JPH06277068A - Rice sucrose phosphate synthetase gene - Google Patents

Abstract

PURPOSE:To provide a DNA of a rice sucrose phosphate synthetase gene. CONSTITUTION:A gene coding a sucrose phosphate synthetase is specified from a rice genom DNA library. The sucrose synthesis activity can be promoted by introducing the sucrose phosphate synthetase gene. Furthermore, the amount of sucrose transported to a storage tissue can be increased to improve the supply of sugar as a material for starch synthesis by promoting the sucrose synthesis activity.

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a gene for rice sucrose phosphate synthase.

[0002]

2. Description of the Related Art Cultivating plants and increasing their yield are important problems in agricultural production. Plants receive the sunlight and absorb carbon dioxide in the atmosphere to perform photosynthesis and fix as carbonic acid assimilation products. Initially, the fixed carbonic acid assimilation products are carried to the tissues of plants that cannot perform carbonic acid assimilation products by performing photosynthesis by themselves. Storage tissues such as seeds, tubers and tubers are places for accumulating these photosynthetic products, which humans use.

The increase in yield can be expected to some extent by the addition of fertilizer and cultivation control, but it does not greatly exceed the capacity of the cultivated plant. Then, it was examined to increase the yield of plants by using the gene recombination technology which has become available for plants in recent years. The inventors of the present application focused on sucrose synthesis performed in the cytoplasm of mesophyll cells when plants perform photosynthesis. Carbon dioxide fixed in leaf chloroplasts is excreted into the cytoplasm in the form of triosephosphate, where it is synthesized by sucrose. The sucrose synthesized here passes through the veins of the veins and is transported to tissues and storage tissues where it cannot synthesize sucrose via the phloem. The sucrose carried to the storage organs is converted into starch and stored. Therefore, it was considered possible to increase the yield by increasing the sucrose delivered to the storage tissue by increasing the sucrose synthesis ability. Therefore, it was considered possible if the activity of sucrose phosphate synthase, which is the central enzyme of sucrose synthesis, could be enhanced.

[0004]

An object of the present invention is to provide a gene encoding rice sucrose phosphate synthase.

[0005]

[Means for Solving the Problems] Plants fix carbonic acid assimilation products by performing a photosynthetic reaction with sunlight and carbon dioxide. In the chloroplasts of mesophyll cells, carbon dioxide passes through the Calvin-Benson cycle and becomes triose-3.
It becomes phosphoric acid, which is excreted from the chloroplast into the cytoplasm and eventually converted to sugar. Sucrose phosphate is synthesized from the converted UDP-glucose and fructose-6-phosphate,
After the dephosphorylation reaction, sucrose is synthesized. The enzyme that synthesizes sucrose phosphate is sucrose phosphate synthase, which is a key enzyme in this sucrose synthesis system, and its activity is known to affect the entire sucrose synthesis. .
The synthesized sucrose passes through the veins of mesophyll cells and is transported to the roots and growing tissues where it cannot synthesize sucrose via the phloem. Sucrose is decomposed in each tissue and converted into another sugar. The storage tissue is further subjected to starch synthesis. The tissue on the side of sucrose synthesis / sender is called the source organ, and the tissue on the side of consumption / reception is called the sink organ, and physiological studies have been conducted as an important factor for increasing the yield of plants. It was

The gene for sucrose phosphate synthase, which is the central enzyme for sucrose synthesis, is currently corn cDN.
Only A has been cloned (AC Worre
ll et al., Plant Cell, 3, 1121 (199
1)), the genomic gene has not yet been cloned. There is no information about the rice sucrose phosphate synthase gene, but it can be inferred to some extent that it is similar to the maize sucrose phosphate synthase cDNA.
Based on the nucleotide sequence of maize cDNA, we succeeded in cloning the rice sucrose phosphate synthase gene from the rice genomic library.

That is, the present invention provides SEQ ID NO: 2 in the sequence listing.
The rice sucrose phosphate synthase gene encoding the amino acid sequence shown in is provided.

The amino acid sequence shown in SEQ ID NO: 2 is the mature protein coding region of the rice sucrose phosphate synthase gene shown in SEQ ID NO: 1 obtained in the following Examples, that is, in the base sequence shown in SEQ ID NO: 1. 894 to 963, 1012 to 1253, 1891 to 2129, 2227 to 2290, 2423 to 3115, 3266 to 3385, and 3474.
No. 3605, 3918 to 4094, 420
3 to 4256, 4345 to 4407, 44
It is equivalent to the amino acid sequences encoded by the nucleotide sequences from 97 to 5432, 5544 to 5671 and 5766 to 6054. Of course, as long as the DNA defines the amino acid sequence of SEQ ID NO: 2, the base sequence is not limited to that described in SEQ ID NO: 1. Also,
The gene may be one in which the coding region of the above amino acid sequence is continuous, or one in which the coding region is interrupted. The amino acid sequence of the rice sucrose phosphate synthase gene shown in SEQ ID NO: 2 was first determined in the present invention. The base sequence and amino acid sequence shown in SEQ ID NO: 1 are also shown in FIGS. 2 to 6. In these figures, the underlined base sequence is the amino acid coding region, and the amino acid sequence described below is joined to form the amino acid sequence represented by SEQ ID NO: 2.

[0009] Generally, in the amino acid sequence constituting the enzyme, the enzymatic activity does not substantially decrease even if a small number of amino acids are substituted or deleted with other amino acids, or a small number of amino acids are inserted. It is widely known that there is. This is especially true in regions other than the active center. Therefore, even if the amino acid sequence shown in SEQ ID NO: 2 has a small number of amino acids substituted or deleted, or has a small number of other amino acids inserted, the rice sucrose phosphate synthase activity is substantially reduced. What I have is
It is intended to be included within the scope of the present invention.

The gene having the nucleotide sequence represented by SEQ ID NO: 1 was obtained by the method described in the following example. Since the nucleotide sequence of the gene was determined by the present invention, rice genomic DNA was used as a template. Well-known PCR
It can be easily prepared by the method.

The sucrose phosphate synthase gene obtained according to the present invention encodes the entire region of the rice protein of interest, as shown in the following examples. Therefore, it is possible to construct an artificial sucrose phosphate synthase expression system by connecting a cauliflower mosaic virus-derived promoter or a photosynthesis-related gene promoter to this sucrose phosphate synthase gene. It was It is possible to introduce the constructed artificial gene into plants such as rice and tobacco by electroporation or a method using Agrobacterium, and as a result, sucrose phosphate synthesis in the obtained transformed plants. Enzymes can be increased.

Therefore, it is expected that the increase in sucrose phosphate enzyme enhances the sucrose synthesis ability, suppresses the starch synthesis in the chloroplast, and promotes the sucrose synthesis. It is considered that sucrose synthesis is promoted, so that sucrose transported to the sink organ is increased, resulting in an increase in starch stored, and thus an increase in yield is possible.

[0013]

INDUSTRIAL APPLICABILITY According to the present invention, a gene encoding rice sucrose phosphate synthase was cloned for the first time and its nucleotide sequence was determined. It is considered that by incorporating the gene of the present invention into a known plant cell vector and transforming a plant, the activity of the enzyme in the plant is increased and the yield of crops is increased.

[0014]

EXAMPLES The present invention will be described in detail below based on examples. Unless otherwise specified, the operation procedure is Molecular
r Cloning (J. Sambrook et al., Col.
dSpring Harbor Laborator
y, 1989).

Example 1 (1) Construction of rice genomic library Sapling of rice Nipponbare 1 week after germination in the dark 30
g from CTAB method (Plant Molecular)
Biology (1985) 5:69) by D
NA was extracted. Restriction enzyme Sau3A with 10 μg of DNA
It was partially decomposed by I (manufactured by Toyobo Co., Ltd.). This is BamH of the vector EMBL3 (Stratagene)
In vitro packaging kit (Stratagene, GIGAPACK G
used to package E. coli P.
A large number of recombinant λ phages were obtained by infecting strain 2392. This was designated as rice genomic library.

(2) Cloning of Sucrose Phosphate Synthase Gene Four kinds of primers were synthesized from the nucleotide sequence of the cDNA of corn sucrose phosphate synthase gene. The base sequence of the primer is 5'-TTCCTGGGAGATTC
CATGGACG-3 ', 5'-AGCCCCGCAT
GATCTCGTCGGC-3 ', 5'-TGGTC
TGACGACAATAAGGA-3 'and 5'-
CAATCCCCACTGCTCATCAAT-3 '. With the primer combination of and, PCR (Poly) using the total DNA extracted from rice green leaves as a template
The nucleotide sequence specific to the sucrose phosphate synthase gene was amplified by the merase chain reaction method and cloned into the vector pUC119. The primers (1) to (2) are a part of the nucleotide sequence of the cDNA of maize sucrose phosphate synthase, and their positions are outlined in FIG.

The DNA fragment amplified at the time of the combination of the primers with SPD28 is the DNA fragment amplified at the time of the combination of the primers with SPD28.
It was set to 4. The nucleotide sequences of SPD28 and SPK24 were determined by the dideoxy method (Messing, Methods i).
n Enzymol. , 101, 20-78 (198
3)) and compared with the cDNA base sequence of corn sucrose phosphate synthase, the homology thereof is high, and thus it was confirmed that the base sequence belongs to sucrose phosphate synthase. , As a probe for screening rice sucrose phosphate synthase gene.

Approximately 30,000 independent plaques in the rice genomic library of (1) were screened using the aforementioned probes SPD28 and SPK24. As a result, one positive clone was obtained. This phage DNA was prepared and the insert was examined. The phage DNA was cleaved with a restriction enzyme SalI (manufactured by Toyobo Co., Ltd.), and Southern hybridization was carried out using SPD28 and SPK24 as probes. The nucleotide sequence of the obtained clone was determined by the dideoxy method, and this was the maize sucrose phosphate synthase cD.
Since it covers the entire NA base sequence,
Since it was determined that the rice sucrose phosphate synthase gene was almost completely contained, this clone was designated as λSPS6192.

(3) Genomic clone λSPS619
2. Analysis of base sequence of 2 The base sequence contained in λSPS6192 was determined.
The nucleotide sequence was determined by the dideoxy method (Messi
ng, Methods in Enzymol. , 1
01, 20-78 (1983)). The nucleotide sequence thus obtained is shown in the sequence listing.

When this sequence was compared with the cDNA base sequence of maize sucrose phosphate synthase, very high homology was observed between them except for the intron portion, so the isolated fragment was isolated from rice. Was confirmed to be the sequence of the sucrose phosphate synthase gene. Further detailed comparison of nucleotide sequences revealed that high homology was found in the structural gene part between rice and maize.

[Sequence list]

 SEQ ID NO: 1 Sequence length: 6901 Sequence shape: Nucleic acid Number of strands: Double strand Topology: Linear Sequence type: DNA Origin: Organ name: Oryza sativa Tissue type: Dark germination Direct origin Library name: Genomic library Library Clone name: λSPS6192 Sequence features Characteristic signature: mature protein coding region Location: 894..963 Method of determining feature: E Characteristic signature: mature protein coding region Location: 1012..1253 Characteristic determination method: E Characteristic symbol: mature protein coding region Location: 1891..2129 Characteristic determining method: E Characteristic symbol: mature protein coding region Location: 2227..2290 Method by which the characteristic was determined: E Characteristic symbol: mature protein coding region Location: 2423..3115 Method by which the characteristic was determined: E Characteristic symbol: matu re protein coding region Location: 3266..3385 Characteristic determination method: E Characteristic symbol: mature protein coding region Location: 3474..3605 Characteristic determining method: E Characteristic symbol: mature protein coding region Location: 3918..4094 Method by which the characteristic was determined: E Characteristic symbol: mature protein coding region Location: 4203..4256 Method by which the characteristic was determined: E Characteristic symbol: mature protein coding region Location: 4345 ..4407 Characteristic determination method: E Characteristic symbol: mature protein coding region Location: 4497..5432 Characteristic determining method: E Characteristic symbol: mature protein coding region Location: 5544..5671 Characteristic Method to determine: E Characteristic symbol: mature protein coding region Location: 5766..6054 Method to determine characteristic: E Characteristic symbol: exon Location: 894..963 Method to determine characteristic: E Feature Symbol indicating: intron Location: 964..1011 Characteristic determination method: E Characteristic symbol: exon Location: 1012..1253 Characteristic determination method: E Characteristic symbol: intron Presence location: 1254..1890 Characteristic determination method: E Characteristic Symbol: exon Location: 1891..2129 Feature determining method: E Feature symbol: intron Location: 2130..2226 Feature determining method: E Feature symbol: exon Location: 2227..2290 Characteristic determination method: E Characteristic symbol: intron Location: 2291..2422 Characteristic determination method: E Characteristic symbol: exon Location: 2423..3115 Characteristic determination method: E Characteristic Symbol: intron Location: 3116..3265 Feature determining method: E Feature symbol: exon Location: 3266..3385 Feature determining method: E Feature symbol: intron Location: 3386..3473 Characteristic determination method: E Characteristic symbol: exon Location: 3474..3605 Characteristic determination method: E Feature symbol: intron Location: 3606..3917 Feature determining method: E Feature symbol: exon Location: 3918..4094 Feature determining method: E Feature symbol: intron Location: 4095 ..4202 Characteristic determination method: E Characteristic symbol: exon Location: 4203..4256 Characteristic determination method: E Characteristic symbol: intron Location: 4257..4344 Characteristic determination method: E Characteristic symbol: exon Location: 4345..4407 Feature determining method: E Characteristic symbol: intron Present location: 4408..4496 Characteristic determining method: E Feature symbol: exon Present location: 4497 ..5432 Characteristic determination method: E Characteristic symbol: intron Location: 5433..5543 Characteristic determination method: E Characteristic symbol: exon Location: 5544..5671 Characteristic determination method: E Characteristic symbol: intron Location: 5672..5765 Characteristic determination method: E Characteristic symbol: exon Location: 5766..6054 Characteristic position: E Characteristic symbol: poly A site Existence position: 6224..6228 Characteristic position: E Characteristic symbol: poly A site Existence position: 6345 .. 6349 were determined feature positions: E SEQ AGTAGACAAC GTAAAGAAAA TTATTTAAGT GGTAGATGTA CTACTCGATA TGTTTGTCCA 60 ATTTATAAAG TGATCATAGT AGTAATATGT GCATGTGTGC ATATATACGT GTGTTTTTTT 120 TAAAGATAAT GGACACGTGT GTTTTTGAAC GTTCATAATA GTGTTTTGGG AAAATAATTA 180 GATAATAAAG CGAAGTTTGT TGAGAAAACG AGTGAATTAA CCAATGCCTT AATTTGGTAC 240 TGCAAGTACT ACATTGGGAT AACAAATTAG AGATCGACGA AAAGCGGAAT ATCCTTTTTA 300 TTTGCGCCCT GACGGATATC TTTCAGTTTG TAACCACCGG ATGACGCACG GACGGCTCGG 360 ATCATCCCGA AAAGATCAAC CGCGGGGCGA GGACGAGACC ACCGTGGGCC CCATGGCCCA 420 CCGACTTACA CAATCTCTCC CACTGCCATG CGGGCCCANA CCCGCAACAG TCCAGNCCAG 480 AGAGCCCCGA ACTCCNCCAA ACCCGGGGGG GCCACACCCT GCCACGTGTC ACCCGCCGCG 540 CCTCCCTCTC ATCCTCTCTC TCCTCGTCCA GTGCTTCTCC TTCTCCTCCT CGCAACCGAA 600 CGCCTAGAAG CGCGCGTCCA CCAAGCCACG GACTCCTCTA ATTCTC TCTC TTGCTTTCTC 660 TCTCCTCGCT TCCCGGGTTT GATACGTGGT ACGTGACGCT TTGCCCTTTT CCTCTCTCTC 720 TCTCTCTCTC TCTTGATCAG TTTGATTTGA TCGGTTCCGC CATTAGCAAA CCTCGCCGAT 780 TCTCTCTCTC GATCGAACAG GGGTAGGGAA GCGATTAACC GGCGATCGAT CGATCGATGC 840 AAGTGATCGC GCTCGGTTGA TCCAGGAATT GGAGAGCATC GGCTGATCGA GAG ATG GCG 899 Met Ala 1 GGG AAC GAG TGG ATC AAT GGC TAC CTG GAG GCG ATA CTG GAC AGC GGC 947 Gly Asn Glu Trp Ile Asn Gly Tyr Leu Glu Ala Ile Leu Asp Ser Gly 5 10 15 GGC GCG GCG GGG GGA G GTGGAGGCGG CGGAGGAGGT GGTGGTGGAG GTGGAGGTGG 1003 Gly Ala Ala Gly Gly Gly 20 CGGTGGAG GGG GGA GGA AGT TCA CCG ACG ACG 1052 Gly Gly Gly Gly Gly Gly Val Asp Pro Ser Ser Pro Thr Thr 25 30 35 GGG ACG ACG AGC CCG CGT GGC CCG CAC ATG AAC TTC AAT CCG ACG CAC 1100 Gly Thr Thr Ser Pro Arg Gly Pro His Met Asn Phe Asn Pro Thr His 40 45 50 TAC TTC GTG GAG GAG GTG GTG AAG GGC GTC GAC GAG AGC GAC CTC CAC 1148 Tyr Phe Val Glu Glu Val Val Lys Gly Val Asp Glu Ser Asp Leu His 55 60 65 CGG ACG TGG ATC AAG GTC GTC GCC ACC CGC AAC GCC CGC GAG CGG AGC 1196 Arg Thr Trp Ile Lys Val Val Ala Thr Arg Asn Ala Arg Glu Arg Ser 70 75 80 85 ACC CGC CTC GAG AAC ATG TGC TGG CGC ATC TGG CAC CTC GCG AGA AAG 1244 Thr Arg Leu Glu Asn Met Cys Trp Arg Ile Trp His Leu Ala Arg Lys 90 95 100 AAG AAG CAG GCATGCATCG ATCTCTCCCT GTCTTTTTCT TTCTTTCTCG TGTTCATGGT 1303 Lys Lys Gln TGATTTAATT TAGTTTCTCG TGCTCTCTGC ATGACTGAAT TAATTATCTN CGAGATACTT 1363 CTGAACTTTC TATTCGACAG AAAATTCAGA TTTTGATTTT AAAAGAAAAT CTTGTCGGAA 1423 CTATGTTATA CGGAGTGCTT TAACTATTCA TCAACACGAT ACCATATAAT ATCCTTTACA 1483 AGGATTCAGA TAATTTTTAG TGGTAACGAT AGATCGGCTA AATTGTCGTG TAGGGCTAGA 1543 TCAGGCCGTT GGCATGATTC TTTTCTGCTT TCAAGAAAAG ATCAGAGTGT TCAATTAATT 1603 TCAGATATGA TTATAGTCCC TTGTAGATCA TGTAGTTTGT ATTATGCACC ACACACGTTT 1663 GTGGAAAGAA GAAAGTATGG CAACCCAACG GTGTCAGTAA TGGACGATGA GTGTGCTATC 1723 TTTTTTCCTT TTCCAAGAGT AGGAAACAGG ATCTTTTAAA CCACTCAATT GGCCATGCCA 1783 AAAGTGAGTT TATTGTGTTC TTTTCGATGA GAAAAAAAAT TATGACTGTN CATGATGCTC 1843 CTAAAAGGTA TTTNTTTCTG AGATTGCCTA AATTTTTATG TGAGCAG CTG GAG CTT 1899 Leu Glu Leu 105 GAG GGA ATC CTG AGG ATT TCT GCA CGG AGG AAG GAG CAG GAG CAG GTG 1947 Glu Gly Ile Leu Arg Ile Ser Ala Arg Arg Lys Glu Gln Glu Gln ValGC 115 C 120 G ACT TCG GAG GAC CTT GCA GAG GAT CTG TTT GAA GGC GAG 1995 Arg Arg Glu Thr Ser Glu Asp Leu Ala Glu Asp Leu Phe Glu Gly Glu 125 130 135 AAG GCG GAC ACC GTC GGT GAA TTG GCA CAG CAA GAC ACT CCC ATG AAG 2043 Lys Ala Asp Thr Val Gly Glu Leu Ala Gln Gln Asp Thr Pro Met Lys 140 145 150 155 AAG AAG TTC CAG AGG AAC TTC TCA GAG CTC ACC GTC AGC TGG TCC GAC 2091 Lys Lys Phe Gln Arg Asn Phe Ser Glu Leu Thr Val Ser Trp Ser Asp 160 165 170 GAG AAC AAG GAG AAA AAG CTG TAC ATT GTG CTC ATC AG GTCTTATACC 2139 Glu Asn Lys Glu Lys Lys Leu Tyr Ile Val Leu Ile Ser 175 180 GCTTACTTTA CTCAATTGGT GCCATTCTGT ATATGCCACT AAATTGCAAA GTTCTTCTGA 2TT CTA GTT CGT GGC GAT AAC Ser Leu His Gly Leu Val Arg Gly Asp Asn 185 190 ATG GAA CTT GGT CGG GAT TCA GAT ACT G GA GGA CAG GTAAAACATG 2300 Met Glu Leu Gly Arg Asp Ser Asp Thr Gly Gly Gln 195 200 205 ATTGATCTTT TCTTTTCTTT TGAGCAGATA TTTCTTATCA TCTCCAGCCC TAGTTCAAAA 2360 AAAAAAAATT CTTATCTTAGT CATCGTTCAGTAGT CATCATT CATTAGT CATCATT CATTATT CATTAGTTAGT GGC2470 Val Lys Tyr Val Val Glu Leu Ala Arg Ala Leu Ala Met Met Pro Gly 210 215 220 GTG TAC AGA GTG GAT CTG TTT ACT CGT CAA GTG TCA TCT CCT GAA GTG 2518 Val Tyr Arg Val Asp Leu Phe Thr Arg Gln Val Ser Ser Pro Glu Val 225 230 235 GAC TGG AGC TAT GGG GAG CCT ACT GAA ATG TTA ACC TCC GGT TCC ACT 2566 Asp Trp Ser Tyr Gly Glu Pro Thr Glu Met Leu Thr Ser Gly Ser Thr 240 245 250 GAC GGA GAG GGA AGC GGT GAG AGT GCT GGT GCG TAC ATT GTG CGC ATT 2614 Asp Gly Glu Gly Ser Gly Glu Ser Ala Gly Ala Tyr Ile Val Arg Ile 255 260 265 CCG TGC GGT CCA AGG GAC AAG TAC CTC CGT AAA GAG GCC CTG TGG CCT 2662 Pro Cys Gly Pro Arg Asp Lys Tyr Leu Arg Lys Glu Ala Leu Trp Pro 270 275 280 285 TAC CTC CAA GAG TTT GTC GAC GGA GCT CTC GCG CAT ATC CTG AAC ATG 2710 Tyr Leu Gln Glu Phe Val Asp Gly Ala Leu Ala His Ile Leu Asn Met 290 295 295 300 TCC AAG GCT CTG GGG GAA CAG GTT AGC AAT GGG AAG CTG GTC TTG CCA 2758 Ser Lys Ala Leu Gly Glu Gln Val Ser Asn Gly Lys Leu Val Leu Pro 305 310 315 TAT GTA ATC CAT GGC CAC TAT GCC GAT GCT GGA GAT GTC GCT GCT CTT 2806 Tyr Val Ile His Gly His Tyr Ala Asp Ala Gly Asp Val Ala Ala Leu 320 325 330 CTT TCT GGT GCG CTG AAT GTG CCG ATG GTT CTC ACC GGT CAT TCA CTT 2854 Leu Ser Gly Ala Leu Asn Val Pro Met Val Leu Thr Gly His Ser Leu 335 340 345 GGG AGG AAC AAG CTG GAG CAG ATC ATG AAG CAA GGG CGC ATG TCG AAG 2902 Gly Arg Asn Lys Leu Glu Gln Ile Met Lys Gln Gly Arg Met Ser Lys 350 355 360 365 GAG GAG ATG GAC TCA ACT TAC AAG ATC ATG AGG CGC ATT GAG GGT GAG 2950 Glu Glu Met Asp Ser Thr Tyr Lys Ile Met Arg Arg Arg Ile Glu Gly Glu 370 375 380 GAG CTG GCC TTG GAT GCA GCG GAG CTT GTC ATA ACG AGT ACA AGG CAG 2998 Glu Leu Ala Leu Asp Ala Ala Glu Leu Val Ile Thr Ser Thr Arg Gln 385 390 395 GAG ATT GAT GAG CAA T GG GGA CTG TAT GAT GGC TTT GAT GTC AAG CTA 3046 Glu Ile Asp Glu Gln Trp Gly Leu Tyr Asp Gly Phe Asp Val Lys Leu 400 405 410 GAG AAA GTT TTG AGG GCT CGT GCG AGG CGC GGA GTT AGC TGC CAC GGC 3094 Glu Lys Val Leu Arg Ala Arg Ala Arg Arg Gly Val Ser Cys His Gly 415 420 425 CGT TTT ATG CCT AGA ATG GTG GTAAGTGTTC AATAATAAGC GTAATAGTACCT 145 TGTATCATTT 435 TGTATCATTA ATTAGA 3265 GTA ATT CCT CCT GGG ATG GAT TTC AGC AGT GTT GTG GTT CCT GAA GAT 3313 Val Ile Pro Pro Gly Met Asp Phe Ser Ser Val Val Val Pro Glu Asp 440 445 450 ACC AGC GAT GGA GAT GAT GGC AAA GAC TTT GAG ATT GCC TCG CCG AGG 3361 Thr Ser Asp Gly Asp Asp Gly Lys Asp Phe Glu Ile Ala Ser Pro Arg 455 460 465 TCA CTG CCC CCA ATC TGG GCT GAG GTTGGGTTTC TGGATTTCCT CTTCAAAATG 3415 Ser Leu Pro Pro Ile Trp Ala Glu 470 ATT GATTAAAAGTGT 475 TATAATTAAGTG TATTATAG 3473 GTG AGC CGG TTT TG G ACC AAT CCC CAC AAG CCA ATG ATC CTG GCT CTG 3521 Val Ser Arg Phe Trp Thr Asn Pro His Lys Pro Met Ile Leu Ala Leu 480 485 490 TCA AGA CCT GAT CCA AAG AAG AAC ATC ACC ACC CTT GTC AAA GCA TTT 3569 Ser Arg Pro Asp Pro Lys Lys Asn Ile Thr Thr Leu Val Lys Ala Phe 495 500 505 GGA GAA TGT CGC CCA CTG AGG GAA CTT GCA AAC CTA GTAAGCAACA 3615 Gly Glu Cys Arg Pro Leu Arg Glu Leu Ala Asn Leu 510 515 520 GTTACTTGACT TATT TATTCGCAAG GAAGAATAAC TGCATTTTCA 3675 GCACTTTACC AGTACAATAC TAGTAAATAG TAATATTAGA TTATAGTTGC ACCCCAAAAG 3735 CTAATCCATC TGTCATGAAC ACAAAGTACA AAAAATATTT CAAGTAGTAT GTACAATTGC 3795 ATACTACTTG CAAATATTTC AAGTCACAAA AGTAGTATAT ACAATGCTTC TGAACATTCT 3855 TGTNCAATTG CATAATTCAG GTATTACTAG TACCTAGCAA TAAAATTTGC CTTTTGTTGC 3915 AG ATT CTG TCC ATG GGG ACC AGG GAT GAC ATC GAT GGG ATG TCC GCT GGC3965 Ile Leu Ser Met Gly Thr Arg Asp Asp Ile Asp Gly Met Ser Ala Gly 525 530 535 AAT GCA AGC GTC CTC ACC ACT GTC CTG AAG CTG ATC GAC AAG TAT GAT 4013 Asn Ala Ser Val Leu Thr Thr Val L L eu Lys Leu Ile Asp Lys Tyr Asp 540 545 550 CTG TAC GGA AGT GTT GCA TTC CCC AAG TAT CAC AAG CAG TCA GAC GTA 4061 Leu Tyr Gly Ser Val Ala Phe Pro Lys Tyr His Lys Gln Ser Asp Val 555 560 565 CCG GAG ATT TAT CGC CTC ACA GGG AAG ATG AAG GTCTNTCACC AGTCATGTCC 4114 Pro Glu Ile Tyr Arg Leu Thr Gly Lys Met Lys 570 575 TCACTCTGTT TCAGCTTAGC CATGTGCCCA CTCTGTTTCA TCTTCT GTT GCTCA ATCCATCTCA GTCAGT Leu Val 580 585 GAG CCT TTC GGT CTC ACC CTG ATC GAG GTCTTCTCAT AGTTCAATTC 4276 Glu Pro Phe Gly Leu Thr Leu Ile Glu 590 595 TCTGACAACC ACCTGATTAT TATTCTTTCA TGTACAG CTC CTCCTCCTCCTCCTCCTC GTC GTC GCT GCT GACT Ala Ala Ala His Gly Leu Pro Ile Val Gly Thr Lys Asn Gly 600 605 610 GGT CCG GTT GAC ATT AAA AAT GTAAGCATCC ATCCTCGNCA AATCTTGTGT 4437 Gly Pro Val Asp Ile Lys Asn 615 ACAACCGCAT GTCGCGG AGCATT GATGCAG CTG CTG GTA GAC CCG CAT GAC CAG CAC GCC ATT 4544 Ala Leu Asn Asn Gly Leu Leu Val Asp Pro His Asp Gln His Ala Ile 620 625 630 GCC GAC GCG CTG CTG AAG CTG GTG GCG GAC AAG AAC CTG TGG CAG GAG 4592 Ala Asp Ala Leu Leu Lys Leu Val Ala Asp Lys Asn Leu Trp Gln Glu 635 640 645 650 TGC CGG AAG AAC GGC CTG CGC AAC ATC CAG CTC TAC TCG TGG CCG GAG 4640 Cys Arg Lys Asn Gly Leu Arg Asn Ile Gln Leu Tyr Ser Trp Glu 655 660 665 CAT TGC CGG ACA TAC CTC ACC AGG ATA GCC GGA TGC CGG ATC AGG AAC 4688 His Cys Arg Thr Tyr Leu Thr Arg Ile Ala Gly Cys Arg Ile Arg Asn 670 675 680 CCG CGC TGG CTG ATG GAC ACG CCG GCG GAC GCG GCG GCC GCC GAG GAG GAG 4736 Pro Arg Trp Leu Met Asp Thr Pro Ala Asp Ala Ala Ala Glu Glu Glu 685 690 695 GAA GCC CTG GAG GAC TCG CTC ATG GAC GTC CAG GAC CTC TCG CTG CGC 4784 Glu Ala Leu Glu Asp Ser Leu Met Asp Val Gln Asp Leu Ser Leu Arg 700 705 710 CTG TCC ATC GAC GGC GAG CGG GGG TCA TCC ATG AAC GAC GCG CCA TCG 4832 Leu Ser Ile Asp Gly Glu Arg Gly Ser Ser Met Asn Asp Ala Pro Ser 715 720 725 730 TCG GAC CCG CAG GAC TCG GTG CAG AGG ATC ATG AAC AAG ATC AAG CGG 4880 Ser Asp Pro Gln Asp Ser Val Gln Arg Ile Met Asn Lys Ile Lys Arg 735 740 745 TCG TCT CCC GCG GAN ACG GAC GGC GCC AAG ATT CCG GCC GAA GCG GCC 4928 Ser Ser Pro Ala Asp Thr Asp Gly Ala Lys Ile Pro Ala Glu Ala Ala 750 755 760 GCC ACC GCC ACC TCC GGT GCC ATG AAC AAG TAC CCG CTC CTC CGC CGA 4976 Ala Thr Ala Thr Ser Gly Ala Met Asn Lys Tyr Pro Leu Leu Arg Arg 765 770 775 CGC CGC AGG CTG TTC GTC ATA GCC GTG GAC TGC TAC GGC GAC GAT GGC 5024 Arg Arg Arg Leu Phe Val Ile Ala Val Asp Cys Tyr Gly Asp Asp Gly 780 785 790 AGC GCC AGC AAG AGG ATG CTG CAG GTG ATC CAG GAG GTG TTC AGG GCT 5072 Ser Ala Ser Lys Arg Met Leu Gln Val Ile Gln Glu Val Phe Arg Ala 795 800 805 810 GTC CGG TCG GAC TCC CAG ATG TCC AGG ATC TCC GGG TTC GCG CTG TCG 5120 Val Arg Ser Asp Ser Gln Met Ser Arg Ile Ser Gly Phe Ala Leu Ser 815 820 825 ACG GCG ATG CCG CTG CCG GAG ACG CTC AAG CTT CTG CAG CTG GGC AAG 5168 Thr Ala Met Pro Leu Pro Glu Thr Leu Lys Leu Leu Gln L eu Gly Lys 830 835 840 ATC CCA CCG ACC GAC TTC GAC GCG CTC ATC TGC GGC AGC GGC AGC GAG 5216 Ile Pro Pro Thr Asp Phe Asp Ala Leu Ile Cys Gly Ser Gly Ser Glu 845 850 855 GTG TAC TAC CCC AGC ACG GCG CAG TGT GTG GAC GCC GGG GGG AGG CTG 5264 Val Tyr Tyr Pro Ser Thr Ala Gln Cys Val Asp Ala Gly Gly Arg Leu 860 865 870 CGC CCC GAC CAG GAC TAC CTG CTG CAC ATC AAC CAC CGG TGG TCT CAC 5312 Arg Pro Asp Gln Asp Tyr Leu Leu His Ile Asn His Arg Trp Ser His 875 880 885 890 GAC GGC GCC AAG CAG ACC ATT GCC AAG CTC GCG CAC GAC GGA TCC GGC 5360 Asp Gly Ala Lys Gln Thr Ile Ala Lys Leu Ala His Asp Gly Ser Gly 895 900 905 ACC AAT GTC GAA CCG GAC GTG GAG TCC TGC AAC CCC CAC TGT GTC TCC 5408 Thr Asn Val Glu Pro Asp Val Glu Ser Cys Asn Pro His Cys Val Ser 910 915 920 TTC TTC ATC AAA GAC CCC AAT AAG GTCCGTACAG CGCCCTGCAT TCTACTTAAT 5462 Phe Ile Lys Asp Pro Asn Lys 925 930 CACAATCTCC TGACACATTG AAAAATGTTC TAATTTGTTG GTATCTGAAA TTCTGAATCT 5522 GAATTCTGCT TCATTTTTTA G GTG AGG ACG ATG GAT GAG ATG CGG GAG AGG 55 73 Val Arg Thr Met Asp Glu Met Arg Glu Arg 935 940 GTG AGG ATG CGT GGC CTC CGA TGC CAT CTC ATG TAC TGC AGG AAT GCA 5621 Val Arg Met Arg Gly Leu Arg Cys His Leu Met Tyr Cys Arg Asn Ala 945 950 955 ACA AGG CTT CAA GTT GTT CCT CTT CTA GCA TCG AGG TCA CAA GCA CTC 5669 Thr Arg Leu Gln Val Val Pro Leu Leu Ala Ser Arg Ser Gln Ala Leu 960 965 970 AG GTGAAGTCTA CATACAAGTT TTCACATTATTGTCCA 5721 AGgATCATG 5721 Arg TTACGG CTT TTC 5775 Arg Tyr Leu Phe 975 GTA CGC TGG GGC CTG TCT GTG GGA AAC ATG TAT CTG ATC GTC GGG GAG 5823 Val Arg Trp Gly Leu Ser Val Gly Asn Met Tyr Leu Ile Val Gly Glu 980 985 990 CAC GGC GAC ACC GAT CAC GAG GAG ATG CTG TCA GGG TTA CAC AAG ACG 5871 His Gly Asp Thr Asp His Glu Glu Met Leu Ser Gly Leu His Lys Thr 995 1000 1005 GTG ATC ATC CGC GGC GTC ACC GAG AAG GGC TCG GAG CAG CTG GTG AGG 5919 Val Ile Ile Arg Gly Val Thr Glu Lys Gly Ser Glu Gln Leu Val Arg 1010 1015 1020 AGC TCA GGG AGT TAC CAG AGG GAA GAT GTT GTC CCA TCC GAG AGC CCC 5967 Ser Ser Gly Ser Tyr Gln Arg Glu Asp Val Val Pro Ser Glu Ser Pro 1025 1030 1035 1040 TTG ATT GCT TTC ACA AAG GGT GAT CTG AAG GCC GAT GAG ATC ATG CGT 6015 Leu Ile Ala Phe Thr Lys Gly Asp Leu Lys Ala Asp Leu Lys Ala Asp Glu Ile Met Arg 1045 1050 1055 GCT CTC AAG GAG GTC ACC AAG GCT GCC AGT GGC ATG TAA ATTGGTTGCC 6064 Ala Leu Lys Glu Val Thr Lys Ala Ala Ser Gly Met 1060 1065TCGATGCTCTGAGACAGTCTCCGAGACCTACTGTGAAG CCTAGAGT TCTTATGGAC CACTACCACG AACTTACCTT GCAGTGAGAA ATAATTATGA CACTGCTGAT 6244 GCTACTGTTG GCTCAAATGT TTATGAGCTG ATTCAGTTAT ATGTATTTTT CCTTTTAATC 6304 CTGCACTTGG TTCAAGTACG CATATCATGG CAATTCTCTT AATAATTTCG GTCCTTGTTC 6364 AGGATTGGAT TACTTGGCAC GTTCTCTCCC GTGGGTTNGT GAAAATAACC TAGGACATAA 6424 ATGGTTTGTA ACTTAAGTTT CAGTAAACCC AGTCAAAAGG AAACATACAA TTCAAACAAG 6484 CTGACTGATA ATTAACACTG TATTTCTGAC ACTAGGTTCA TTTTCTGAGA CTGTCCTATC 6544 GCTGAAACCT TTTTTTTATT TTTTGAAAGA ACTGAAACTT TACCAAGCTA ACTAATACTC 660 4 TCTCCGTCCC TAAATATTTG ACGCCGTTGA CTTTTTAGCA CATGTTTGAC CGTTTGTCTT 6664 ATTCAAAAAC TTTTGTGAAA TATATAAAAC TATATGTATA CATAAAAATA TATTTAAGAA 6724 TGAATCAAAT GATAGGAAAA GAATTAATAA TTACTTAAAT TTTTTTGAAT AAGACGAACG 6784 GTCAAACATA TTTAAAAAAG TCAACGGCGT CGAATATTTA GGGAGCATAA ATGAAGGTTA 6844 AGTTATATTT CTTTAATAAT AACTTACAGG CCACGTGGCA CACTCCAATT GGTCGAC 6901 SEQ ID NO: length of the two sequences: 1068 SEQ type: Amino acid sequence Met Ala Gly Asn Glu Trp Ile Asn Gly Tyr Leu Glu Ala Ile Leu Asp 1 5 10 15 Ser Gly Gly Ala Ala Gly Gly Gly Gly Gly Gly Gly Gly Val Asp Pro 20 25 30 Ser Ser Pro Thr Thr Gly Thr Thr Ser Pro Arg Gly Pro His Met Asn 35 40 45 Phe Asn Pro Thr His Tyr Phe Val Glu Glu Val Val Lys Gly Val Asp 50 55 60 Glu Ser Asp Leu His Arg Thr Trp Ile Lys Val Val Ala Thr Arg Asn 65 70 75 80 Ala Arg Glu Arg Ser Thr Arg Leu Glu Asn Met Cys Trp Arg Ile Trp 85 90 95 His Leu Ala Arg Lys Lys Lys Gln Leu Glu Leu Glu Gly Ile Leu Arg 100 105 110 Ile Ser Ala Arg Arg Lys Glu Gln Glu Gln Val Arg Arg Glu Thr Ser 115 120 125 Glu Asp Leu Ala Glu Asp Leu Phe Glu Gly Glu Lys Ala Asp Thr Val 130 135 140 Gly Glu Leu Ala Gln Gln Asp Thr Pro Met Lys Lys Lys Phe Gln Arg 145 150 155 160 Asn Phe Ser Glu Leu Thr Val Ser Trp Ser Asp Glu Asn Lys Glu Lys 165 170 175 Lys Leu Tyr Ile Val Leu Ile Ser Leu His Gly Leu Val Arg Gly Asp 180 185 190 Asn Met Glu Leu Gly Arg Asp Ser Asp Thr Gly Gly Gln Val Lys Tyr 195 200 205 Val Val Glu Leu Ala Arg Ala Leu Ala Met Met Pro Gly Val Tyr Arg 210 215 220 Val Asp Leu Phe Thr Arg Gln Val Ser Ser Pro Glu Val Asp Trp Ser 225 230 235 240 Tyr Gly Glu Pro Thr Glu Met Leu Thr Ser Gly Ser Thr Asp Gly Glu 245 250 255 Gly Ser Gly Glu Ser Ala Gly Ala Tyr Ile Val Arg Ile Pro Cys Gly 260 265 270 Pro Arg Asp Lys Tyr Leu Arg Lys Glu Ala Leu Trp Pro Tyr Leu Gln 275 280 285 Glu Phe Val Asp Gly Ala Leu Ala His Ile Leu Asn Met Ser Lys Ala 290 295 300 Leu Gly Glu Gln Val Ser Asn Gly Lys Leu Val Leu Pro Tyr Val Ile 305 310 315 320 His Gly His Tyr Ala Asp Ala Gly Asp Val Al a Ala Leu Leu Ser Gly 325 330 335 Ala Leu Asn Val Pro Met Val Leu Thr Gly His Ser Leu Gly Arg Asn 340 345 350 Lys Leu Glu Gln Ile Met Lys Gln Gly Arg Met Ser Lys Glu Glu Met 355 360 365 Asp Ser Thr Tyr Lys Ile Met Arg Arg Ile Glu Gly Glu Glu Leu Ala 370 375 380 Leu Asp Ala Ala Glu Leu Val Ile Thr Ser Thr Arg Gln Glu Ile Asp 385 390 395 400 Glu Gln Trp Gly Leu Tyr Asp Gly Phe Asp Val Lys Leu Glu Lys Val 405 410 415 Leu Arg Ala Arg Ala Arg Arg Gly Val Ser Cys His Gly Arg Phe Met 420 425 430 Pro Arg Met Val Val Ile Pro Pro Gly Met Asp Phe Ser Ser Val Val 435 440 445 Val Pro Glu Asp Thr Ser Asp Gly Asp Asp Gly Lys Asp Phe Glu Ile 450 455 460 Ala Ser Pro Arg Ser Leu Pro Pro Ile Trp Ala Glu Val Ser Arg Phe 465 470 475 480 Trp Thr Asn Pro His Lys Pro Met Ile Leu Ala Leu Ser Arg Pro Asp 485 490 495 Pro Lys Lys Asn Ile Thr Thr Leu Val Lys Ala Phe Gly Glu Cys Arg 500 505 510 Pro Leu Arg Glu Leu Ala Asn Leu Ile Leu Ser Met Gly Thr Arg Asp 515 520 525 Asp Ile Asp Gly Met Ser Ala Gly Asn Ala Ser Va l Leu Thr Thr Val 530 535 540 Leu Lys Leu Ile Asp Lys Tyr Asp Leu Tyr Gly Ser Val Ala Phe Pro 545 550 555 560 Lys Tyr His Lys Gln Ser Asp Val Pro Glu Ile Tyr Arg Leu Thr Gly 565 570 575 Lys Met Lys Gly Val Phe Ile Asn Pro Ala Leu Val Glu Pro Phe Gly 580 585 590 Leu Thr Leu Ile Glu Ala Ala Ala His Gly Leu Pro Ile Val Gly Thr 595 600 605 Lys Asn Gly Gly Pro Val Asp Ile Lys Asn Ala Leu Asn Asn Gly Leu 610 615 620 Leu Val Asp Pro His Asp Gln His Ala Ile Ala Asp Ala Leu Leu Lys 625 630 635 640 Leu Val Ala Asp Lys Asn Leu Trp Gln Glu Cys Arg Lys Asn Gly Leu 645 650 655 Arg Asn Ile Gln Leu Tyr Ser Trp Pro Glu His Cys Arg Thr Tyr Leu 660 665 670 Thr Arg Ile Ala Gly Cys Arg Ile Arg Asn Pro Arg Trp Leu Met Asp 675 680 685 Thr Pro Ala Asp Ala Ala Ala Glu Glu Glu Glu Ala Leu Glu Asp Ser 690 695 700 Leu Met Asp Val Gln Asp Leu Ser Leu Arg Leu Ser Ile Asp Gly Glu 705 710 715 720 Arg Gly Ser Ser Met Asn Asp Ala Pro Ser Ser Asp Pro Gln Asp Ser 725 730 735 Val Gln Arg Ile Met Asn Lys Ile Lys Arg Ser S er Pro Ala Asp Thr 740 745 750 Asp Gly Ala Lys Ile Pro Ala Glu Ala Ala Ala Thr Ala Thr Ser Gly 755 760 765 Ala Met Asn Lys Tyr Pro Leu Leu Arg Arg Arg Arg Arg Leu Phe Val 770 775 780 Ile Ala Val Asp Cys Tyr Gly Asp Asp Gly Ser Ala Ser Lys Arg Met 785 790 795 800 Leu Gln Val Ile Gln Glu Val Phe Arg Ala Val Arg Ser Asp Ser Gln 805 810 815 Met Ser Arg Ile Ser Gly Phe Ala Leu Ser Thr Ala Met Pro Leu Pro 820 825 830 Glu Thr Leu Lys Leu Leu Gln Leu Gly Lys Ile Pro Pro Thr Asp Phe 835 840 845 Asp Ala Leu Ile Cys Gly Ser Gly Ser Glu Val Tyr Tyr Pro Ser Thr 850 855 860 Ala Gln Cys Val Asp Ala Gly Gly Arg Leu Arg Pro Asp Gln Asp Tyr 865 870 875 880 Leu Leu His Ile Asn His Arg Trp Ser His Asp Gly Ala Lys Gln Thr 885 890 895 Ile Ala Lys Leu Ala His Asp Gly Ser Gly Thr Asn Val Glu Pro Asp 900 905 910 Val Glu Ser Cys Asn Pro His Cys Val Ser Phe Phe Ile Lys Asp Pro 915 920 925 Asn Lys Val Arg Thr Met Asp Glu Met Arg Glu Arg Val Arg Met Arg 930 935 940 Gly Leu Arg Cys His Leu Met Tyr Cys Arg Asn Ala T hr Arg Leu Gln 945 950 955 960 Val Val Pro Leu Leu Ala Ser Arg Ser Gln Ala Leu Arg Tyr Leu Phe 965 970 975 Val Arg Trp Gly Leu Ser Val Gly Asn Met Tyr Leu Ile Val Gly Glu 980 985 990 His Gly Asp Thr Asp His Glu Glu Met Leu Ser Gly Leu His Lys Thr 995 1000 1005 Val Ile Ile Arg Gly Val Thr Glu Lys Gly Ser Glu Gln Leu Val Arg 1010 1015 1020 Ser Ser Gly Ser Tyr Gln Arg Glu Asp Val Val Pro Ser Glu Ser Pro 1025 1030 1035 1040 Leu Ile Ala Phe Thr Lys Gly Asp Leu Lys Ala Asp Glu Ile Met Arg 1045 1050 1055 Ala Leu Lys Glu Val Thr Lys Ala Ala Ser Gly Met 1060 1065

[Brief description of drawings]

FIG. 1 is a diagram showing the positions of primers used in Examples of the present invention.

FIG. 2 shows the nucleotide sequences of genes and corresponding amino acid sequences obtained in the examples of the present invention.

FIG. 3 is a diagram showing a continuation of the arrangement shown in FIG.

FIG. 4 is a view showing a continuation of the arrangement shown in FIG.

5 is a diagram showing a continuation of the arrangement shown in FIG. 4. FIG.

FIG. 6 is a diagram showing a continuation of the array shown in FIG. 5;

Claims (3)

[Claims] 1. A rice sucrose phosphate synthase gene encoding the amino acid sequence shown in SEQ ID NO: 2 in the sequence listing. 2. The nucleotide sequence shown in SEQ ID NO: 1 of the Sequence Listing, which is 894th to 963rd, and 1012th to 1253th.
No. 1891 to 2129, 2227 to 229
0, 2423 to 3115, 3266 to 33
85th, 3474th to 3605th, 3918th to 4th
The gene according to claim 1, which has a nucleotide sequence of 094, 4203 to 4256, 4345 to 4407, 4497 to 5432, 5544 to 5671 and 5766 to 6054. 3. The gene according to claim 2, which has the nucleotide sequence shown in SEQ ID NO: 1 in the sequence listing.