissue sample;

(b) detecting the expression amount or level of the circular RNA hsa _ circ _0008362 in the detection sample; and

(c) comparing the expression level or level of the RSA marker circular RNA hsa _ circ _0008362 to a control reference value; wherein, if the expression level or level of the RNA hsa _ circ _0008362 in the test sample is significantly higher than the reference value of the control, the test object is an RSA patient or the possibility of RSA generation is higher than that of the general population.

In another preferred embodiment, the sample is from a test subject.

In another preferred example, the detection object is a human.

In another preferred embodiment, the expression level is detected by quantitative PCR.

In another preferred embodiment, if the expression level of the RSA marker circular RNA hsa _ circ _0008362 is significantly higher than the reference value, the test subject has a greater probability of RSA than the general population.

In another preferred embodiment, the control reference value is the expression level of the RSA marker circular RNA hsa _ circ _0008362 in the same sample of healthy population.

In another preferred embodiment, the reference value is the expression level of the RSA marker circular RNA hsa _ circ _0008362 in the same sample of the general induced abortion population.

In another preferred embodiment, the sample is a serum sample.

In another preferred embodiment, the sample is a tissue sample.

In another preferred embodiment, the method is a non-diagnostic and non-therapeutic method.

In a fourth aspect of the invention, there is provided a method of diagnosing RSA, comprising the steps of:

a) providing a test sample from a subject, said test sample selected from the group consisting of: a serum sample, a tissue sample, or a combination thereof;

b) detecting the expression level of the RSA marker circular RNA hsa _ circ _0008362 in the test sample; and

c) the expression level of the RSA marker circular RNA hsa _ circ _0008362 was compared to a control reference value.

Wherein the expression level of the RSA marker circular RNA hsa _ circ _0008362 in the sample is obviously higher than the reference value of the control, which indicates that the tested object is an RSA patient or the RSA occurrence probability is higher than that of the common population.

In another preferred embodiment, in step (b), the detection comprises PCR (e.g., Q-PCR, ddPCR), sequencing, or a combination thereof.

In another preferred embodiment, the test subject includes human and non-human mammals.

In another preferred example, the general population comprises healthy people and/or general induced abortion people.

In another preferred example, the subject to be tested is an adult female.

In another preferred example, the subject to be tested is a subject who has not suffered abortion.

In another preferred example, the object to be tested is an object which has induced abortion.

In another preferred embodiment, the expression level of the circular RNA hsa _ circ _0008362 is detected by using quantitative PCR, and data processing is performed, wherein the data processing determines whether the object to be detected is an RSA patient according to the expression level of the circular RNA hsa _ circ _0008362 of the object to be detected.

In a fifth aspect of the invention there is provided the use of the RSA marker circular RNA hsa _ circ _0008362 as a marker for diagnosing RSA and/or predicting RSA occurrence.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the structure of hsa _ circ _0008362 and the splicing relationship of hsa _ circ _0008362 to genomic sequences, and the sequencing results of PCR amplification products containing the splicing sites. CDS indicates that the circular RNA is from the coding region. F and R represent the position of the gene-specific primer, respectively, and the arrow indicates the direction of primer priming.

FIG. 2 shows the differential expression of hsa _ circ _0008362 in the villus tissue of RSA patients and that of induced abortion patients, using Real-time PCR. Wherein N represents the number of samples.

FIG. 3 shows the ROC curve for hsa _ circ _0008362 detection in the villus tissue of RSA patients.

FIG. 4 shows the differential expression of hsa _ circ _0008362 in the sera of RSA patients and induced abortion patients using Real-time PCR. Wherein N represents the number of samples.

FIG. 5 shows the ROC curve for hsa _ circ _0008362 test results in the sera of RSA patients.

FIG. 6 shows the DNA sequence (SEQ ID No:4) corresponding to hsa _ circ _0008362 and the positions of the primers (SEQ ID Nos: 2 and 3), with the positions of the primers underlined.

FIG. 7 shows the sequences of amplification products obtained using SEQ ID Nos. 2 and 3 (SEQ ID No: 5). The amplification product contained the sequence of the splice site of hsa _ circ _0008362(SEQ ID Nos: 1 or 4).

Detailed Description

The present inventors have conducted extensive and intensive studies and, for the first time, have unexpectedly found a class of RSA markers present in serum and/or villus tissue, which is circular RNA hsa _ circ _ 0008362. The RSA marker is specifically and highly expressed in serum and/or villus tissues of RSA patients, and therefore can be used as a specific marker for RSA diagnosis (especially early diagnosis and/or auxiliary diagnosis). The experimental result shows that the expression level of the circular RNA hsa _ circ _0008362 in RSA patients is obviously increased compared with that in normal population, and the circular RNA hsa _ circ _0008362 can be used as a marker for diagnosing RSA. The present invention has been accomplished based on this.

Description of the terms

The term "sample" or "specimen" as used herein refers to a material that is specifically associated with a subject from which specific information about the subject can be determined, calculated, or inferred. The sample may be composed in whole or in part of biological material from the subject.

As used herein, the term "expression" refers to the production of a circular RNA from a gene or gene portion.

As used herein, the term "RSA" refers to recurrent spontaneous abortion (spontaneous abortion).

RSA markers

As used herein, the terms "marker of the invention", "RSA marker of the invention", "cyclic RNA marker of the invention", or "cyclic RNA marker hsa _ circ _0008362 of the invention" are used interchangeably to refer to cyclic RNA hsa _ circ _0008362 or a nucleic acid sequence corresponding thereto. The term includes full-length hsa _ circ _0008362 or fragments thereof (as long as the fragment can distinguish hsa _ circ _0008362 from other nucleic acids). In addition, the term also includes nucleic acid molecules in the form of RNA, or cDNA or DNA thereof. In addition, the term also includes nucleic acid molecules in the form of single or double stranded, sense and antisense strands. In addition, the term also includes circular or linear marker nucleic acid molecules. In addition, the term also includes full-length or non-full-length RNA hsa _ circ _0008362, where the non-full-length sequence contains a splice site (e.g., contains a TCA)GGATG, where GG is the nucleotide of the splice site), and is typically greater than 20bp in length.

Preferably "circular RNA hsa _ circ _ 0008362" refers to non-coding RNA in the form of a closed circle, especially hsa _ circ _0008362 in human villus tissue or serum.

In a specific embodiment of the invention, hsa _ circ _0008362 is hsa _ circ _0008362 in a human villus tissue sample.

In another embodiment of the invention, hsa _ circ _0008362 is hsa _ circ _0008362 in a human serum sample.

In one embodiment of the invention, the nucleotide sequence of the circular RNA is shown in SEQ ID NO. 1, and the first two nucleotides and the last two nucleotides are loop binding sites.

The whole length of the nucleotide sequence of the circular RNA hsa _ circ _0008362 is 510bp, and is shown as SEQ ID No. 1.

GAUGACCAGUGUCCCAGUGAAGGAACGAGUGAAGGUGUCUCAGAACUGGAGACUGGGGCGCUGCCGAGAGGGGAUUCUGCUGAAGUGGAGAUGCAGUCAGAUGCCCUGGAUGCAGCUAGAGGAUGAUUCUCUGUACAUAUCCCAGGCUAAUUUCAUCCUGGCCUACCAGUUCCGUCCAGAUGGUGCCAGCUUGAAUCGUCGGCCUCUGGGAGUCUUUGCUGGGCAUGAUGAGGACGUUUGCCACUUUGUGCUGGCCAACUCGCAUAUUGUUAGUGCAGGAGGGGAUGGGAAGAUUGGCAUUCAUAAGAUUCACAGCACCUUCACUGUCAAGUACUCGGCUCAUGAACAGGAGGUGAACUGUGUGGAUUGCAAAGGGGGCAUCAUUGUGAGUGGCUCCAGGGACAGGACGGCCAAGGUGUGGCCUUUGGCCUCAGGCCGGCUGGGGCAGUGCUUACACACCAUCCAGACUGAAGACCGAGUCUGGUCCAUUGCUAUCAGCCCAUUACUCAG(SEQ ID No:1)

The corresponding DNA sequence is corresponding to SEQ ID No. 1 (U is changed into T), and is shown as SEQ ID No. 4:

GATGACCAGTGTCCCAGTGAAGGAACGAGTGAAGGTGTCTCAGAACTGGAGACTGGGGCGCTGCCGAGAGGGGATTCTGCTGAAGTGGAGATGCAGTCAGATGCCCTGGATGCAGCTAGAGGATGATTCTCTGTACATATCCCAGGCTAATTTCATCCTGGCCTACCAGTTCCGTCCAGATGGTGCCAGCTTGAATCGTCGGCCTCTGGGAGTCTTTGCTGGGCATGATGAGGACGTTTGCCACTTTGTGCTGGCCAACTCGCATATTGTTAGTGCAGGAGGGGATGGGAAGATTGGCATTCATAAGATTCACAGCACCTTCACTGTCAAGTACTCGGCTCATGAACAGGAGGTGAACTGTGTGGATTGCAAAGGGGGCATCATTGTGAGTGGCTCCAGGGACAGGACGGCCAAGGTGTGGCCTTTGGCCTCAGGCCGGCTGGGGCAGTGCTTACACACCATCCAGACTGAAGACCGAGTCTGGTCCATTGCTATCAGCCCATTACTCAG(SEQ ID No:4)

the splicing relationship and structure of the circular RNA hsa _ circ _0008362 and the genome sequence are shown in FIG. 1. The circular RNA hsa _ circ _0008362 is formed by cutting and circularizing exons 2-5 of FBXW4 gene. The DNA sequence corresponding to the circular RNA hsa _ circ _0008362 is derived from chr10:103427642 and 103436193 on the 10 th chromosome antisense strand of human.

The FBXW4 gene is located in the long arm of human chromosome 10 and encodes F-Box/WD repeat protein 4, and specific target proteins are recruited through the WD-40 protein-protein binding domain of the F-Box/WD repeat protein 4 for ubiquitin-mediated degradation. F-Box/WD repeat protein 4 may be involved in key signaling pathways critical to normal limb development, e.g., may be involved in Wnt signaling.

Detection method

Based on the high expression of the RSA marker circular RNA hsa _ circ _0008362 in serum and/or tissue samples, the invention also provides a corresponding method for diagnosing RSA.

The present invention relates to diagnostic assays for quantitatively detecting the expression level of the human RSA marker circular RNA hsa _ circ _ 0008362. These assays are well known in the art. The expression level of hsa _ circ _0008362 of the human RSA marker circular RNA detected in the assay can be used to diagnose (including aiding diagnosis) the presence or absence of RSA.

A preferred method is to perform quantitative PCR detection on RNA or cDNA.

A preferred method of diagnosing RSA patients, based on the experimental results of the present invention, is based on the expression level of the circular RNA hsa _ circ _ 0008362. Preferably, the method includes the following judgment method: if the expression level of the circular RNA hsa _ circ _0008362 in the serum and/or tissue sample of the test object is significantly higher than that of the normal population and/or the general induced abortion population, the test object can be preliminarily judged to be suffering from RSA.

Detection kit

Based on the correlation between the RSA marker and RSA, the RSA marker circular RNA hsa _ circ _0008362 can be used as a diagnostic marker of RSA.

The invention also provides a kit for diagnosing RSA, which contains a detection reagent used for detecting the RSA marker circular RNA hsa _ circ _ 0008362. Preferably, the kit contains the RSA marker circular RNA hsa _ circ _0008362 of the present invention; or a primer or primer pair, probe or chip comprising the specifically amplified RSA marker circular RNA hsa _ circ _ 0008362.

In another preferred embodiment, the kit further comprises instructions for use of the kit in diagnosing RSA and/or predicting the occurrence of RSA.

ROC curve

The ROC curve is a short term for a receiver operating characteristic curve (receiver operating characteristic curve), and is often applied in the medical field to determine whether a certain factor has a diagnostic value for diagnosing a certain disease. The ROC graph reflects the relationship between sensitivity and specificity, the X axis of the abscissa is 1-specificity, also called false positive rate (false alarm rate), and the closer the X axis is to zero, the higher the accuracy rate is; the Y-axis on the ordinate is called sensitivity, also called true positive rate (sensitivity), with larger Y-axes representing better accuracy. The whole graph is divided into two parts according to the curve position, the area of the part below the curve is called AUC (area Under Current) and is used for representing the prediction accuracy, and the higher the AUC value, namely the larger the area Under the curve, the higher the prediction accuracy is. The closer the curve is to the upper left corner (the smaller X, the larger Y), the higher the prediction accuracy.

The invention has the main advantages that:

1. the inventor firstly discovers that the circular RNA hsa _ circ _0008362 is related to RSA pathological pregnancy and can be used as a specific marker of recurrent abortion (RSA).

2. The expression condition of the circular specific marker is obtained through detecting serum and/or villus tissue samples, so that the circular specific marker can be used for diagnosing and/or predicting RSA pathological pregnancy conditions.

3. The circular RNA molecule for RSA diagnosis and/or prediction provides a new visual angle for research of RSA pathogenesis and screening and identification of biomarker molecules.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, molecular cloning is generally performed according to conventional conditions such as Sambrook et al: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are by weight.

Materials, reagents, instruments and the like used in examples are commercially available unless otherwise specified.

Materials and methods

Study object

Subjects were enrolled with the following inclusion criteria, selected for recurrent abortion at the scheduled family clinic of the hospital:

recurrent abortion group (RSA group): 2 or more times of spontaneous abortion (including the pregnancy) with the same partner; abdominal pain, vaginal bleeding and vaginal discharge do not occur in the pregnancy process; the prior or subsequent diagnosis and treatment process has eliminated the chromosome karyotype abnormality of infection, dissection, endocrine and couples, the family history of autoimmune diseases, thrombotic diseases and related diseases of women and the sperm abnormality of men.

After informed consent of the subjects, villus tissues of patients with recurrent abortion and induced abortion, and sera of patients with RSA and induced abortion were collected. The collected villus tissue and serum samples were frozen in a freezer at-80 ℃.

Extraction of RNA from villus tissue

The villus tissue of the patient collected in TRIZOL in advance was taken out from a freezer at-80 deg.C, put into a mortar, ground in liquid nitrogen with a pestle, and left at room temperature for 5 minutes when the tissue was ground into a liquid state. The liquid was aspirated, centrifuged at 12000rpm at 4 ℃ for 5 minutes, and then the supernatant was collected, 200. mu.l of chloroform was added thereto at TRIZOL/ml, vigorously shaken for 15 seconds, allowed to stand at room temperature for 2 to 3 minutes, and centrifuged at 12000rpm at 4 ℃ for 15 minutes. The upper aqueous phase was aspirated, 500. mu.l of isopropyl alcohol was added thereto at TRIZOL/ml, and the mixture was left at room temperature for 10 minutes. After completion of the standing, the mixture was centrifuged at 12000rpm at 4 ℃ for 10 minutes, and the supernatant was discarded, whereby RNA was deposited on the bottom of the tube. 1ml of 75% ethanol was added to the TRIZOL/ml, the precipitate was suspended by a Vortex mixer, centrifuged at 12000rpm at 4 ℃ for 5 minutes, the supernatant was discarded, and the precipitate was dried at room temperature for 5 to 10 minutes. RNA was quantified and mass analyzed by dissolving the RNA pellet in 50. mu.l volume of DEPC-treated water, measuring concentration and OD 260/280.

Blood RNA extraction

RNA was extracted using the miRNeasy Serum/Plasma kit (Qiagen) according to the kit instructions. Serum samples were thawed and 200. mu.l was taken, 5 volumes of QIAzol lysis reagent was added, vortexed or vortexed and incubated for 5 minutes at room temperature (15-25 ℃). Adding chloroform with the volume equal to that of serum, covering the cover, violently shaking for 15 seconds, incubating at room temperature for 2-3 minutes, centrifuging at 12000g for 15 minutes at 4 ℃, absorbing the upper aqueous phase, adding absolute ethyl alcohol according to 1.5 times of volume, and blowing and mixing uniformly. Transferring 700 μ l into RNeasy MinElute centrifugal column, centrifuging at room temperature 8000g for 15 s, and removing eluate; adding 500 μ l Buffer RPE, centrifuging at room temperature 8000g for 15 s, and discarding eluate; adding 500 μ l 80% ethanol, centrifuging at room temperature 8000g for 2 min, and removing effluent and collecting tube; placing the column into a new 2ml collection tube, centrifuging at full speed for 5 minutes, and discarding the effluent and collection tube; the column was placed in a new 2ml collection tube, centrifuged at full speed for 5 minutes, and the effluent and collection tube discarded. The column was placed in a new 1.5ml EP tube, 14. mu.l RNase-free water was added to the center of the column, and the column was centrifuged at full speed for 1 minute to elute RNA. The RNA concentration and OD260/280 values were measured, and the RNA obtained was quantified and mass-analyzed.

RT-PCR reaction

The reaction system was prepared and the RT-PCR reaction was carried out according to the instructions of the reverse transcription kit (Thermo scientific, cat # K1682), all in an ice bath. The specific reaction system formulation and operation steps are shown in Table 1.

TABLE 1

Real Time fluorescent quantitative PCR reaction

RT products of villous tissue RNA, using ddH₂O dilution 10 fold, i.e.: 2 μ l RT product +18 μ l ddH₂O; RT products of serum RNA, with ddH₂O dilution 1.5 times, i.e.: 20 μ l RT product +10 μ l ddH₂And O. The primers (SEQ ID No. 2 and SEQ ID No. 3) are synthesized by Biotechnology engineering (Shanghai) corporation, operated according to the instruction, and the lyophilized powder is prepared into 100 μ M primer stock solution with RNase-free water, and then subpackaged and stored; before use, 10-fold dilution (45. mu.l water + 5. mu.l stock solution) was carried out to prepare 10. mu.M working solution. A20. mu.l PCR reaction was set up as in Table 2:

TABLE 2

Diluted RT product	1.0μl
		SYBR Green Mix	10μl
Forward primer(10uM)	0.4μl
		Reverse primer(10uM)	0.4μl
ddH₂O	8.2μl
		Total volume	20μl

In order to reduce or avoid sample addition errors, in actual operation, a mixture is prepared and then different primers are added respectively. 3 multiple holes are arranged. The thermal cycle parameters were set as in table 3:

TABLE 3

After the program is finished, the data is stored and the software and instruments are shut down. The real-time fluorescent quantitative PCR instrument used in the present invention is that of Roche, Switzerland

480II Real-Time PCR System。

Data processing

Raw data obtained from the Real Time fluorescent quantitative PCR reaction were processed according to the following formula:

Δ Ct is an average value of (Ct value of target gene-Ct value of internal reference)

Delta. DELTA. Ct ═ average value (delta. Ct of RSA group target gene-delta. Ct of control group target gene)

Relative expression amount ═ 2^-ΔΔCt) Average value of (a).

Statistical analysis

Statistical analysis SPSS, version 21.0(SPSS inc., IL, USA) in combination with GraphPad Prism version 6(inc., San Diego, CA, USA) software, normality of data was analyzed by the shariro-Wilk test, and in the case where both case and control groups of data were normally distributed, independent sample t-tests were used, non-parametric Mann-Whitney U tests were used for data that did not meet, data were expressed as mean ± standard error, and P <0.05 (two-tailed) was considered to be statistically different.

Example 1

Real-time fluorescent quantitative PCR detection of villus tissue circular RNA hsa _ circ _0008362 expression level

26 cases of villus tissue from patients with recurrent abortion and 24 cases of villus tissue from patients with artificial abortion were collected according to the recruitment criteria described above. RNA from each of the above-mentioned villus tissues was extracted, and the expression level of circular RNA hsa _ circ _0008362 in 50 cases of villus tissues in two groups was determined by real-time fluorescent quantitative PCR. And calculating the relative expression of two groups of villus tissue circular RNA hsa _ circ _0008362 according to the detection result, and performing statistical analysis.

The length of the amplification product obtained by using SEQ ID Nos. 2 and 3 as primers is 116bp, and the sequence is shown in SEQ ID No. 5 and FIG. 7 through sequencing verification. Sequence analysis showed that the amplification product corresponded to RNA hsa _ circ _0008362(SEQ ID Nos: 1 or 4), and the positional relationships of SEQ ID Nos: 2 and 3 to SEQ ID No:4 are shown in FIG. 6.

Further studies have shown that RNA hsa _ circ _0008362 is derived from chr10:103427642 and 103436193 on the antisense strand of chromosome 10 from humans.

The results are shown in fig. 2, the relative expression level of the recurrent abortion villus tissue circular RNA hsa _ circ _0008362 is significantly higher than that of the induced abortion villus tissue, and P is 0.0027, which has significant statistical difference.

Meanwhile, the results were subjected to ROC curve analysis, and the area under the ROC curve was found to be 0.744, as shown in FIG. 3.

Example 2

Real-time fluorescent quantitative PCR detection of serum circular RNAhsa _ circ _0008362 expression level

Serum samples were collected from 11 patients with recurrent abortion and 14 patients with artificial abortion according to the above recruitment criteria. RNA was extracted from each of the above serum samples, and the expression level of circular RNA hsa _ circ _0008362 was measured in two groups of 25 cases of villus tissues in total using real-time fluorescent quantitative PCR. And calculating the relative expression of the two groups of serum samples of circular RNA hsa _ circ _0008362 according to the detection result, and performing statistical analysis.

The length of the amplification product obtained by using SEQ ID Nos. 2 and 3 as primers is 116bp, and the sequence is shown in SEQ ID No. 5 and FIG. 7 through sequencing verification.

The results are shown in fig. 4, the relative expression level of the recurrent abortion serum circular RNA hsa _ circ _0008362 is significantly higher than that of the induced abortion serum, and P is 0.0242, which has significant statistical difference.

Meanwhile, the results were subjected to ROC curve analysis, and the area under the ROC curve was found to be 0.734, as shown in FIG. 5.

The above results show that the amplification product obtained by using the specific amplification primer provided by the application is a single band and has no non-specific amplification, the specific amplification primer can be used as a specific marker for the detection, and the circular RNA hsa _ circ _0008362 can be used as a molecular marker for RSA identification. Wherein the detection sensitivity in tissues can reach 76.9 percent, the specificity can reach 62.5 percent, the detection sensitivity in serum can reach 63.6 percent, and the specificity can reach 92.9 percent.

Example 3

Kit for detecting recurrent abortion (RSA)

Preparing a kit comprising the following primers for specifically amplifying the circular RNA hsa _ circ _0008362 and instructions:

5'-GTCCATTGCTATCAGCCCATTA-3', SEQ ID NO: 2; and

5'-TCCACTTCAGCAGAATCCC-3'，SEQ ID NO：3。

wherein the instructions state that the kit is useful for (a) diagnosing RSA, and/or (b) predicting RSA occurrence.

Reference to the literature

[1]Practice Committee of American Society for Reproductive Medicine.Definitions of infertility and recurrent pregnancy loss:a committee opinion.Fertil Steril.2013；99(1):63.

[2]Branch DW,Gibson M,Silver RM.Clinical practice.Recurrent miscarriage.N Engl J Med.2010；363(18):1740-7.

[3]Creighton CJ,Benham AL,Zhu H,Khan MF,Reid JG,Nagaraja AK,et al.Discovery of novel microRNAs in female reproductive tract using next generation sequencing.PLoS One 2010；5:e9637.

[4]Jeck WR,Sorrentino JA,Wang K,et al.Circular RNAs are abundant,conserved,and associated with ALU repeats[J].RNA,2013,19(2):141-157.

[5]Salzman J.Circular RNA Expression:Its Potential Regulation and Function.Trends Genet.2016May；32(5):309-316.

[6]Zhao Z,Li X,Jian D,et al.Hsa_circ_0054633in peripheral blood can be used as a diagnostic biomarker of pre-diabetes and type 2diabetes mellitus[J].Acta Diabetol,2017,54(3):237-245.

[7]Sun H,Tang W,Rong D,et al.Hsa_circ_0000520,a potential new circular RNA biomarker,is involved in gastric carcinoma.Cancer Biomark.2018Feb 6；21(2):299-306.

[8]Zhao Z,Li X,Gao C,et al.Peripheral blood circular RNA hsa_circ_0124644can be used as a diagnostic biomarker of coronary artery disease[J].Sci Rep,2017,7:39918.

[9]Lukiw WJ.Circular RNA(circRNA)in Alzheimer's disease(AD).Front Genet.2013；4:307.

[10]Dang Y,Yan L,Hu B,et al.Tracing the expression of circular RNAs in human pre-implantation embryos.Genome Biol.2016；17(1):130.

[11]Liu L,Li L,Ma X,et al.Altered Circular RNA expression in patients with Repeated Implantation Failure[J].Cell Physiol Biochem,2017,44(1):303-313.

[12]Qian Y,Wang X,Ruan H,et al.Circular RNAs expressed in chorionic villi are probably involved in the occurrence of recurrent spontaneous abortion[J].Biomed Pharmacother,2017,88:1154-1162.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> scientific institute of family planning in Shanghai City

<120> abortion marker and application thereof in diagnosis and prediction of recurrent abortion pathological pregnancy

<130> P2020-0006

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 510

<212> RNA

<213> Intelligent (Homo sapiens)

<400> 1

gaugaccagu gucccaguga aggaacgagu gaaggugucu cagaacugga gacuggggcg 60

cugccgagag gggauucugc ugaaguggag augcagucag augcccugga ugcagcuaga 120

ggaugauucu cuguacauau cccaggcuaa uuucauccug gccuaccagu uccguccaga 180

uggugccagc uugaaucguc ggccucuggg agucuuugcu gggcaugaug aggacguuug 240

ccacuuugug cuggccaacu cgcauauugu uagugcagga ggggauggga agauuggcau 300

ucauaagauu cacagcaccu ucacugucaa guacucggcu caugaacagg aggugaacug 360

uguggauugc aaagggggca ucauugugag uggcuccagg gacaggacgg ccaaggugug 420

gccuuuggcc ucaggccggc uggggcagug cuuacacacc auccagacug aagaccgagu 480

cugguccauu gcuaucagcc cauuacucag 510

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gtccattgct atcagcccat ta 22

<210> 3

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

tccacttcag cagaatccc 19

<210> 4

<211> 510

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 4

gatgaccagt gtcccagtga aggaacgagt gaaggtgtct cagaactgga gactggggcg 60

ctgccgagag gggattctgc tgaagtggag atgcagtcag atgccctgga tgcagctaga 120

ggatgattct ctgtacatat cccaggctaa tttcatcctg gcctaccagt tccgtccaga 180

tggtgccagc ttgaatcgtc ggcctctggg agtctttgct gggcatgatg aggacgtttg 240

ccactttgtg ctggccaact cgcatattgt tagtgcagga ggggatggga agattggcat 300

tcataagatt cacagcacct tcactgtcaa gtactcggct catgaacagg aggtgaactg 360

tgtggattgc aaagggggca tcattgtgag tggctccagg gacaggacgg ccaaggtgtg 420

gcctttggcc tcaggccggc tggggcagtg cttacacacc atccagactg aagaccgagt 480

ctggtccatt gctatcagcc cattactcag 510

<210> 5

<211> 116

<212> DNA

<213> Intelligent (Homo sapiens)

<400> 5

gtccattgct atcagcccat tactcaggat gaccagtgtc ccagtgaagg aacgagtgaa 60

ggtgtctcag aactggagac tggggcgctg ccgagagggg attctgctga agtgga 116

Claims

1. Use of a circular RNA as a pathologic pregnancy marker of recurrent abortion (RSA) or a detection reagent thereof, wherein the circular RNA is hsa _ circ _0008362, for preparing a diagnostic reagent or a kit for (a) diagnosing RSA of recurrent abortion and/or (b) predicting the occurrence of RSA of recurrent abortion.

2. The use of claim 1, wherein the detection reagent comprises:

(a) RSA marker circular RNA hsa _ circ _0008362 or cDNA thereof; and/or

(b) Primers or primer pairs, probes or chips for specific amplification of the RSA marker circular RNA hsa _ circ _ 0008362.

3. The use according to claim 1, wherein the nucleotide sequence of the RSA marker circular RNA hsa _ circ _0008362 is as shown in SEQ ID No. 1.

4. The use of claim 1, wherein the assay is an ex vivo sample assay.

5. The use of claim 4, wherein the ex vivo sample is selected from the group consisting of: a serum sample, a tissue sample, or a combination thereof.

6. The use of claim 1, wherein the detection reagent is a PCR primer pair.

7. The use according to claim 6, wherein the PCR primer pair is:

5'-GTCCATTGCTATCAGCCCATTA-3', SEQ ID NO: 2; and

5'-TCCACTTCAGCAGAATCCC-3'，SEQ ID NO：3。

8. a kit for diagnosing recurrent abortion (RSA), said kit comprising a detection reagent for detecting the RSA marker circular RNA hsa _ circ _ 0008362; and instructions, wherein the instructions state that the kit is useful for (a) diagnosing RSA, and/or (b) predicting RSA development.

9. The kit of claim 8, wherein the kit comprises the RSA marker circular RNA hsa _ circ _0008362 as a control or quality control; and/or

The detection reagent is a PCR primer pair which is SEQ ID No. 2 and SEQ ID No. 3.

10. The kit of claim 8, wherein the instructions comprise the following: if the expression level of the circular RNA hsa _ circ _0008362 in the serum and/or tissue sample of the test object is significantly higher than the reference value of the control, the test object can be preliminarily judged as the RSA patient or the possibility of RSA generation is higher than that of the general population.