CN114107322A - Application of gene for regulating and controlling soluble solid content of tomato fruit - Google Patents

Abstract

The invention discloses an application of a gene for regulating and controlling the soluble solid content of tomato fruits, wherein the gene has a nucleotide sequence shown as SEQ ID NO: 1, the Solyc01g095900 gene knockout in tomato can improve the content of soluble solids. Namely, the application of the gene Solyc01g095900 is as follows: the method is used for constructing the gene-editing tomato, the gene-editing tomato does not contain exogenous gene fragments, and the content of soluble solids is higher than that of wild type.

Description

Application of gene for regulating and controlling soluble solid content of tomato fruit

Technical Field

The invention relates to the technical field of biology, in particular to application of a tomato SlREC1a gene in regulation of soluble solid content of tomato fruits.

Background

Tomatoes (Solanum lycopersicum) are important vegetable crops in the world and have rich nutritional values. According to the statistics of the food and agriculture organization of the United nations, the tomato planting area in China is about 109 ten thousand hectares, the annual yield reaches 6287 ten thousand tons and the tomato is stably positioned at the first place of the world (http:// www.fao.org/home/en /). Tomato breeding has long been of increased interest in yield, shelf life, and disease resistance, leading to a decrease in flavor quality of cultivated tomatoes in the market (Klee and Tieman, 2013; Tieman et al, 2017).

Saccharides are important components of dry matter of fruits, and are one of the important determinants of flavor and quality of fruits. The types, contents and proportions of the sugar and the acid have a crucial effect on the sensory quality of the fruits and are also important factors influencing the market competitiveness of the fruits. The sugar in tomato fruit is mainly derived from carbohydrate generated by photosynthesis of leaves and young fruits, the accumulation type of the sugar is divided into hexose accumulation type and sucrose accumulation type, and the commonly cultivated tomato is hexose accumulation type and mainly accumulates glucose and fructose. The content of Soluble solids (TSS) is one of the important indicators for measuring the quality of fruits, and mainly includes Soluble sugar, organic acid, etc. The soluble solids in tomato fruits are mainly soluble sugars (about 65%, mainly sucrose and hexoses), organic acids (about 13%, mainly citric acid and malic acid) and some other trace substances (such as phenols, amino acids, vitamin C and minerals, etc.) (Balibrea et al, 2006; Kader, 2008). In the tomato domestication process, the content of soluble solids in fruits is reduced, the content of the soluble solids in the commonly cultivated tomatoes is about 4% -6%, and the content of wild species fruits is 2-3 times that of the common tomatoes (Beckles et al, 2011). Due to the high correlation of soluble solids with sugar content in tomato fruits, sugar content is often indicated as how much soluble solids content is (mallundo et al, 1995).

The soluble solid content of tomato fruit is quantitative, the genetic regulation is complex, and many QTL sites related to the soluble solid content are discovered at present (Bernacchi et al, 1998; Eshel and Zamir,1995), wherein the functions of key genes of individual sites are verified, such as the apoplastic sucrose invertase Lin5 gene (Baxter et al, 2005; Fridman and Zamir, 2003). Studies have also found that QTL loci associated with soluble solids content of tomato are genetically close to loci associated with the weight of the tomato fruit, and that fruit soluble solids content is inversely related to fruit weight (Tanksley, 2004; Tieman et al, 2017). Therefore, the molecular mechanism for revealing the accumulation of the soluble solids of the tomato fruits has important significance, and the molecular mechanism not only relates to the formation of the flavor quality of the tomato, but also is closely related to the yield of the tomato. In addition, the tomato is a model plant for researching the development and maturity of fleshy fruits, the regulation and control mechanism of the accumulation of the sugar content of the tomato is explored, and the method has important significance for high-quality breeding of the tomato and other fruits and vegetables.

The TPR (Tetratricopeptide repeat) gene is a gene family containing TPR conserved motif, and the family is widely existed in prokaryotic and eukaryotic genomes. TPR motifs generally mediate interactions between proteins and are involved in transcriptional regulation, protein transport, protein folding, assembly of protein complexes, and RNA splicing in cellular biological processes (Blatch and

1999; d' Andrea and Regan, 2003). The tomato Solyc01g095900 protein (designated herein as SlREC1a) contains 3 TPR motifs, the homologous protein in Arabidopsis AtREC1(Reduced Chloroplast Coverage 1) was shown to be involved in the regulation of Chloroplast compartment size in mesophyllic cells (Larkin et al, 2016). In addition, the RCP2(Reduced Carotenoid vaccination 2) protein of the floral plant Hericium erinaceus (Mimulus) is also a TPR protein of REC family, and can be involved in the regulation of the development of chromoplasts in floral organs and the biosynthesis of carotenoids (Stanley et al, 2020).

https:// solgenomics. net/organization/Solanum _ lysopersicum/genome discloses the sequence of Solyc01g095900, but its use is not known at present.

The references referred to are as follows:

Balibrea,M.E.,Martínez-Andújar,C.,Cuartero,J.,Bolarín,M.C.,and Pérez-Alfocea,F.(2006).The high fruit soluble sugar content in wild Lycopersicon species and their hybrids with cultivars depends on sucrose import during ripening rather than on sucrose metabolism.Funct.Plant Biol.33:279-288；

Baxter,C.J.,Carrari,F.,Bauke,A.,Overy,S.,Hill,S.A.,Quick,P.W.,Fernie,A.R.,and Sweetlove,L.J.(2005).Fruit carbohydrate metabolism in an introgression line of tomato with increased fruit soluble solids.Plant Cell Physiol.46:425-437；

Beckles,D.M.,Hong,N.,Stamova,L.,and Luengwilai,K.(2011).Biochemical factors contributing to tomato fruit sugar content:a review.Fruits 67:49-64；

Bernacchi,D.,Beck-Bunn,T.,Eshed,Y.,Lopez,J.,Petiard,V.,Uhlig,J.,Zamir,D.,and Tanksley,S.(1998).Advanced backcross QTL analysis in tomato.I.Identification of QTLs for traits of agronomic importance from Lycopersicon hirsutum.Theoretical and Applied Genetics 97:381-397；

Blatch,G.L.,and

M.(1999).The tetratricopeptide repeat:a structural motif mediating protein-protein interactions.Bioessays 21:932-939；

D'Andrea,L.D.,and Regan,L.(2003).TPR proteins:the versatile helix.Trends Biochem.Sci.28:655-662；

Eshed,Y.,and Zamir,D.(1995).An introgression line population of Lycopersicon pennellii in the cultivated tomato enables the identification and fine mapping of yield-associated QTL.Genetics141:1147-1162；

Fridman,E.,and Zamir,D.(2003).Functional divergence of a syntenic invertase gene family in tomato,potato,and Arabidopsis.Plant Physiol.131:603-609；

Kader,A.A.(2008).Flavor quality of fruits and vegetables.J.Sci.Food Agric.88:1863-1868.

Klee,H.J.,and Tieman,D.M.(2013).Genetic challenges of flavor improvement in tomato.Trends Genet.29:257-262；

Larkin,R.M.,Stefano,G.,Ruckle,M.E.,Stavoe,A.K.,Sinkler,C.A.,Brandizzi,F.,Malmstrom,C.M.,and Osteryoung,K.W.(2016).REDUCED CHLOROPLAST COVERAGE genes fromArabidopsis thaliana help to establish the size of the chloroplast compartment.Proc.Natl.Acad.Sci.U.S.A.113:E1116-1125；

Malundo,T.M.M.,Shewfelt,R.L.,and Scott,J.W.(1995).Flavor quality of fresh tomato(Lycopersicon esculentum Mill.)as affected by sugar and acid levels.Postharvest.Biol.Technol.6:103-110；

Stanley,L.E.,Ding,B.,Sun,W.,Mou,F.,Hill,C.,Chen,S.,and Yuan,Y.W.(2020).ATetratricopeptide Repeat Protein Regulates Carotenoid Biosynthesis and Chromoplast Development in Monkeyflowers(Mimulus).Plant Cell 32:1536-1555；

Tanksley,S.D.(2004).The genetic,developmental,and molecular bases of fruit size and shape variation in tomato.Plant Cell 16Suppl:S181-189；

Tieman,D.,Zhu,G.,Resende,M.F.,Jr.,Lin,T.,Nguyen,C.,Bies,D.,Rambla,J.L.,Beltran,K.S.,Taylor,M.,Zhang,B.,Ikeda,H.,Liu,Z.,Fisher,J.,Zemach,I.,Monforte,A.,Zamir,D.,Granell,A.,Kirst,M.,Huang,S.,and Klee,H.(2017).A chemical genetic roadmap to improved tomato flavor.Science 355:391-394。

disclosure of Invention

The invention aims to solve the technical problem of providing the application of a gene SlREC1a (Solyc01g095900) -regulating and controlling the content of soluble solids in tomato fruits.

In order to solve the technical problems, the invention provides a gene SlREC1a (Solyc01g095900) capable of regulating and controlling the content of soluble solids of tomatoes, which has the nucleotide sequence shown in SEQ ID NO: 1.

The invention also provides a protein coded by the gene, which has the amino acid sequence shown in SEQ ID NO: 2, or a pharmaceutically acceptable salt thereof.

The invention also provides the application of the gene for regulating and controlling the soluble solid content of the tomato fruit, and the gene has a nucleotide sequence shown as SEQ ID NO: 1, the Solyc01g095900 gene knockout in tomato can improve the content of soluble solids.

The invention simultaneously provides two targets of a CRISPR/Cas9 gene editing system for editing (knocking out) the genes, wherein the two targets are Target1 and Target2 respectively. The Target1 sequence is (PAM sequence underlined) GCGCAACGGCGCATGTTAGAAGGThe Target point Target2 sequence is (PAM sequence underlined) GACTCTTGCAAGAATGCGCGAGG。

The invention also provides a gene editing vector (plasmid) containing the editing target point and based on the CRISPR/Cas9 system.

The invention also provides a host cell of the vector, and the host cell is an escherichia coli cell and an agrobacterium cell.

The invention also provides the application of the gene Solyc01g 095900: the method is used for constructing the gene-editing tomato, the gene-editing tomato does not contain exogenous gene segments, and the content of soluble solids is higher than that of wild type (microTom).

The invention also provides two SlREC1a gene homozygous editing materials rec1a-1 and rec1a-2 (both are edited by Target 1), namely, two tomato SlREC1a gene homozygous editing plants are provided, wherein the editing plants do not contain exogenous gene segments and have higher soluble solid content;

the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-1 is shown in SEQ ID NO:3, the process is carried out; the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-2 is shown in SEQ ID NO:4, the method is described in the specification.

The invention also provides a mutant translation product caused by the gene mutation, and the amino acid sequence of the homozygous editing material rec1a-1 is shown as SEQ ID NO: 5, the amino acid sequence of the homozygous editing material rec1a-2 is shown as SEQ ID NO: and 6.

In conclusion, the present invention provides a gene and protein capable of regulating and controlling the soluble solid content of tomato, and provides a gene-edited tomato material with increased soluble solid content.

According to the invention, the SlREC1a gene of the tomato is edited, the soluble solid content of tomato fruits is regulated and controlled, and high-quality tomato varieties are cultivated, so that the method has a good application prospect.

Drawings

In order to make the objects, technical solutions and advantages of the present invention more apparent, embodiments of the present invention are described in detail below with reference to the accompanying drawings.

FIG. 1 is a SlREC1a gene editing vector structure based on CRISPR/Cas9 system;

FIG. 2 is a diagram of an editing target position, an editing (mutation) site sequence and a sequencing peak of SlREC1a gene;

FIG. 3 is an off-target identification analysis of two SlREC1a gene editing homozygous lines;

FIG. 4 is the upper diagram showing the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-1, and the lower diagram showing the nucleotide sequence of the 5 th exon of the homozygous editing material rec1 a-2; underlined is an inserted nucleotide sequence;

fig. 5 is a graph comparing the soluble solids content of mature fruits of two SlREC1a gene editing homozygous lines with wild type.

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

regulating and controlling soluble solid content of tomato fruit

1. Tomato SlREC1a (Solyc01g095900) gene knockout target design

The SlREC1a gene is knocked out by using a gene editing technology based on a CRISPR/Cas9 system, and a basic vector is pYLCRISPR/Cas9Pbui-H (Genbank: KR 029109). Specific vector construction protocol reference (Ma X, Liu Y. CRISPR/Cas9-Based Multiplex Genome Editing in Monocot and Dicot Plants. [ J ]. Current protocols in molecular biology,2016,115 (1)). The on-line tool CRISPR-P v 2.0.0 (http:// CRISPR. hzau. edu. cn/CRISPR2/) is used for target design and off-target prediction, and the on-line software RNA Folding program (http:// unaflow. RNA. albany. edu/.

The nucleotide sequence of SlREC1a gene is shown in SEQ ID NO: 1, the amino acid sequence of the protein coded by the gene is shown as SEQ ID NO: 2, respectively.

Based on that online software can only be used for auxiliary design, therefore, in order to improve targeting efficiency, the invention designs two targets (Target1 and Target2) for tomato SlREC1a gene, and the sgRNAs corresponding to the targets are respectively initiated and transcribed by AtU3d and AtU3b promoters, so that a SlREC1a gene editing vector based on CRISPR/Cas9 system is obtained, and the structure is shown in FIG. 1. Both targets are located on the 5 th exon of the gene, the specific positions are shown in fig. 2(a), and the target sequences are as follows: the Target1 sequence is (PAM sequence underlined) GCGCAACGGCGCATGTTAGAAGGThe Target point Target2 sequence is (PAM sequence underlined) GACTCTTGCAAGAATGCGCGAGG。

And synthesizing corresponding primers according to the target sequences:

the upstream and downstream primers of Target1 are respectively: GCGCAACGGCGCATGTTAGAgttttagagctagaaat and TCTAACATGCGCCGTTGCGCTgaccaatggtgctttg;

the upstream and downstream primers of Target2 are respectively: GACTCTTGCAAGAATGCGCGgttttagagctagaaat, and CGCGCATTCTTGCAAGAGTCTgaccaatgttgctcc.

2. Genetic transformation of SlREC1a Gene editing vector

The editing vector constructed in the step 1 is used for transforming Agrobacterium GV3101 and transforming tomato by using an Agrobacterium-Mediated mode, and the transformation method is referred to in the literature (Park S, Morris J L, Park J, et al. effective and genetic-induced Agrobacterium-Mediated transformation [ J ] Journal of Plant Physiology,2003,160(10):1253-1257), and simply, the Agrobacterium is used for infecting pre-cultured tomato cotyledons, tissue culture seedlings are obtained by inducing resistant cluster buds and rooting culture, and then positive transgenic plants are verified by PCR.

3. Screening of SlREC1a gene editing homozygous plants

Amplifying a gene fragment containing two editing targets of the T0 generation positive transgenic seedling by a PCR mode, and then sending the gene fragment to a company for sequencing to determine the editing condition of a transgenic line.

The extraction of the genome DNA is completed by adopting a plant genome DNA extraction kit (TSP101-50) of Beijing Optimalaceae Biotechnology Co. PCR amplification is completed by using a T3 Super PCR Mix kit (TSE030) of the company, and the system and the amplification program are described by referring to the kit, wherein the primers are as follows: AATTTCGGAACTACAAGACG, and CGCATTACACTGAAGAGGAG.

Selecting strains with editing (including homozygous, heterozygous, biallelic editing and the like), planting for T1 generation, firstly, utilizing PCR to amplify T-DNA sequence (including Cas9 gene segment and hygromycin resistance gene segment), determining whether the plants contain transgenic sequence (the transgenic sequence is T-DNA insertion segment, namely the sequence between LB and RB shown in figure 1), then preferentially selecting strains without the transgenic sequence, and utilizing PCR amplification and sequencing to verify the target point editing situation. The T2 generation plants were screened until transgenic lines were screened that did not contain the transgene sequence (T-DNA free) and were homozygous for editing. The invention screens 2 homozygous editing lines of T-DNA free together, and the specific editing information and sequencing evidence are shown in FIG. 2 (B-C). Homozygous editors of 2T-DNA free are rec1a-1 and rec1 a-2; the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-1 is shown in SEQ ID NO:3, the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-2 is shown as SEQ ID NO:4, respectively. The rec1a-1 and rec1a-2 are edited at the Target1 site.

Description of the drawings: the sequencing result of a homozygous edit should be that an edit has occurred (i.e., the nucleotide sequence is not identical to the wild type) and the peak pattern is a normal single peak; the sequencing peak diagrams of the heterozygous and biallelic editing are bimodal, and can be predicted according to an online tool DSDecodeM (http:// skl.scau.edu.cn/saddecode /), and if the prediction result is that one of two alleles has mutation and the other has no mutation, the heterozygous editing is carried out; if the result shows that both alleles are mutated, but the mutation mode is different, the mutation is biallelic.

4. SlREC1a gene editing homozygous plant off-target identification

Based on the potential off-Target sites of Target1 and Target2, the 7 sites with the highest score are selected for verification (as shown in Table 1), i.e., fragments containing the potential off-Target sites are cloned by PCR and then sequenced for verification. The results show that no off-target editing phenomenon occurs in both homozygous editing lines, and the related evidence is shown in FIG. 3.

Table 1, potential off-Target sites of SlREC1a gene editing targets Target1 and Target2

5. Phenotypic analysis of SlREC1a gene editing homozygous plants

Compared with wild type, the fruits of the SlREC1a gene homozygous editing lines rec1a-1 and rec1a-2 obtained by the invention have obvious change.

The rec1a-1, rec1a-2 and wild type (namely, microTom) are planted according to a conventional method, when the ripe fruit (10 days after color breaking), the soluble solid content of the ripe fruit is measured by a Refractometer (ATAGO PAL-1Digital 0-53% Brix Refractometer), and the content is specifically measured according to the instruction of the instrument, namely, pure water is adjusted to zero at normal temperature, and then juice of the tomato fruit is extruded for direct measurement.

The results show that the soluble solids content of the mature fruits (10 days after color breaking) of the homozygous editing lines rec1a-1 and rec1a-2 is significantly higher than that of the wild type (FIG. 5). In conclusion, the sugar content of tomato fruits can be obviously influenced by knocking out the SlREC1a gene by gene editing, so that the nutritional quality such as fruit taste (sugar-acid ratio) and the like can be improved, and the SlREC1a gene can be used as an important target point for molecular regulation of the sugar content of the fruits.

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang province academy of agricultural sciences

<120> application of gene for regulating and controlling soluble solid content of tomato fruit

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 14577

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gtaaattatt ctcaacaaca tgcctaattt ataccaatac tctgtttttg cttatactta 60

taaaaattac atatttcaat tggatttaag aacggagcaa aagtatcgca gaagcggagc 120

cacgatttta aaatttaatt attccatttc ctaaagttat tgagttctgt aaatattaaa 180

tttggtcgaa ttcataatct cttgcggtct cgcccctatt gtttactata attgtctcat 240

gtgaaatttt tgtctatagg tgtagtatat ataaaagaat ttgaaagttt gagtttaaca 300

aatggcaccc aacaagaatg gtcgtggcaa aacaaaggga gacaagaaga agaaagaaga 360

gaagggtatt attacttttt tttctttttt ctgttagtat tatacgatac atttttagca 420

tatgttaaaa attaaatgtc agtatatata taaaatttta tttgttatac taatgatgat 480

atgttttatt tgtgctgctc agttctccca gttgtaatgg atataacgat aaaccttccg 540

gaggagactc aagttatttt aaaggttcgt catttacgaa cacacttttt taaaattaat 600

attgcttata aatatatagt tataacacga agtatattta atcgtctttc tttgtttaaa 660

cttctttatt ttattcgagt acttttttgt tagattttgg ttgatgtttt gttgcttttt 720

tcaaggaaat cagattcagc tctgacagct tggctttcta attatattcc aaaagaagaa 780

aaatgaggcg ctagagctaa tttttcaaac agttggttaa ccattcaata tttcaccggt 840

tacttgcgca agcacaacaa ttttgatatc aattagttca caaaattgaa tggtcaataa 900

acgaagttag tacaagtcat agaaacaaag gtcatatgat tgataaataa agttaagaga 960

agttgtagaa ataaaagata tatatctgtc attaaaacgt acacgcaaca aaatagtgtt 1020

aaataattga taacaataaa atattttagt gaaggtaaca taacttaaat atataaaata 1080

tagtcaactt ttattttatt ataaaatttt actttttcta gaaaaaatta ttgctacacc 1140

attattatta atagtattat tattataact gctattttga ttttaaaata tccttgaatt 1200

taattaaatc atttaacggc tttgtttttc tacgagcagg gaatatctac ggatagaatt 1260

atcgatgttc gtcgattatt atctgtcaat acaacaactt gtaatgtcac taatttctca 1320

ctgtctcatg aggtaagggg acaaatcaga cggctgtcat attttcttta acttatttgt 1380

ttaatttagg accatctgat ttttactgtt tttaacagtt aaggggtcca cgtttaaaag 1440

aaacagtgga cgtttccgca ctgaagccct gcatcctgac tcttatcgaa ggtaaaaaaa 1500

tttcggaact acaagacgtc gtcgtatagg gtattaggat atttctattt taggaagtgg 1560

tcccgggccg gtcaggtcta gatattataa aagcccgatt ataccctcaa ctttcttctt 1620

tgaacagagg aatacgatga agaaagcgca acggcgcatg ttagaaggct gttggacatc 1680

gtcgcttgta caacgagttt tgggccgtcg gggactagtg gtaaagagtt gaaaactgac 1740

tcttgcaaga atgcgcgagg tgtgcaggat aacaagaatg ctaagaaatc caacaaggtt 1800

cgtgggaatg ataagtcatc gtcgccgcca caaacgccaa ctccggtggc gcaacagctg 1860

ggtaaagatg cgggatcgga agaagttgat ggagagatga gcaatacttg ccctaagatt 1920

ggaagcttct atgagttctt ctcgctttct catctcacgc ctcctcttca gtgtaatgcg 1980

ccctctctct ctcacattgt gtctctcttc tcgtgtttct tgttaaaatt aagactcatc 2040

ttgattcttg cagtcataag aagagcaaca agacaacaag atgatgaagt tttgccagat 2100

gatcatcttt tctctcttga agtaagcttt cttggagcca atttcatctt ctttagtcta 2160

atgagttcaa tgatctgata ttttctaggt ttgattaatt cataaaataa catatgtaat 2220

tgtttatagg tgaaactttg taatggaaag ctggttattg ttgaagcttg caagaaagga 2280

ttttacaact ttggaaagca ggggattctt tgtcacaatc ttgttgattt gttgagacaa 2340

ctcagtagag catttgacaa tgtacgcttg ggcagatttt ttttctctat caattcagtc 2400

atgctagttt catgtcttat ttcattgttg acattgctca tcccaatttt caggcatacg 2460

atgatctcat gaaagcattc ttggagcgta ataaggtgca gatgatgatt tctcttgaca 2520

tgtttcatca ccttaagttt tctaaaactg attacacgcg ggaagttctt tcttcgctgc 2580

ataaccttct ctaacccaag gttgtaaact gtttttcttc ttaatacagt ttgggaatct 2640

tccatacgga ttcagagcca acacatggct tataccacct gtggcagcac agttgccagc 2700

tatttttcca cctctacctg tggaggatga tacctgggga gcaaatggag gtggtctagg 2760

ccgagatgga aaatttgatt ctttaccttt tgccaatgaa tttttgaatg ttgcatccat 2820

ggcttgtaag acaacagagg agaggcagat cagagacagg aaggctttta ttcttcatag 2880

tttatttgtt gatgtcgcca ttttacgagc catttcagct gtaaagcatg tcatggagaa 2940

agttaaacca gctcattgtg atttgaatgg agaaatcatt tataatgaga cagttgggga 3000

cttgagcata tttgttacca aagattcttc aaatgctagc tgcaaagtag ataccaaaat 3060

tgatggattt caagcaactg gaatagctat gaagaatctg atggaaagaa atttactgaa 3120

ggggataact gctgatgaaa atactgctgc ccatgtaaga aaatactaag agaaattata 3180

tgggtcctaa ttttctgtgg tacttctaat gtagtgcatc tgattggaaa aaaacttact 3240

gcattttgaa ttcaggatat tgctacttta ggtgttctga atgtaagaca ttgtggttat 3300

attgcaactg taaaagttca aggaaaagaa aatgacaaag tgggcagccc actgcaaagc 3360

atggaacttg ctgatcagcc tgatggtggt gcaaatgccc tcaatatcaa caggtattac 3420

ttgaaaatcc tcattataag ccaataagtc ataatagtag tttattgatt ttttttctgc 3480

tgcggtttat gatgcaaaca ataagtaata gtagtaattt attgatctct ttctgttgtg 3540

gtttcactat gcaaacaata aaatactttg gttctttttg actgttaaaa gtgtaaagac 3600

aaagttatgt tgagctcttg accaaaaaag ttctttggtt tgataaattg agattctcat 3660

tctggttcaa cttttagaag tttgtcggag gaagaaatta tcctggaaaa gtgaagtctt 3720

ctctaagtag gagctgtttc caaaataaca gagcaataaa acaactgcat tctgatagct 3780

tttttctttg ctctgatgat ataacccttt caaatacttc ttggtctagg atccctccaa 3840

aacctcatgg accacaacaa tatttgtaag atcttctgaa ggtaaaaaca aaaagaggaa 3900

ttttagagaa aggttacgcg tcaattgggg taatgataaa atgtaatagc tttaacacaa 3960

ttctagacct tgcacaacaa tcatacatga tgtgtaaaaa tatggataat tgtgtgttac 4020

atctcccaat gtactactat taggttgctt aactgtcatg aatcagagct gggtctcacc 4080

ctgtttgggc cccaatcctg ttccagttgg aggtctgggc gtgtaggggt gtttgagtgg 4140

gttagagttc tactttagtt ccggaatgaa ctggtggttt ctttatatgg atttgcacaa 4200

ttctttcctc gtgttctagc ttttgtggtt gagctaggcc aagggccatt tcttacctaa 4260

tttattatct cctgttaata gtttgtcatt ttggtgtcat attcaccata tcactggtcc 4320

tgtatttcat tatcaatttg ctaggatggt gcattcgtct tctcaagact tagtgcctat 4380

ttttcttatt ttatcacgta atcttgcagt ttacgcttgc tccttcacaa gaaagtggac 4440

aacaaggtaa tgcattcaaa accttcagaa actgaagagc ctaattgctc tcaggcattt 4500

gtaaggagaa tactagaaga gagtcttacc aaacttgaag aagagaaaat agaaggtgac 4560

tctttcatca gatgggaact tggtgcatgc tggatacagc acttacaaga tcagaaaaaa 4620

tcagaaaagg acaagaaacc ctccgctgag aagaaaaaaa atgagatgaa ggttgaggga 4680

cttggaatac ctcttaagtc ccttaagaac agaaagaaga gcacagatgg aactaacatg 4740

gaatcccagt cagaaagctt caaatctgcc gcagatggtg ttggaggggg atcagaaaaa 4800

cctgtcctgc agtctgggga gtctcagttt gagacagata cagatcaaaa tcaggtcgtc 4860

ctcaaggcat tgttgtctga tgctggcttt acaaggttga aggagtcaga gactggactt 4920

caccttaagg tagaaatctt tttaaattta agtgatagat tatgagaaga ccttactatt 4980

tttccatctt ctaaccactt ccggctgttg atagtctttg gaagagctga ttgatctgtc 5040

acagaagtac tataatgaag ttgccctgcc aaagctggta acacttaaaa tagtattgtt 5100

tatatataaa tctacaaaga aaattgtttg tgacaagtgg catcttagct gtgtttcatt 5160

tcacaatgca ttgtaggtgg ctgattttgg ctctttagaa ctctcaccag tagatggtcg 5220

aaccttaact gatttcatgc atacccgagg tctacgtatg cgttctcttg gacaagtagt 5280

aagtcttaat gatcattttt tacccttagt gattttctcc ttctgtatgt gtgtgtgtga 5340

cacatatatt tgtccactta gacttcaatt tgtgtcttct tgttagtatg tttaatctcc 5400

aggtcataat atttttactt tagtatatta atttaaccga gattatcaaa tatagatgtt 5460

gaactttgtc agaactgtcg aaggtttgag aatgatctga aagttgaatt tctcattctt 5520

tatctctttc ctattgcctc tacattgatc tggttttaga tcatgattaa ctcttatgtg 5580

caactgtaaa attatactag gccaactttt atctcattaa gctgtgccta aattgattct 5640

tgcgttttct tcttcttctt gtgtaggtta aactttctga gaagttatca catgtgcaat 5700

ctctttgtat acacgagatg atagtccgag cttttaaaca tattcttcaa gcagctattg 5760

catcagttgt tgacattgaa gatatagctg cgataattgc tgctgccttg aatatgatgc 5820

ttggggtacc tgaaaatgat gattcaaatg agtacggtgt tgattctttg atctggagat 5880

ggctgaaatt atttttgaag aagagatacg aatgggatgt tggcagcctg aactacaaag 5940

atatgaggaa atttgctatc ctccgtggtt tatgccataa ggtacttgaa atcttgttct 6000

aaacaattga ctttttaagg atgacctcag tgtgggactg cactgggtat tttgttgttg 6060

ttgatacata atacatcaaa catttgtctt tgggtggttg catttgaata gatttggtag 6120

gtttcacacc tggctatttt tgaccgttct tctgagaatg tattgaacac ttggaattcg 6180

ctgtctttgg aaggggaaat aaaacacata agaaaatatg aaaagaaatt gaagaaaatt 6240

gtttgctaag acatagagac acttgttggt gtgtcaattc atcaaatatt taacttgggc 6300

aaagatataa cctttgtgca gatgtctttg aatactttgg tgatggaaat gaacgttatt 6360

gaagttttcg ttctataccc aagaacactt acgagtaatt tttctgtcta ggtgggaatt 6420

gaactggttc caagagatta tgatatgagt tcagcaagtc cttttcagaa agtagacatt 6480

gtcagcctag taccagtgca taaggtgata atgcaaccct gtctacgtgt ctgatactag 6540

gagatattat gccgagttca cttctgtttg tacttatcat ttttcttcta ctcccttcgt 6600

gtctttgtgt ctgcttttct gcagcaagct gcttgctctt ctgcagacgg aagacagctt 6660

ttggaatcat ccaaaacagc tctggataag ggaaaacttg aagatgcggt cagctatggg 6720

actaaggtaa ttgatttccg agattagaaa aaagttgtac attacattct ccattcttcc 6780

gattgaaact ttctattgta tagaaaccaa gttattttgg tgggcttcca actccatcgc 6840

ttcttatatt tcttcccttt gttggtcttg ggtacagatt gaaaatattg gaattagaat 6900

aataaaataa ggtaaccttg gttttgaatg gtataaatta ttgcatacca tgtgacaact 6960

gctgcatttt tgtggtgctt tcaggctctt gccaagctgg tcgcagtatg tggtccatac 7020

catcgaatga cagctggagc ttatagcctt cttgctgttg ttctgtatca caccggtgat 7080

tttaatcagg tatgcttcag aagctcgtca gcatagacct ccttggtcct acattgttac 7140

tctttctgcc tgctttaaaa actctgactt ctatcctatt caactcttaa atgtgttgat 7200

ggcggtatcc atgacaggcc acaatctatc agcaaaaggc cttggacata aatgaaagag 7260

agttgggcct tgatcaccca gacactatga aaagttatgg tgatcttgca gttttctatt 7320

accgacttca acacacagag ttggctctca agtatgttta tttctgttgg attgccaagt 7380

acttaaaatt tcttgatgat gccaacaact aaattagcaa aaaaaaaaaa agaaaaagaa 7440

aaaaaagaac aaattacaaa agtggagttg gaggttcatt attctaaact agacattttt 7500

atatttcttg agtttctggt tttcgtattt tcaatggtca tgtatgtttc tttagttgct 7560

cccccatcca ataggactat aaagtaggca ttgttttcct cggcctgtct caataaactt 7620

gtcatctttg ctaagatggc aagttactct ccttcaacaa ttcaagctag tgtaaagaaa 7680

atactactgt actttatatc agtcaaaact aacttaatca agcttgtgaa atacatatga 7740

ttggttgaaa tttggtcgtg gatatgttct tgaatgacgg ttcaaataat aaagttcgca 7800

tatggggttt gattatttac gcagcttttg ggcttactag caccaaacca acatggtcct 7860

tgtaaaaaat accaaatcaa catggtcctt gtaaaaaata ccaaatcaac atggtccttg 7920

taaaaaatac caaatcaaca tggtccttgt aaaaaatacc aaatcaacat ggtggaaact 7980

tatgtcctcc taattatgaa agattgtacc actcatatct gctcctcacg tttaacatta 8040

aatatgaatg atttaatatc tgtttttgat tcttctttcc acttctccct gttgttattc 8100

acatttcaca ctccatatca atttaccatt cccattttta caggtatgta aaacgagctc 8160

tttatttgtt gcatctcaca tgtggcccct cccatccaaa tactgcggcg acatatataa 8220

atgtggctat gatggaggaa gggctcggta atgtgcatgt tgctctcaga tatctccata 8280

aagctttgaa gtgtaaccaa aagttactcg gtccagacca tattcaggtt cctttcttct 8340

tctgctggag cttataagtg tttaattttt attttagcat tcacagctca ctctagtttt 8400

ctaggcttgt gaaactaaag tggatttatt caggaaaaaa atggccgctt atgtcctagt 8460

ttaggagatt cagggtagtt tcatgtcaaa cagtgtactt gagtatgcgt tattcttttt 8520

ccattaactg ctacatatgc attatgtgta tttgactata ggaaaagaag tagtaccatt 8580

caagttattt tttctgatgg caatggcctg gctgttgggc taaggtgttc acaaataaga 8640

acctgtgcag gaacagttac ctatgtcaaa aaaaaagaaa agaatcagtg caggtgtatg 8700

gtttcctttt cttttctttg tgaaacgata tctgtcatct gtcattgacc tcagatactc 8760

gagatgtgcc agaccatact aactattgag ttgcaggcct aaaagttcat tcaatgttcc 8820

atttactttt ttgtcttctc atgttttcat tttaatcgag caacttcagt gtcatcttaa 8880

acgaatgacc gtacttaagg gtccctttcg aatctggctt caatgtgagt actcatagtt 8940

ggcacattga ggtgccaaag tgcaaaaagg aaatataggt caatcatgaa gctgtccaat 9000

ctttccaatc tttatggcca ccagtccatg agagtcattt ttattgcaat aaaggacttg 9060

attgacaatc ttcagtatca atagccttag attgggttat ttggaactcc gtaatctcta 9120

tctcaactca gagcatggtg cgcttgtttt tgttctggta gtttaggtag taaaactatg 9180

cttgacttct ttagttcaag cttgcatagt gttgcatttt gaacttggtt gaatatgtgg 9240

aagattgaaa ccttccagtt gttaaacaaa ctccgtcact atatattctt ggaaacaagt 9300

atgtcttatt ttgttgctgc ataataaaac gcctttcatt tctgatgaac ctggttaatt 9360

atctctacag attcttgcct acacctctct cttatctagt taccttttgt gcctctgtaa 9420

tttccagaca gctgcaagtt atcatgctat agcaattgcc ctctctttga tggaagctta 9480

tcctttgagc gttcagcatg agcaaacaac cttgcagata cttcgagcaa agcttggtcc 9540

agatgatctt cgcacacagg ttaacttctg tcttacacac atgtacacaa taagtaggcc 9600

ctctcttttg cttcagagaa aagatgggcg aacaacttgc agttgctggc acttcaattt 9660

ttttttcctt gtgaagttat aatacctcat atcatagaaa ccagtgaact actagaagta 9720

caacttcaga tgtttctaac caattaggtt gtctttaaat ttcatgtcac ctctattttg 9780

gtcacgtcta ggtgatgaca ccgttgaaag ttgaaataca atatactttt tttttaaaaa 9840

aaaattatgg ttgttttgtt cttacttcag tcatctattt tcataatttt taaatttcta 9900

atctttgctg aaggatgctg ctgcatggct tgagtatttt gagtcgaagg cttttgaaca 9960

gcaagaagct gctcgaaatg gaactaagaa gcctgatgca tcaatagcca gcaagggtca 10020

tttgaggtat atttgcatgt attgcttaaa ttaatttttt ttggtagact taatgagtga 10080

aaagacaacc ttaatttctg ttatagctct tattagactg ctaggtaatg taataactga 10140

aggacttgaa tcgtcataat ctgtgagagc atatgtttga tatttctttt gcccactgtc 10200

tcgtcctttt gcttttaaac tacaagatag ttcactatgc cttcatgtct agtctctttg 10260

atttatgctc aaaagtagtg ctgacaaaaa tgaacccaaa catggataat ccgcctagaa 10320

tttcaagtgt tgggctcaag ataatttgaa ttgagtttaa tctcaatccg ttcatgctta 10380

atccatttga ggagaatttt caattgaacc taattcaatc tccaatttca acccgtttta 10440

aaacttttta ttaagatatg ttcctatact aaaggtatga attattttca atttaatgtc 10500

ttttaggatt tatctatcca tttgttactt ttttcaacaa aaattcttga gcggaaattc 10560

aaatcgtgat tataaaagtt aaatatcaat atgttaaatt attgagatta atcaggttaa 10620

attgggcagg tcaagaccca acccgttttt agctcatttg aacccaaccc atttgagccc 10680

aaattaaact tgggcggatc aagacccaac ccgttttttt atttcaaccc attttaatat 10740

tttcaatttc aacccatccc aacccaacca tttgacaccg ctagttttag aatatgaatt 10800

tatcaagaaa ggacaatgtt caatggctgt caatgtaaaa attttgggtt cctgacttag 10860

taattgcata aattttttgc acataggatt tcaaaaaaat gtacaagcag ataaccatac 10920

tctagataac agtaagtaaa atatttcagt ttaaatcttg tggtgacata ctttattgcg 10980

cagtgtgtca gatttgctcg actacattaa tccaagtcca gatgccaaag ggagagatgt 11040

tggatcaaaa agaagaggtt ttgtctcaaa ggtacgtggt gattggagta caatatcttt 11100

gtttcttgct tatgattttc caatacgtat cagcatgatt aggttcatgg aaattagctt 11160

ggatgaagat tttcatctta tgcaaacttg ttataaaata agcagaaata atcatgttct 11220

ttctggaagg tctaccttgt gtaatacctg tctggaagaa gagagaatga gtgagaacta 11280

gtttaacaga aaactggtaa tgttcagaag ctttgacatg tttcaggctc tctaaaggtc 11340

tgtttgcctt atgtttttcc tattctcctc cctcagtagg cattgacaca cattgcatat 11400

gcctgattaa ctgcctatca tgcttccaca cggaatgtgc atataatgct ccatatattg 11460

taaaagtgga catgctcccg ttttcttatc cttttccttt ttgccatatc ttttctcagg 11520

ctcttatttc tcaggtgaag ggaaaatctg atcaaaacaa tgttgccata ccaaactctg 11580

acacttttaa agatgttcca aaagaagaga cagatgaaaa gaaacaaatt gtcgaagatc 11640

acactgatcc caagatgaat atggaacctg ttgacactgt aattgaatcc catcacaatg 11700

gagatggagg aattactgag aacaaaccca tccaatctgg accattgtta aaggaaactt 11760

caattgagaa gtctatggtc cgtgaagtct tatctgaacc ttctgctgaa gcagaagatg 11820

gatggcagcc agtgcagaga ccaaggtcag gtggtttcta tggacgaaga cgaaggcaga 11880

ggcgtcaaac catcagcaag gttattggtt accagaaaaa ggacccaatt tctgatgttg 11940

atcatgctaa attgaagaat aactatcaag ctagtaaata ttatgtctta aagaaacgga 12000

catcaccagg aagctatgca gattattact tagcaaaaag tcaggcttct ggtaccaaac 12060

ttggtcgaag agtcataaaa gctgtagcct accgtgtgaa gtctgtgtca tcttctgtca 12120

gagatgctgt tcctgagatc tccacaactg gaggagattt gttaaatact tcatcagagc 12180

aggtccaagt ttctgcaaca aaggaggttg gatcactatc aaagagaagt tcaatagtaa 12240

acctaggaaa atctccttcc tataaggaag tagcacttgc cccgccaggt accatttcta 12300

tgttgcagga gagagtttct gaagatgaaa ttcctgataa cccagacgtt atgaaacttg 12360

aaaaggagag caatggagca gaagaaaatt ccaaaataat gggaagagat gcagaatcca 12420

tggagaaaga gaacattcag gatctagttg caaattcttc tgatcatgta aaaagtgaaa 12480

cagtagatac tgacagtaaa gaagaaattc aaatgagtga tctcaaaggt ggtgaaattt 12540

cagatctgat atctgcaaat gcatctattc aacccggcca tgttgatgtt agtccaatgg 12600

aacagggtag tgtcaagact cataatgtcc ctacttctga caattctccc aaagcggatc 12660

cctgtgaaaa ggactcatca agcaatttaa atcctggcgt tatctcaaat atgaccttgc 12720

aagatatgga tcatctgaag gtaaaatctg cgtcatctca tgcaagtgat gccagtcgag 12780

aattgtccag aaagctatct gcatcagcag caccattcag cccttcccca gctgttcccc 12840

gcggtacccc attacctatg aacattaatc tcccttctcc tcctggaaca cgaccaccga 12900

ttggtccttg gtcagtgacc atgtctcttc atcaaggacc accgaccatc ttgcctagtc 12960

caatgtgctc ctcccctcat cacctgtacc cttcacctcc acacacccca aacatgatgc 13020

acccattgcg ctttatctac cctccgtatt ctcaacccca gacgttacct ccaaatacat 13080

tccccatgag tagcagcact ttccatccga atcattatgc ttggcaatgc aatatagctc 13140

ctaatgcatc agagtatgtt cctgccacag tttggcctgg ctgccaccca gtcgagtttt 13200

ctatctcacc acctgtgatt gagcctataa ctgactcaat ttcctctgct aaggagatat 13260

ctgataatcc tgaaaatatt actttgacaa caagcttact agttgatctc aacaccgggg 13320

atgaagtcaa ggaagatgta aatcttccag catcagaaac agtggagaac atagctgcag 13380

ttgtaccaga aaaagagaga gcaagcaaca ctccagattc acattttgtt acctcgtcta 13440

gtgatcaatc aaaagagggc agtggatcaa atcatgtgca aagaaatctt acggagacgg 13500

ataatgagaa gaccttcaac attttggtac ggggccggag gaatcgcaaa caaactctaa 13560

gaatgcctat aagtttgctc aagagaccat attcttctca gcccttcaaa gctgtatata 13620

gcagggtaat aagggagact gaggttccca gctctaccag ctttgatcca catgaacatg 13680

gcataacgac tgctacttga ggctgtttct atgtctttta cgagataata ctagcagaat 13740

ggtctattga agctgagtat acatatctgt tggtcgtata tcatgactgc tggactttat 13800

tgctgttcca attctcatga ctatgatgtt agttggcttt cagactatgc ctcagtttaa 13860

cttgaaggtt agttctcttc aagagatact ctcctcacca aggacatttt ctgctgccaa 13920

tagggtgaaa agatcatcct ttgcttagtc gttcatttac cttctgggaa agtagagata 13980

catctagctt cttcttgacc aaactaccgt tgagataaaa ctaatggaat aatttacctt 14040

ttgagataca gtgaaaattc taaaagattc agtgggtgtc atatcagtta gcgaagcaag 14100

ttgtagcctc atgtagcaaa caattgcaat cccatatgct tctatagaat gacttctaga 14160

aacgattgaa actgcatact gttatgatgc tatgttttca actctttgat cacatctgat 14220

attgatttag tccatgtagc tacaatgcat gatttctgat tatgtattgt tttttattga 14280

catgcaggtt tacttctcaa catacttttt gatgctaagg agttgtcttt tctgtgtaag 14340

ctttacagtt tggctataac attgtctttt taggagcata ctgcaatata gaattaaatt 14400

gtcgtcttgt ttctcagttg ctagtgatta ttggtttcac tgacttgtat acataaccaa 14460

attattcttc aactgctcca acaaagtata tctgcatctg atttaggact tgcagagttg 14520

tatgcaatgc attcttctat aagttcaatc taaaatgatc tggaaagaat tctgaga 14577

<210> 2

<211> 1897

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 2

Met Ala Pro Asn Lys Asn Gly Arg Gly Lys Thr Lys Gly Asp Lys Lys

1 5 10 15

Lys Lys Glu Glu Lys Val Leu Pro Val Val Met Asp Ile Thr Ile Asn

20 25 30

Leu Pro Glu Glu Thr Gln Val Ile Leu Lys Gly Ile Ser Thr Asp Arg

35 40 45

Ile Ile Asp Val Arg Arg Leu Leu Ser Val Asn Thr Thr Thr Cys Asn

50 55 60

Val Thr Asn Phe Ser Leu Ser His Glu Leu Arg Gly Pro Arg Leu Lys

65 70 75 80

Glu Thr Val Asp Val Ser Ala Leu Lys Pro Cys Ile Leu Thr Leu Ile

85 90 95

Glu Glu Glu Tyr Asp Glu Glu Ser Ala Thr Ala His Val Arg Arg Leu

100 105 110

Leu Asp Ile Val Ala Cys Thr Thr Ser Phe Gly Pro Ser Gly Thr Ser

115 120 125

Gly Lys Glu Leu Lys Thr Asp Ser Cys Lys Asn Ala Arg Gly Val Gln

130 135 140

Asp Asn Lys Asn Ala Lys Lys Ser Asn Lys Val Arg Gly Asn Asp Lys

145 150 155 160

Ser Ser Ser Pro Pro Gln Thr Pro Thr Pro Val Ala Gln Gln Leu Gly

165 170 175

Lys Asp Ala Gly Ser Glu Glu Val Asp Gly Glu Met Ser Asn Thr Cys

180 185 190

Pro Lys Ile Gly Ser Phe Tyr Glu Phe Phe Ser Leu Ser His Leu Thr

195 200 205

Pro Pro Leu Gln Phe Ile Arg Arg Ala Thr Arg Gln Gln Asp Asp Glu

210 215 220

Val Leu Pro Asp Asp His Leu Phe Ser Leu Glu Val Lys Leu Cys Asn

225 230 235 240

Gly Lys Leu Val Ile Val Glu Ala Cys Lys Lys Gly Phe Tyr Asn Phe

245 250 255

Gly Lys Gln Gly Ile Leu Cys His Asn Leu Val Asp Leu Leu Arg Gln

260 265 270

Leu Ser Arg Ala Phe Asp Asn Ala Tyr Asp Asp Leu Met Lys Ala Phe

275 280 285

Leu Glu Arg Asn Lys Phe Gly Asn Leu Pro Tyr Gly Phe Arg Ala Asn

290 295 300

Thr Trp Leu Ile Pro Pro Val Ala Ala Gln Leu Pro Ala Ile Phe Pro

305 310 315 320

Pro Leu Pro Val Glu Asp Asp Thr Trp Gly Ala Asn Gly Gly Gly Leu

325 330 335

Gly Arg Asp Gly Lys Phe Asp Ser Leu Pro Phe Ala Asn Glu Phe Leu

340 345 350

Asn Val Ala Ser Met Ala Cys Lys Thr Thr Glu Glu Arg Gln Ile Arg

355 360 365

Asp Arg Lys Ala Phe Ile Leu His Ser Leu Phe Val Asp Val Ala Ile

370 375 380

Leu Arg Ala Ile Ser Ala Val Lys His Val Met Glu Lys Val Lys Pro

385 390 395 400

Ala His Cys Asp Leu Asn Gly Glu Ile Ile Tyr Asn Glu Thr Val Gly

405 410 415

Asp Leu Ser Ile Phe Val Thr Lys Asp Ser Ser Asn Ala Ser Cys Lys

420 425 430

Val Asp Thr Lys Ile Asp Gly Phe Gln Ala Thr Gly Ile Ala Met Lys

435 440 445

Asn Leu Met Glu Arg Asn Leu Leu Lys Gly Ile Thr Ala Asp Glu Asn

450 455 460

Thr Ala Ala His Asp Ile Ala Thr Leu Gly Val Leu Asn Val Arg His

465 470 475 480

Cys Gly Tyr Ile Ala Thr Val Lys Val Gln Gly Lys Glu Asn Asp Lys

485 490 495

Val Gly Ser Pro Leu Gln Ser Met Glu Leu Ala Asp Gln Pro Asp Gly

500 505 510

Gly Ala Asn Ala Leu Asn Ile Asn Ser Leu Arg Leu Leu Leu His Lys

515 520 525

Lys Val Asp Asn Lys Val Met His Ser Lys Pro Ser Glu Thr Glu Glu

530 535 540

Pro Asn Cys Ser Gln Ala Phe Val Arg Arg Ile Leu Glu Glu Ser Leu

545 550 555 560

Thr Lys Leu Glu Glu Glu Lys Ile Glu Gly Asp Ser Phe Ile Arg Trp

565 570 575

Glu Leu Gly Ala Cys Trp Ile Gln His Leu Gln Asp Gln Lys Lys Ser

580 585 590

Glu Lys Asp Lys Lys Pro Ser Ala Glu Lys Lys Lys Asn Glu Met Lys

595 600 605

Val Glu Gly Leu Gly Ile Pro Leu Lys Ser Leu Lys Asn Arg Lys Lys

610 615 620

Ser Thr Asp Gly Thr Asn Met Glu Ser Gln Ser Glu Ser Phe Lys Ser

625 630 635 640

Ala Ala Asp Gly Val Gly Gly Gly Ser Glu Lys Pro Val Leu Gln Ser

645 650 655

Gly Glu Ser Gln Phe Glu Thr Asp Thr Asp Gln Asn Gln Val Val Leu

660 665 670

Lys Ala Leu Leu Ser Asp Ala Gly Phe Thr Arg Leu Lys Glu Ser Glu

675 680 685

Thr Gly Leu His Leu Lys Ser Leu Glu Glu Leu Ile Asp Leu Ser Gln

690 695 700

Lys Tyr Tyr Asn Glu Val Ala Leu Pro Lys Leu Val Ala Asp Phe Gly

705 710 715 720

Ser Leu Glu Leu Ser Pro Val Asp Gly Arg Thr Leu Thr Asp Phe Met

725 730 735

His Thr Arg Gly Leu Arg Met Arg Ser Leu Gly Gln Val Val Lys Leu

740 745 750

Ser Glu Lys Leu Ser His Val Gln Ser Leu Cys Ile His Glu Met Ile

755 760 765

Val Arg Ala Phe Lys His Ile Leu Gln Ala Ala Ile Ala Ser Val Val

770 775 780

Asp Ile Glu Asp Ile Ala Ala Ile Ile Ala Ala Ala Leu Asn Met Met

785 790 795 800

Leu Gly Val Pro Glu Asn Asp Asp Ser Asn Glu Tyr Gly Val Asp Ser

805 810 815

Leu Ile Trp Arg Trp Leu Lys Leu Phe Leu Lys Lys Arg Tyr Glu Trp

820 825 830

Asp Val Gly Ser Leu Asn Tyr Lys Asp Met Arg Lys Phe Ala Ile Leu

835 840 845

Arg Gly Leu Cys His Lys Val Gly Ile Glu Leu Val Pro Arg Asp Tyr

850 855 860

Asp Met Ser Ser Ala Ser Pro Phe Gln Lys Val Asp Ile Val Ser Leu

865 870 875 880

Val Pro Val His Lys Gln Ala Ala Cys Ser Ser Ala Asp Gly Arg Gln

885 890 895

Leu Leu Glu Ser Ser Lys Thr Ala Leu Asp Lys Gly Lys Leu Glu Asp

900 905 910

Ala Val Ser Tyr Gly Thr Lys Ala Leu Ala Lys Leu Val Ala Val Cys

915 920 925

Gly Pro Tyr His Arg Met Thr Ala Gly Ala Tyr Ser Leu Leu Ala Val

930 935 940

Val Leu Tyr His Thr Gly Asp Phe Asn Gln Ala Thr Ile Tyr Gln Gln

945 950 955 960

Lys Ala Leu Asp Ile Asn Glu Arg Glu Leu Gly Leu Asp His Pro Asp

965 970 975

Thr Met Lys Ser Tyr Gly Asp Leu Ala Val Phe Tyr Tyr Arg Leu Gln

980 985 990

His Thr Glu Leu Ala Leu Lys Tyr Val Lys Arg Ala Leu Tyr Leu Leu

995 1000 1005

His Leu Thr Cys Gly Pro Ser His Pro Asn Thr Ala Ala Thr Tyr Ile

1010 1015 1020

Asn Val Ala Met Met Glu Glu Gly Leu Gly Asn Val His Val Ala Leu

1025 1030 1035 1040

Arg Tyr Leu His Lys Ala Leu Lys Cys Asn Gln Lys Leu Leu Gly Pro

1045 1050 1055

Asp His Ile Gln Thr Ala Ala Ser Tyr His Ala Ile Ala Ile Ala Leu

1060 1065 1070

Ser Leu Met Glu Ala Tyr Pro Leu Ser Val Gln His Glu Gln Thr Thr

1075 1080 1085

Leu Gln Ile Leu Arg Ala Lys Leu Gly Pro Asp Asp Leu Arg Thr Gln

1090 1095 1100

Asp Ala Ala Ala Trp Leu Glu Tyr Phe Glu Ser Lys Ala Phe Glu Gln

1105 1110 1115 1120

Gln Glu Ala Ala Arg Asn Gly Thr Lys Lys Pro Asp Ala Ser Ile Ala

1125 1130 1135

Ser Lys Gly His Leu Ser Val Ser Asp Leu Leu Asp Tyr Ile Asn Pro

1140 1145 1150

Ser Pro Asp Ala Lys Gly Arg Asp Val Gly Ser Lys Arg Arg Gly Phe

1155 1160 1165

Val Ser Lys Ala Leu Ile Ser Gln Val Lys Gly Lys Ser Asp Gln Asn

1170 1175 1180

Asn Val Ala Ile Pro Asn Ser Asp Thr Phe Lys Asp Val Pro Lys Glu

1185 1190 1195 1200

Glu Thr Asp Glu Lys Lys Gln Ile Val Glu Asp His Thr Asp Pro Lys

1205 1210 1215

Met Asn Met Glu Pro Val Asp Thr Val Ile Glu Ser His His Asn Gly

1220 1225 1230

Asp Gly Gly Ile Thr Glu Asn Lys Pro Ile Gln Ser Gly Pro Leu Leu

1235 1240 1245

Lys Glu Thr Ser Ile Glu Lys Ser Met Val Arg Glu Val Leu Ser Glu

1250 1255 1260

Pro Ser Ala Glu Ala Glu Asp Gly Trp Gln Pro Val Gln Arg Pro Arg

1265 1270 1275 1280

Ser Gly Gly Phe Tyr Gly Arg Arg Arg Arg Gln Arg Arg Gln Thr Ile

1285 1290 1295

Ser Lys Val Ile Gly Tyr Gln Lys Lys Asp Pro Ile Ser Asp Val Asp

1300 1305 1310

His Ala Lys Leu Lys Asn Asn Tyr Gln Ala Ser Lys Tyr Tyr Val Leu

1315 1320 1325

Lys Lys Arg Thr Ser Pro Gly Ser Tyr Ala Asp Tyr Tyr Leu Ala Lys

1330 1335 1340

Ser Gln Ala Ser Gly Thr Lys Leu Gly Arg Arg Val Ile Lys Ala Val

1345 1350 1355 1360

Ala Tyr Arg Val Lys Ser Val Ser Ser Ser Val Arg Asp Ala Val Pro

1365 1370 1375

Glu Ile Ser Thr Thr Gly Gly Asp Leu Leu Asn Thr Ser Ser Glu Gln

1380 1385 1390

Val Gln Val Ser Ala Thr Lys Glu Val Gly Ser Leu Ser Lys Arg Ser

1395 1400 1405

Ser Ile Val Asn Leu Gly Lys Ser Pro Ser Tyr Lys Glu Val Ala Leu

1410 1415 1420

Ala Pro Pro Gly Thr Ile Ser Met Leu Gln Glu Arg Val Ser Glu Asp

1425 1430 1435 1440

Glu Ile Pro Asp Asn Pro Asp Val Met Lys Leu Glu Lys Glu Ser Asn

1445 1450 1455

Gly Ala Glu Glu Asn Ser Lys Ile Met Gly Arg Asp Ala Glu Ser Met

1460 1465 1470

Glu Lys Glu Asn Ile Gln Asp Leu Val Ala Asn Ser Ser Asp His Val

1475 1480 1485

Lys Ser Glu Thr Val Asp Thr Asp Ser Lys Glu Glu Ile Gln Met Ser

1490 1495 1500

Asp Leu Lys Gly Gly Glu Ile Ser Asp Leu Ile Ser Ala Asn Ala Ser

1505 1510 1515 1520

Ile Gln Pro Gly His Val Asp Val Ser Pro Met Glu Gln Gly Ser Val

1525 1530 1535

Lys Thr His Asn Val Pro Thr Ser Asp Asn Ser Pro Lys Ala Asp Pro

1540 1545 1550

Cys Glu Lys Asp Ser Ser Ser Asn Leu Asn Pro Gly Val Ile Ser Asn

1555 1560 1565

Met Thr Leu Gln Asp Met Asp His Leu Lys Val Lys Ser Ala Ser Ser

1570 1575 1580

His Ala Ser Asp Ala Ser Arg Glu Leu Ser Arg Lys Leu Ser Ala Ser

1585 1590 1595 1600

Ala Ala Pro Phe Ser Pro Ser Pro Ala Val Pro Arg Gly Thr Pro Leu

1605 1610 1615

Pro Met Asn Ile Asn Leu Pro Ser Pro Pro Gly Thr Arg Pro Pro Ile

1620 1625 1630

Gly Pro Trp Ser Val Thr Met Ser Leu His Gln Gly Pro Pro Thr Ile

1635 1640 1645

Leu Pro Ser Pro Met Cys Ser Ser Pro His His Leu Tyr Pro Ser Pro

1650 1655 1660

Pro His Thr Pro Asn Met Met His Pro Leu Arg Phe Ile Tyr Pro Pro

1665 1670 1675 1680

Tyr Ser Gln Pro Gln Thr Leu Pro Pro Asn Thr Phe Pro Met Ser Ser

1685 1690 1695

Ser Thr Phe His Pro Asn His Tyr Ala Trp Gln Cys Asn Ile Ala Pro

1700 1705 1710

Asn Ala Ser Glu Tyr Val Pro Ala Thr Val Trp Pro Gly Cys His Pro

1715 1720 1725

Val Glu Phe Ser Ile Ser Pro Pro Val Ile Glu Pro Ile Thr Asp Ser

1730 1735 1740

Ile Ser Ser Ala Lys Glu Ile Ser Asp Asn Pro Glu Asn Ile Thr Leu

1745 1750 1755 1760

Thr Thr Ser Leu Leu Val Asp Leu Asn Thr Gly Asp Glu Val Lys Glu

1765 1770 1775

Asp Val Asn Leu Pro Ala Ser Glu Thr Val Glu Asn Ile Ala Ala Val

1780 1785 1790

Val Pro Glu Lys Glu Arg Ala Ser Asn Thr Pro Asp Ser His Phe Val

1795 1800 1805

Thr Ser Ser Ser Asp Gln Ser Lys Glu Gly Ser Gly Ser Asn His Val

1810 1815 1820

Gln Arg Asn Leu Thr Glu Thr Asp Asn Glu Lys Thr Phe Asn Ile Leu

1825 1830 1835 1840

Val Arg Gly Arg Arg Asn Arg Lys Gln Thr Leu Arg Met Pro Ile Ser

1845 1850 1855

Leu Leu Lys Arg Pro Tyr Ser Ser Gln Pro Phe Lys Ala Val Tyr Ser

1860 1865 1870

Arg Val Ile Arg Glu Thr Glu Val Pro Ser Ser Thr Ser Phe Asp Pro

1875 1880 1885

His Glu His Gly Ile Thr Thr Ala Thr

1890 1895

<210> 3

<211> 346

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aggaatacga tgaagaaagc gcaacggcgc atgtttagaa ggctgttgga catcgtcgct 60

tgtacaacga gttttgggcc gtcggggact agtggtaaag agttgaaaac tgactcttgc 120

aagaatgcgc gaggtgtgca ggataacaag aatgctaaga aatccaacaa ggttcgtggg 180

aatgataagt catcgtcgcc gccacaaacg ccaactccgg tggcgcaaca gctgggtaaa 240

gatgcgggat cggaagaagt tgatggagag atgagcaata cttgccctaa gattggaagc 300

ttctatgagt tcttctcgct ttctcatctc acgcctcctc ttcagt 346

<210> 4

<211> 346

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

aggaatacga tgaagaaagc gcaacggcgc atgttaagaa ggctgttgga catcgtcgct 60

tgtacaacga gttttgggcc gtcggggact agtggtaaag agttgaaaac tgactcttgc 120

aagaatgcgc gaggtgtgca ggataacaag aatgctaaga aatccaacaa ggttcgtggg 180

aatgataagt catcgtcgcc gccacaaacg ccaactccgg tggcgcaaca gctgggtaaa 240

gatgcgggat cggaagaagt tgatggagag atgagcaata cttgccctaa gattggaagc 300

ttctatgagt tcttctcgct ttctcatctc acgcctcctc ttcagt 346

<210> 5

<211> 109

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 5

Met Ala Pro Asn Lys Asn Gly Arg Gly Lys Thr Lys Gly Asp Lys Lys

1 5 10 15

Lys Lys Glu Glu Lys Val Leu Pro Val Val Met Asp Ile Thr Ile Asn

20 25 30

Leu Pro Glu Glu Thr Gln Val Ile Leu Lys Gly Ile Ser Thr Asp Arg

35 40 45

Ile Ile Asp Val Arg Arg Leu Leu Ser Val Asn Thr Thr Thr Cys Asn

50 55 60

Val Thr Asn Phe Ser Leu Ser His Glu Leu Arg Gly Pro Arg Leu Lys

65 70 75 80

Glu Thr Val Asp Val Ser Ala Leu Lys Pro Cys Ile Leu Thr Leu Ile

85 90 95

Glu Glu Glu Tyr Asp Glu Glu Ser Ala Thr Ala His Val

100 105

<210> 6

<211> 127

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 6

Met Ala Pro Asn Lys Asn Gly Arg Gly Lys Thr Lys Gly Asp Lys Lys

1 5 10 15

Lys Lys Glu Glu Lys Val Leu Pro Val Val Met Asp Ile Thr Ile Asn

20 25 30

Leu Pro Glu Glu Thr Gln Val Ile Leu Lys Gly Ile Ser Thr Asp Arg

35 40 45

Ile Ile Asp Val Arg Arg Leu Leu Ser Val Asn Thr Thr Thr Cys Asn

50 55 60

Val Thr Asn Phe Ser Leu Ser His Glu Leu Arg Gly Pro Arg Leu Lys

65 70 75 80

Glu Thr Val Asp Val Ser Ala Leu Lys Pro Cys Ile Leu Thr Leu Ile

85 90 95

Glu Glu Glu Tyr Asp Glu Glu Ser Ala Thr Ala His Val Lys Lys Ala

100 105 110

Val Gly His Arg Arg Leu Tyr Asn Glu Phe Trp Ala Val Gly Asp

115 120 125

Claims (6)

1. The application of the gene for regulating and controlling the soluble solid content of the tomato fruit is characterized in that: the gene has a nucleotide sequence shown as SEQ ID NO: 1, the Solyc01g095900 gene knockout in tomato can improve the content of soluble solids.

2. Two targets for editing the Solyc01g095900 gene, characterized by: the two target points are respectively: target1 and Target 2;

target 1: GCGCAACGGCGCATGTTAGAAGG，

Target 2: GACTCTTGCAAGAATGCGCGAGG。

3. Two targets for editing (knock-out) the Solyc01g095900 gene according to claim 2, characterized by: target1 is edited, and the edited nucleotide sequence is shown as SEQ ID NO. 3 or SEQ ID NO. 4.

4. A gene editing vector (plasmid) based on CRISPR/Cas9 system comprising the target of claim 2 or 3.

5. Two Solyc01g095900 gene homozygous editing materials are characterized in that: respectively homozygous editing material rec1a-1 and homozygous editing material rec1a-2,

the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-1 is shown in SEQ ID NO:3, the process is carried out;

the nucleotide sequence of the 5 th exon of the homozygous editing material rec1a-2 is shown in SEQ ID NO:4, the method is described in the specification.

6. The use of the gene Solyc01g095900 according to claim 1, which is characterized in that: the method is used for constructing the gene-editing tomato, the gene-editing tomato does not contain exogenous gene fragments, and the content of soluble solids is higher than that of wild type.

Images