CN114107260A - Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof - Google Patents
Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof Download PDFInfo
- Publication number
- CN114107260A CN114107260A CN202111568039.XA CN202111568039A CN114107260A CN 114107260 A CN114107260 A CN 114107260A CN 202111568039 A CN202111568039 A CN 202111568039A CN 114107260 A CN114107260 A CN 114107260A
- Authority
- CN
- China
- Prior art keywords
- fucoidan
- sulfate
- ouc
- degrading enzyme
- enzyme
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/70—Vectors or expression systems specially adapted for E. coli
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/12—Disaccharides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/14—Preparation of compounds containing saccharide radicals produced by the action of a carbohydrase (EC 3.2.x), e.g. by alpha-amylase, e.g. by cellulase, hemicellulase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01044—Fucoidanase (3.2.1.44)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a fucoidan sulfate degrading enzyme OUC-FaFcn1, the amino acid sequence of which is shown in SEQ ID NO.1. The nucleotide sequence of the gene for coding the fucoidan sulfate degrading enzyme OUC-FaFcn1 is shown in SEQ ID NO. 2. The application of the fucoidan degrading enzyme OUC-FaFcn1 in degrading fucoidan sulfate/preparing low molecular weight fucoidan sulfate. The invention also discloses an enzyme preparation containing the fucoidan sulfate degrading enzyme OUC-FaFcn 1. The fucosan sulfate degrading enzyme OUC-FaFcn1 has specific enzyme activity of 4.11U/mg at 40 deg.C and pH of 9, and can act on fucosan sulfate substrate, final product fucosan sulfate oligosaccharide with different polymerization degrees, and main product fucobiose. Good degradation effect and mild reaction condition.
Description
Technical Field
The invention relates to recombinant expression, preparation and application of fucoidan sulfate degrading enzyme OUC-FaFcn1, belonging to the technical field of functional enzymes.
Background
Fucoidan (Fucoidan), an important class of marine polysaccharides, is composed mainly of fucose and sulfate groups, with a small proportion of other monosaccharides, such as glucose, galactose, mannose, xylose, uronic acid, etc., present in the structure. Fucoidan is widely distributed in brown algae and echinoderm, and can be generally classified into two types according to the connection mode of the main chain: the first fucosan sulfate is composed of fucopyranose residues which are connected by relatively uniform alpha-1, 3 glycosidic bonds, and sulfate groups mainly exist at positions C2 and C4 and are mainly distributed in Laminaria japonica, Echinodermata, sea cucumber, sea urchin and other echinoderms; the other fucosan sulfate main chain is formed by alternately connecting alpha-1, 3 and alpha-1, 4 glycosidic bonds, a side chain branch structure of alpha-1, 2 is also present, sulfate groups are mainly present in C2, a small amount of sulfate groups are located at C3 and C4, and the fucosan is mainly distributed in Ascophyllum nodosum and Fucales algae.
Fucoidin has extensive biological activities of anticoagulation, antioxidation, antitumor, antithrombotic formation, anti-inflammation, lipid reduction, immunoregulation, antivirus and the like, thereby arousing the research interest of extensive experts and scholars and having wide application prospect in the fields of food and medicine. However, fucoidan has a complex structure, which greatly varies with algae species, harvesting time, and extraction method, and its properties such as high molecular weight and high viscosity may limit its bioavailability and functional activity. The low molecular weight fucosan sulfate is easy to absorb, and has some unique biological activities, such as antibiosis, antidiabetic, whitening, and the like. Therefore, how to prepare the fucoidan with low molecular weight with high efficiency becomes a hot problem for people to study.
The method for preparing the fucosan sulfate with low molecular weight comprises a physical method, a chemical method and an enzymolysis method, wherein the physical method mainly refers to a method for degrading the fucosan sulfate by physical means such as ultrasonic, microwave and the like; the chemical method mainly comprises acid hydrolysis and oxidation degradation; at present, the most common degradation methods are acid hydrolysis and enzyme hydrolysis, and compared with the acid hydrolysis method, the enzyme hydrolysis method has the advantages of high efficiency, mild reaction, single product, easiness in separation and the like, but fucoidan sulfate degrading enzymes are reported rarely, and only 14 degrading enzymes are researched at present. Therefore, the discovery of a new fucoidan sulfate-degrading enzyme has great significance for analyzing fucoidan sulfate with a complex structure and obtaining fucooligosaccharide with a specific structure.
Disclosure of Invention
Aiming at the prior art, the invention provides a novel degrading enzyme, namely the fucoidan sulfate degrading enzyme OUC-FaFcn1, which can degrade fucoidan sulfate to generate low molecular weight fucoidan sulfate, and makes up the defects of the existing enzyme library.
The invention is realized by the following technical scheme:
the amino acid sequence of the fucoidan degrading enzyme OUC-FaFcn1 is shown as SEQ ID NO.1.
The amino acid sequence of the fucoidan-degrading enzyme OUC-FaFcn1 (SEQ ID NO. 1):
MNSKQNISYKLDKNLILIITCAFLSIPTVNAQVPDSEQGLRAGWLRGAWGLNWKPENFYNGTIEDVSIAPYLEELKDVRTLDYIQVHLSESNIYSPSHSAPHPLLESFWQEDTDESGNPINLIVPRASSGVDPFESWLKAIKGAGLKTMVYVNSYNLLARDPTSIPDGFPDVSTRWMEWCDTNPEAQAFINSQSYHIKGDNRRRYMFCYAEFVLKVYAQRYGDLIDAWGFDSADNVMADECGDEPKSDLLDDQRIYEAFANALHTGNSNAAVAFNNSVGTAAAPFTTPTYFDDYCFGHPFGGAGNMVETESLYTRNFGIPQLMNTTNGFPFRDDTRDWNDNVVGRFFPKLSTTSWNAGATPCLTDEQFVEWNSVGIIDAGSILWGAPLLRNNLNNSPVLTLQPLALAQLKLLDAHLKISQFTGSPVFARQETILPAVYIGQSYTHNLVEGFDFWDSEELGITNISFEGIKPSWLNVSLTAEGVWTISGNPTETVPQDYTFELKIEDADGSTTRSVKLQVIEHPADFINPLDGTPIWKLNPTVLANAVALKEYSSLLELGVHFYDFENDPLTINMISGPSWLSLTEVAEGNWRLKGIPSVTDAGVNTFNFTVSDGVHSSEAEIKITVDHAGDFTDLGDGTPVWSSTTFNLADGEVSTAYNSILQFGIDFYDFEGDALTITKTAGANWLTIQQTTTGTWELSGTPTLADEGEQSFTFNLSDGIKSSNAEIIIKVIPTVKIEGEVEIKATALTNYGIGTTATMVSDVQTAVDGKATFKVAIQVTPPADKAVISGISGGSATEYSWGLGDGTNVNTDYIFTGSDNEWVENINNIQIIDFNANGGSLTKESMTAFFKSVTIVNAQSSKDYVSLKVEGVISNPGKLADQITILNLKEATGVDEISAFSIGTGNTETTNKWAVEGISVAITYNENTLSNKDFNVTDRQEFILFPNPVTTHISFIITPQKTEIFDLTGKTLLTDISGNKTIDISSLNKGMYLIKVQNEEGKLFFSKFIKIKQ。
the nucleotide sequence of the gene for coding the fucoidan sulfate degrading enzyme OUC-FaFcn1 is shown as SEQ ID NO. 2.
Nucleotide sequence of the gene encoding fucoidan-FaFcn 1 (SEQ ID No. 2):
5’-ATGAATAGTAAACAAAATATATCGTATAAATTAGATAAGAATTTAATACTAATTATTACTTGTGCTTTTTTATCCATACCTACTGTAAATGCACAAGTTCCAGATTCCGAACAAGGATTACGTGCCGGCTGGCTGCGTGGAGCTTGGGGACTAAATTGGAAGCCTGAAAACTTTTACAATGGTACCATAGAAGATGTATCTATTGCACCTTATCTTGAAGAATTAAAGGATGTTCGAACATTAGATTATATTCAAGTTCATTTATCTGAATCAAATATTTATTCACCGTCACATAGCGCACCACATCCGCTTTTAGAAAGTTTTTGGCAAGAAGATACAGATGAAAGCGGAAATCCAATAAATCTAATAGTTCCACGGGCTTCTTCGGGGGTAGATCCTTTTGAAAGCTGGCTTAAAGCAATTAAAGGAGCAGGATTAAAAACCATGGTATATGTTAATTCTTATAATTTATTAGCTCGTGACCCAACATCCATACCTGATGGTTTTCCTGATGTATCTACTAGATGGATGGAGTGGTGTGATACTAATCCCGAGGCTCAAGCTTTTATCAATAGCCAATCTTATCATATTAAAGGTGACAACAGACGTCGCTATATGTTTTGTTATGCTGAATTTGTTCTAAAAGTGTATGCTCAACGTTATGGAGATTTAATTGATGCGTGGGGATTCGATTCTGCTGACAATGTTATGGCAGACGAATGCGGAGATGAGCCTAAATCGGATCTTTTAGACGATCAGCGTATCTATGAGGCTTTTGCCAATGCGTTACATACTGGAAATTCAAATGCTGCTGTTGCATTCAACAATAGTGTAGGAACGGCTGCAGCCCCATTTACAACTCCTACTTATTTTGATGATTATTGCTTTGGACATCCTTTTGGGGGTGCTGGAAATATGGTTGAAACAGAGAGTTTGTATACTAGAAATTTTGGAATACCGCAACTTATGAATACTACAAATGGATTTCCGTTTAGAGATGATACTAGAGATTGGAATGACAATGTTGTTGGACGTTTTTTTCCAAAATTAAGTACTACTTCTTGGAATGCAGGAGCAACACCTTGTTTAACAGATGAACAATTTGTAGAATGGAATAGTGTGGGTATAATTGACGCAGGCTCCATACTTTGGGGTGCACCTCTTTTAAGAAATAATTTAAATAATTCTCCTGTGCTCACCCTTCAGCCTTTAGCATTAGCGCAATTAAAGTTATTAGATGCACATTTAAAAATATCTCAATTTACTGGATCTCCGGTTTTCGCCAGACAAGAAACGATTTTGCCAGCGGTATATATTGGGCAAAGTTATACTCATAATTTGGTTGAAGGTTTCGACTTTTGGGATTCAGAGGAATTGGGTATAACAAATATTTCTTTTGAAGGAATTAAACCATCTTGGCTAAATGTCAGTCTAACTGCTGAAGGAGTTTGGACTATAAGTGGAAATCCAACAGAAACTGTACCTCAGGATTACACATTTGAATTAAAGATTGAGGATGCTGATGGATCGACAACAAGGTCAGTAAAATTGCAAGTTATTGAACATCCTGCAGATTTTATAAACCCCTTAGATGGAACCCCTATATGGAAATTGAACCCTACAGTACTTGCAAATGCAGTGGCATTAAAAGAGTATAGTAGCCTATTAGAATTAGGTGTCCATTTTTATGATTTTGAAAATGATCCATTAACAATTAATATGATTTCTGGACCAAGTTGGCTCAGTTTAACGGAGGTTGCCGAGGGAAATTGGCGTTTAAAAGGAATTCCATCTGTAACTGATGCAGGCGTAAACACATTCAATTTTACTGTTAGCGATGGCGTTCATTCCTCAGAGGCAGAAATTAAAATAACAGTCGATCACGCTGGTGATTTTACAGACTTGGGTGATGGTACACCGGTTTGGTCTTCAACCACTTTTAATCTAGCTGATGGAGAAGTATCAACTGCCTATAACTCTATTTTGCAATTCGGTATTGATTTTTATGATTTTGAGGGCGATGCGCTTACGATTACAAAAACAGCAGGAGCGAATTGGCTTACGATACAGCAAACTACTACAGGTACTTGGGAATTAAGTGGAACTCCAACTCTTGCAGATGAGGGCGAACAGTCTTTCACTTTCAATCTAAGTGATGGTATTAAATCATCAAACGCTGAAATTATTATAAAGGTTATACCAACAGTAAAAATTGAAGGAGAAGTTGAAATTAAAGCGACAGCACTAACCAATTATGGGATTGGTACAACAGCGACAATGGTGTCTGATGTTCAAACAGCAGTTGATGGAAAAGCAACTTTCAAAGTGGCTATCCAAGTAACTCCGCCAGCAGATAAAGCAGTAATCTCTGGTATATCGGGAGGTTCGGCAACGGAATATTCTTGGGGTTTAGGTGATGGAACAAATGTGAATACAGATTATATTTTTACAGGAAGCGATAATGAATGGGTAGAGAATATAAATAATATTCAAATTATTGATTTTAATGCCAATGGAGGTTCATTAACTAAAGAAAGTATGACAGCTTTTTTTAAATCTGTTACTATTGTAAATGCGCAATCTTCTAAAGATTATGTATCTCTGAAGGTAGAAGGTGTTATTTCAAATCCTGGAAAATTAGCAGATCAAATAACAATATTAAATTTAAAGGAAGCAACGGGTGTTGATGAAATAAGTGCATTTTCTATTGGTACAGGAAATACTGAAACGACAAATAAATGGGCTGTCGAAGGTATTTCTGTAGCGATAACTTACAATGAAAATACTCTTTCAAATAAAGATTTTAATGTAACTGATAGACAAGAGTTTATACTATTTCCTAACCCTGTAACAACTCATATATCATTTATCATTACACCTCAAAAAACTGAAATTTTTGATTTGACAGGTAAAACACTGCTTACGGATATTTCTGGAAATAAAACAATAGATATTTCTAGTTTGAACAAGGGCATGTATTTAATTAAAGTACAAAACGAAGAAGGGAAGTTGTTTTTTTCTAAATTCATAAAAATAAAACAATAA-3’。
the application of the fucoidan degrading enzyme OUC-FaFcn1 in degrading fucoidan sulfate/preparing low molecular weight fucoidan sulfate.
A method for preparing low molecular weight fucoidan sulfate comprises: the fucoidan sulfate is degraded by the fucoidan sulfate degrading enzyme OUC-FaFcn1 to obtain a low molecular weight fucoidan sulfate product, wherein the product contains oligosaccharides with various polymerization degrees, and the main product is disaccharide.
Further, the degradation conditions are as follows: the concentration of the fucosan sulfate is 0.1-0.3%, the enzyme adding amount is 0.02U, the temperature is 40-50 ℃, the pH value is 8.0-9.0, and the time is 1-12 hours. Preferably, the degradation conditions are: the fucoidan sulfate has a concentration of 0.2%, an enzyme amount of 0.02U, a temperature of 40 deg.C, a pH of 9.0, and a time of 1 hr.
The gene of the encoding fucoidan sulfate degrading enzyme OUC-FaFcn1 is applied to the preparation of enzyme preparations for degrading fucoidan sulfate/preparing low molecular weight fucoidan sulfate.
An enzyme preparation comprises the above fucoidan-degrading enzyme OUC-FaFcn 1.
The use of the enzyme preparation in degrading fucoidan sulfate/preparing low molecular weight fucoidan sulfate.
A recombinant expression vector carrying the above gene encoding the fucoidan sulfate-degrading enzyme OUC-FaFcn 1.
A recombinant engineering bacterium, wherein the gene coding the fucoidan sulfate-degrading enzyme OUC-FaFcn1 is inserted into the genome of the recombinant engineering bacterium, and the recombinant engineering bacterium can express the fucoidan sulfate-degrading enzyme OUC-FaFcn 1.
The recombinant engineering bacteria can be applied to the preparation of fucoidan sulfate degrading enzyme OUC-FaFcn 1.
The specific enzyme activity of the fucoidan degrading enzyme OUC-FaFcn1 can reach 4.11U/mg under the conditions of 40 ℃ and pH value of 9. The activity of the studied fucoidan degrading enzyme is low, only the generation of products can be detected, and the activity of the fucoidan degrading enzyme cannot be quantified by a colorimetric method. Therefore, compared with the reported literature, the fucoidan sulfate degrading enzyme OUC-FaFcn1 has higher enzyme activity. It can be used as fucoidan sulfate substrate, fucoidan sulfate oligosaccharide with different polymerization degrees as final product, and fucobiose as main product. The invention constructs a recombinant vector containing the fucoidan sulfate degrading enzyme gene, realizes heterologous expression in escherichia coli, and provides a good foundation for industrial production and application of the enzyme. The expressed fucoidan degrading enzyme has mild reaction condition and good degrading effect on fucoidan, degrades the fucoidan to generate disaccharide, and the like, and can be applied to the preparation of antibacterial agents, antiviral agents, immunomodulators, antioxidants, and the like.
The various terms and phrases used herein have the ordinary meaning as is well known to those skilled in the art.
Drawings
FIG. 1: the purified pure enzyme SDS-PAGE electrophoresis picture of the fucoidan sulfate degrading enzyme is shown in the invention, wherein M is a standard protein Marker; 1 is pET-28a (+) no-load plasmid protein; 2, crude enzyme protein; 3 is fucoidan degradation enzyme protein after purification and concentration.
FIG. 2: schematic diagram of influence of temperature change on relative enzyme activity
FIG. 3: schematic diagram of the effect of pH change on relative enzyme activity.
FIG. 4: the liquid phase diagram of the enzymatic hydrolysate of fucoidan sulfate degrading enzyme of the invention.
FIG. 5: the mass spectrogram of disaccharide which is a main product of the degradation enzyme of the fucoidan sulfate is disclosed.
Detailed Description
The present invention will be further described with reference to the following examples. However, the scope of the present invention is not limited to the following examples. It will be understood by those skilled in the art that various changes and modifications may be made to the invention without departing from the spirit and scope of the invention.
The instruments, reagents, materials and the like used in the following examples are conventional instruments, reagents, materials and the like in the prior art and are commercially available in a normal manner unless otherwise specified. Unless otherwise specified, the experimental methods, detection methods, and the like described in the following examples are conventional experimental methods, detection methods, and the like in the prior art.
EXAMPLE 1 cloning of the fucoidan sulfate-degrading enzyme OUC-FaFcn1
The inventor of the invention notices that the strain Flavobacterium Flavobacterium algicola (preserved in China general microbiological culture Collection center with the preservation number of CGMCC No.1.12076 and the preservation date of 1/10/2012, which is a strain disclosed in the prior art and can be purchased from China university of oceanic culture or China general microbiological culture Collection center) has better activity on the fucoidan sulfate, so the strain is subjected to whole genome sequencing (the sequencing sequence is not disclosed) and digs a gene with the similarity of about 59.01 percent of the family of GH107 fucoidan sulfate degrading enzymes, and the inventor performs PCR amplification on the gene (the sequences of the used primers are shown as SEQ ID NO.3 and 4) from Flavobacterium alficola (the gene fragment can also be obtained by artificial synthesis), and pET28a (+) was used as a gene vector for expression in E.coli. The fucoidan sulfate degrading enzyme gene disclosed by the invention comprises 3045 base sequences shown as SEQ ID NO.2 and 1014 coded amino acids shown as SEQ ID NO.1. The fucoidan-degrading enzyme was found to belong to polysaccharide hydrolase family 107 (GH107) according to the phylogenetic tree alignment.
Taking Flavobacterium sp.algicola genome as a template, designing primers for seamless connection at the upstream and downstream of fucoidan sulfate degrading enzyme gene, and carrying out PCR amplification on an OUC-FaFcn1 gene fragment.
The sequences of the primers are shown below:
an upstream primer: 5'-CGAATTCGAGCTCCGTCAAGTTCCAGATTCCG-3', as shown in SEQ ID NO. 3;
a downstream primer: 5'-TCAGTGGTGGTGGTGGTGGTGTTGTTTTATTTTTATG-3', as shown in SEQ ID NO. 4.
The PCR reaction system is as follows: 2 XPCR Buffer 25. mu.L, dNTP 10. mu.L, primers 1.5. mu.L each, template 1. mu.L, KOD Fx enzyme 1. mu.L, sterile water 10. mu.L, total 50. mu.L.
The reaction conditions of PCR were: pre-denaturation at 94 deg.C for 5min, denaturation at 98 deg.C for 10s, annealing at 58 deg.C for 15s, extension at 72 deg.C for 3min, reaction for 30 cycles, and extension at 72 deg.C for 5 min.
After agarose gel electrophoresis, a 3Kb fragment of the PCR product was recovered.
Example 2 construction of expression vector containing fucoidan sulfate-degrading enzyme Gene
The gene fragment and pET-28a (+) cloning vector are connected by adopting a seamless cloning technology, the connection product is transferred into E.coli DH5 alpha competent cells, the competent cells are coated on an LB culture medium solid plate (containing 50 mu g/mL kanamycin), after the culture is carried out for 16 hours in an incubator at 37 ℃, a single clone is picked up to an LB liquid culture medium containing 50 mu g/m L kanamycin, and the shaking culture is carried out at 37 ℃ and the shaking culture is carried out overnight at the rotating speed of 220 rpm. Single clones were sequenced after positive validation and were designated pET28a-OUC-FaFcn 1. The plasmid was stored at-20 ℃ until use.
Example 3 construction of recombinant plasmid and engineering bacteria containing fucoidan sulfate-degrading enzyme Gene
The plasmid extracted in example 2 is transformed into host E.coli BL21 competent cells, and the constructed engineering bacteria grow on a kanamycin sulfate resistant plate to obtain a recombinant expression strain.
Example 4 preparation of recombinant fucoidan sulfate-degrading enzyme Using engineered Escherichia coli
After the escherichia coli recombinant strain is activated in 5ml LB liquid culture medium (containing 50 mug/m L kanamycin), the escherichia coli recombinant strain is inoculated into LB culture medium containing kanamycin sulfate (50 mug/m L) according to the inoculation amount of 1%, the bacillus coli recombinant strain is cultured for 6 hours at 37 ℃ and 200rpm, when the OD (600) value of a bacterial liquid is 0.6, 1 ‰ IPTG (100mM/L) is added, and the fucoidan sulfate degrading enzyme is expressed by low-temperature induction at 20 ℃ for 20 hours.
After fermentation, 8000xg is centrifuged for 10min to collect thalli, the cells are suspended in 50mM Tirs-HCl buffer solution with pH 8.0, then the cells are ultrasonically crushed for 20min (200W,3s on and 3s off) in ice water bath, then 8000xg is centrifuged again for 15min, and supernatant is collected, namely crude enzyme solution. Based on the His-tag-fused protein, the crude enzyme solution was subjected to affinity chromatography purification using a Ni-NTA column, the column was equilibrated with a low concentration of 10mM imidazole solution (500mM NaCl,50mM Tris-HCl), followed by elution of the hetero-protein having a weak binding force with a 20mM imidazole solution (500mM NaCl,50mM Tris-HCl), elution of the objective protein with a 100mM imidazole solution, and collection of the eluted components in the buffer of this fraction to obtain a solution of purified recombinant fucoidan sulfate-degrading enzyme (17 mg of pure enzyme per liter of medium). The purity and molecular weight of the protein were checked by SDS-PAGE (FIG. 1), and the results showed that the electrophoretically pure protein was obtained by affinity column purification of the recombinant protein, with a molecular weight of about 110 kDa.
Example 5 determination of specific enzyme Activity of recombinant fucoidan sulfate-degrading enzyme
The standard assay for fucoidan sulfate-degrading enzyme OUC-FaFcn1 activity was: a300. mu.L reaction system containing 30. mu.L of enzyme solution, 270. mu.L of 0.2% fucoidan sulfate dissolved in Tris-HCl pH 9.0 was reacted at 40 ℃ for 1 hour, the reaction sample was mixed with 100. mu.L of pHBH reagent (4-hydroxybenzohydrazide dissolved in 2M HCl, 20% concentration, mixed with 2M NaOH at a ratio of 1: 9), and boiled in a boiling water bath for 5 minutes for color development at OD415nmThe absorbance was measured. Enzyme activity is defined as the amount of enzyme required to produce 1. mu.M reducing sugar per min under standard conditions. The activity of the purified fucoidan degrading enzyme can reach 4.11U/mg through determination.
Example 6 determination of optimum reaction conditions for fucoidan sulfate-degrading enzyme
The purified fucoidan sulfate-degrading enzyme solution obtained in example 4 was reacted at different temperatures and pH, and the influence of temperature and pH on the enzyme activity was measured. Selecting the temperature of 25 ℃, 30 ℃, 35 ℃, 40 ℃, 45 ℃,50 ℃, 55 ℃, 60 ℃ and 65 ℃, and determining the optimum temperature according to the reaction of the method for determining the specific enzyme activity of the fucoidan sulfate degrading enzyme for 1 hour in the embodiment 5. At 40 ℃, selecting buffer solution with pH of 3.0-10.0 as different pH buffer solutions for enzyme reaction, and determining the optimum pH of the fucoidan sulfate degrading enzyme according to the enzyme activity of the fucoidan sulfate degrading enzyme. The relative enzyme activities under different conditions were calculated with the highest enzyme activity being 100%, and the results are shown in fig. 2 and fig. 3, where the optimal reaction temperature of the recombinant fucoidan sulfate-degrading enzyme was 40 ℃, and the optimal pH was 9.0.
Example 7 determination of degradation products of recombinant fucoidan sulfate-degrading enzymes
The fucoidan-degrading enzyme OUC-FaFcn1 purified in example 4 was reacted with 0.2% fucoidan sulfate at 40 ℃ for 48 hours, and then the product was detected by high performance liquid chromatography. As shown in FIG. 4, the results show that the product contains oligosaccharides with different polymerization degrees.
Example 8 definition of recombinant fucoidan sulfate-degrading enzyme product composition
The fucoidan-degrading enzyme OUC-FaFcn1 purified in example 4 was reacted with 0.2% fucoidan sulfate at 40 deg.C until complete conversion, and the major product was collected in the liquid phase and then detected by ESI-MS. As shown in fig. 5, the results indicate that the main product is a disaccharide.
Example 9 preparation of enzyme preparation Using recombinant fucoidan sulfate-degrading enzyme
Enzyme preparation was prepared using the recombinant fucoidan-degrading enzyme prepared in example 4: purifying the fermented and crushed solution, replacing imidazole with a buffer solution, freeze-drying and storing enzyme powder.
The above examples are provided to those of ordinary skill in the art to fully disclose and describe how to make and use the claimed embodiments, and are not intended to limit the scope of the disclosure herein. Modifications apparent to those skilled in the art are intended to be within the scope of the appended claims.
Sequence listing
<110> China oceanic university
<120> fucoidan-degrading enzyme OUC-FaFcn1 and application thereof
<141> 2021-12-16
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1014
<212> PRT
<213> Flavobacterium algicola
<400> 1
Met Asn Ser Lys Gln Asn Ile Ser Tyr Lys Leu Asp Lys Asn Leu Ile
1 5 10 15
Leu Ile Ile Thr Cys Ala Phe Leu Ser Ile Pro Thr Val Asn Ala Gln
20 25 30
Val Pro Asp Ser Glu Gln Gly Leu Arg Ala Gly Trp Leu Arg Gly Ala
35 40 45
Trp Gly Leu Asn Trp Lys Pro Glu Asn Phe Tyr Asn Gly Thr Ile Glu
50 55 60
Asp Val Ser Ile Ala Pro Tyr Leu Glu Glu Leu Lys Asp Val Arg Thr
65 70 75 80
Leu Asp Tyr Ile Gln Val His Leu Ser Glu Ser Asn Ile Tyr Ser Pro
85 90 95
Ser His Ser Ala Pro His Pro Leu Leu Glu Ser Phe Trp Gln Glu Asp
100 105 110
Thr Asp Glu Ser Gly Asn Pro Ile Asn Leu Ile Val Pro Arg Ala Ser
115 120 125
Ser Gly Val Asp Pro Phe Glu Ser Trp Leu Lys Ala Ile Lys Gly Ala
130 135 140
Gly Leu Lys Thr Met Val Tyr Val Asn Ser Tyr Asn Leu Leu Ala Arg
145 150 155 160
Asp Pro Thr Ser Ile Pro Asp Gly Phe Pro Asp Val Ser Thr Arg Trp
165 170 175
Met Glu Trp Cys Asp Thr Asn Pro Glu Ala Gln Ala Phe Ile Asn Ser
180 185 190
Gln Ser Tyr His Ile Lys Gly Asp Asn Arg Arg Arg Tyr Met Phe Cys
195 200 205
Tyr Ala Glu Phe Val Leu Lys Val Tyr Ala Gln Arg Tyr Gly Asp Leu
210 215 220
Ile Asp Ala Trp Gly Phe Asp Ser Ala Asp Asn Val Met Ala Asp Glu
225 230 235 240
Cys Gly Asp Glu Pro Lys Ser Asp Leu Leu Asp Asp Gln Arg Ile Tyr
245 250 255
Glu Ala Phe Ala Asn Ala Leu His Thr Gly Asn Ser Asn Ala Ala Val
260 265 270
Ala Phe Asn Asn Ser Val Gly Thr Ala Ala Ala Pro Phe Thr Thr Pro
275 280 285
Thr Tyr Phe Asp Asp Tyr Cys Phe Gly His Pro Phe Gly Gly Ala Gly
290 295 300
Asn Met Val Glu Thr Glu Ser Leu Tyr Thr Arg Asn Phe Gly Ile Pro
305 310 315 320
Gln Leu Met Asn Thr Thr Asn Gly Phe Pro Phe Arg Asp Asp Thr Arg
325 330 335
Asp Trp Asn Asp Asn Val Val Gly Arg Phe Phe Pro Lys Leu Ser Thr
340 345 350
Thr Ser Trp Asn Ala Gly Ala Thr Pro Cys Leu Thr Asp Glu Gln Phe
355 360 365
Val Glu Trp Asn Ser Val Gly Ile Ile Asp Ala Gly Ser Ile Leu Trp
370 375 380
Gly Ala Pro Leu Leu Arg Asn Asn Leu Asn Asn Ser Pro Val Leu Thr
385 390 395 400
Leu Gln Pro Leu Ala Leu Ala Gln Leu Lys Leu Leu Asp Ala His Leu
405 410 415
Lys Ile Ser Gln Phe Thr Gly Ser Pro Val Phe Ala Arg Gln Glu Thr
420 425 430
Ile Leu Pro Ala Val Tyr Ile Gly Gln Ser Tyr Thr His Asn Leu Val
435 440 445
Glu Gly Phe Asp Phe Trp Asp Ser Glu Glu Leu Gly Ile Thr Asn Ile
450 455 460
Ser Phe Glu Gly Ile Lys Pro Ser Trp Leu Asn Val Ser Leu Thr Ala
465 470 475 480
Glu Gly Val Trp Thr Ile Ser Gly Asn Pro Thr Glu Thr Val Pro Gln
485 490 495
Asp Tyr Thr Phe Glu Leu Lys Ile Glu Asp Ala Asp Gly Ser Thr Thr
500 505 510
Arg Ser Val Lys Leu Gln Val Ile Glu His Pro Ala Asp Phe Ile Asn
515 520 525
Pro Leu Asp Gly Thr Pro Ile Trp Lys Leu Asn Pro Thr Val Leu Ala
530 535 540
Asn Ala Val Ala Leu Lys Glu Tyr Ser Ser Leu Leu Glu Leu Gly Val
545 550 555 560
His Phe Tyr Asp Phe Glu Asn Asp Pro Leu Thr Ile Asn Met Ile Ser
565 570 575
Gly Pro Ser Trp Leu Ser Leu Thr Glu Val Ala Glu Gly Asn Trp Arg
580 585 590
Leu Lys Gly Ile Pro Ser Val Thr Asp Ala Gly Val Asn Thr Phe Asn
595 600 605
Phe Thr Val Ser Asp Gly Val His Ser Ser Glu Ala Glu Ile Lys Ile
610 615 620
Thr Val Asp His Ala Gly Asp Phe Thr Asp Leu Gly Asp Gly Thr Pro
625 630 635 640
Val Trp Ser Ser Thr Thr Phe Asn Leu Ala Asp Gly Glu Val Ser Thr
645 650 655
Ala Tyr Asn Ser Ile Leu Gln Phe Gly Ile Asp Phe Tyr Asp Phe Glu
660 665 670
Gly Asp Ala Leu Thr Ile Thr Lys Thr Ala Gly Ala Asn Trp Leu Thr
675 680 685
Ile Gln Gln Thr Thr Thr Gly Thr Trp Glu Leu Ser Gly Thr Pro Thr
690 695 700
Leu Ala Asp Glu Gly Glu Gln Ser Phe Thr Phe Asn Leu Ser Asp Gly
705 710 715 720
Ile Lys Ser Ser Asn Ala Glu Ile Ile Ile Lys Val Ile Pro Thr Val
725 730 735
Lys Ile Glu Gly Glu Val Glu Ile Lys Ala Thr Ala Leu Thr Asn Tyr
740 745 750
Gly Ile Gly Thr Thr Ala Thr Met Val Ser Asp Val Gln Thr Ala Val
755 760 765
Asp Gly Lys Ala Thr Phe Lys Val Ala Ile Gln Val Thr Pro Pro Ala
770 775 780
Asp Lys Ala Val Ile Ser Gly Ile Ser Gly Gly Ser Ala Thr Glu Tyr
785 790 795 800
Ser Trp Gly Leu Gly Asp Gly Thr Asn Val Asn Thr Asp Tyr Ile Phe
805 810 815
Thr Gly Ser Asp Asn Glu Trp Val Glu Asn Ile Asn Asn Ile Gln Ile
820 825 830
Ile Asp Phe Asn Ala Asn Gly Gly Ser Leu Thr Lys Glu Ser Met Thr
835 840 845
Ala Phe Phe Lys Ser Val Thr Ile Val Asn Ala Gln Ser Ser Lys Asp
850 855 860
Tyr Val Ser Leu Lys Val Glu Gly Val Ile Ser Asn Pro Gly Lys Leu
865 870 875 880
Ala Asp Gln Ile Thr Ile Leu Asn Leu Lys Glu Ala Thr Gly Val Asp
885 890 895
Glu Ile Ser Ala Phe Ser Ile Gly Thr Gly Asn Thr Glu Thr Thr Asn
900 905 910
Lys Trp Ala Val Glu Gly Ile Ser Val Ala Ile Thr Tyr Asn Glu Asn
915 920 925
Thr Leu Ser Asn Lys Asp Phe Asn Val Thr Asp Arg Gln Glu Phe Ile
930 935 940
Leu Phe Pro Asn Pro Val Thr Thr His Ile Ser Phe Ile Ile Thr Pro
945 950 955 960
Gln Lys Thr Glu Ile Phe Asp Leu Thr Gly Lys Thr Leu Leu Thr Asp
965 970 975
Ile Ser Gly Asn Lys Thr Ile Asp Ile Ser Ser Leu Asn Lys Gly Met
980 985 990
Tyr Leu Ile Lys Val Gln Asn Glu Glu Gly Lys Leu Phe Phe Ser Lys
995 1000 1005
Phe Ile Lys Ile Lys Gln
1010
<210> 2
<211> 3045
<212> DNA
<213> Flavobacterium algicola
<400> 2
atgaatagta aacaaaatat atcgtataaa ttagataaga atttaatact aattattact 60
tgtgcttttt tatccatacc tactgtaaat gcacaagttc cagattccga acaaggatta 120
cgtgccggct ggctgcgtgg agcttgggga ctaaattgga agcctgaaaa cttttacaat 180
ggtaccatag aagatgtatc tattgcacct tatcttgaag aattaaagga tgttcgaaca 240
ttagattata ttcaagttca tttatctgaa tcaaatattt attcaccgtc acatagcgca 300
ccacatccgc ttttagaaag tttttggcaa gaagatacag atgaaagcgg aaatccaata 360
aatctaatag ttccacgggc ttcttcgggg gtagatcctt ttgaaagctg gcttaaagca 420
attaaaggag caggattaaa aaccatggta tatgttaatt cttataattt attagctcgt 480
gacccaacat ccatacctga tggttttcct gatgtatcta ctagatggat ggagtggtgt 540
gatactaatc ccgaggctca agcttttatc aatagccaat cttatcatat taaaggtgac 600
aacagacgtc gctatatgtt ttgttatgct gaatttgttc taaaagtgta tgctcaacgt 660
tatggagatt taattgatgc gtggggattc gattctgctg acaatgttat ggcagacgaa 720
tgcggagatg agcctaaatc ggatctttta gacgatcagc gtatctatga ggcttttgcc 780
aatgcgttac atactggaaa ttcaaatgct gctgttgcat tcaacaatag tgtaggaacg 840
gctgcagccc catttacaac tcctacttat tttgatgatt attgctttgg acatcctttt 900
gggggtgctg gaaatatggt tgaaacagag agtttgtata ctagaaattt tggaataccg 960
caacttatga atactacaaa tggatttccg tttagagatg atactagaga ttggaatgac 1020
aatgttgttg gacgtttttt tccaaaatta agtactactt cttggaatgc aggagcaaca 1080
ccttgtttaa cagatgaaca atttgtagaa tggaatagtg tgggtataat tgacgcaggc 1140
tccatacttt ggggtgcacc tcttttaaga aataatttaa ataattctcc tgtgctcacc 1200
cttcagcctt tagcattagc gcaattaaag ttattagatg cacatttaaa aatatctcaa 1260
tttactggat ctccggtttt cgccagacaa gaaacgattt tgccagcggt atatattggg 1320
caaagttata ctcataattt ggttgaaggt ttcgactttt gggattcaga ggaattgggt 1380
ataacaaata tttcttttga aggaattaaa ccatcttggc taaatgtcag tctaactgct 1440
gaaggagttt ggactataag tggaaatcca acagaaactg tacctcagga ttacacattt 1500
gaattaaaga ttgaggatgc tgatggatcg acaacaaggt cagtaaaatt gcaagttatt 1560
gaacatcctg cagattttat aaacccctta gatggaaccc ctatatggaa attgaaccct 1620
acagtacttg caaatgcagt ggcattaaaa gagtatagta gcctattaga attaggtgtc 1680
catttttatg attttgaaaa tgatccatta acaattaata tgatttctgg accaagttgg 1740
ctcagtttaa cggaggttgc cgagggaaat tggcgtttaa aaggaattcc atctgtaact 1800
gatgcaggcg taaacacatt caattttact gttagcgatg gcgttcattc ctcagaggca 1860
gaaattaaaa taacagtcga tcacgctggt gattttacag acttgggtga tggtacaccg 1920
gtttggtctt caaccacttt taatctagct gatggagaag tatcaactgc ctataactct 1980
attttgcaat tcggtattga tttttatgat tttgagggcg atgcgcttac gattacaaaa 2040
acagcaggag cgaattggct tacgatacag caaactacta caggtacttg ggaattaagt 2100
ggaactccaa ctcttgcaga tgagggcgaa cagtctttca ctttcaatct aagtgatggt 2160
attaaatcat caaacgctga aattattata aaggttatac caacagtaaa aattgaagga 2220
gaagttgaaa ttaaagcgac agcactaacc aattatggga ttggtacaac agcgacaatg 2280
gtgtctgatg ttcaaacagc agttgatgga aaagcaactt tcaaagtggc tatccaagta 2340
actccgccag cagataaagc agtaatctct ggtatatcgg gaggttcggc aacggaatat 2400
tcttggggtt taggtgatgg aacaaatgtg aatacagatt atatttttac aggaagcgat 2460
aatgaatggg tagagaatat aaataatatt caaattattg attttaatgc caatggaggt 2520
tcattaacta aagaaagtat gacagctttt tttaaatctg ttactattgt aaatgcgcaa 2580
tcttctaaag attatgtatc tctgaaggta gaaggtgtta tttcaaatcc tggaaaatta 2640
gcagatcaaa taacaatatt aaatttaaag gaagcaacgg gtgttgatga aataagtgca 2700
ttttctattg gtacaggaaa tactgaaacg acaaataaat gggctgtcga aggtatttct 2760
gtagcgataa cttacaatga aaatactctt tcaaataaag attttaatgt aactgataga 2820
caagagttta tactatttcc taaccctgta acaactcata tatcatttat cattacacct 2880
caaaaaactg aaatttttga tttgacaggt aaaacactgc ttacggatat ttctggaaat 2940
aaaacaatag atatttctag tttgaacaag ggcatgtatt taattaaagt acaaaacgaa 3000
gaagggaagt tgtttttttc taaattcata aaaataaaac aataa 3045
<210> 3
<211> 32
<212> DNA
<213> Artificial Sequence
<400> 3
cgaattcgag ctccgtcaag ttccagattc cg 32
<210> 4
<211> 37
<212> DNA
<213> Artificial Sequence
<400> 4
tcagtggtgg tggtggtggt gttgttttat ttttatg 37
Claims (10)
1. The amino acid sequence of the fucoidan degrading enzyme OUC-FaFcn1 is shown in SEQ ID NO.1.
2. The gene coding for the fucoidan-degrading enzyme OUC-FaFcn1 of claim 1, wherein the nucleotide sequence is shown in SEQ ID NO. 2.
3. The use of the fucoidan-degrading enzyme OUC-FaFcn1 of claim 1 for degrading fucoidan/making low molecular weight fucoidan sulfate.
4. A method for degrading fucoidan sulfate/preparing low molecular weight fucoidan sulfate is characterized in that: degrading fucoidan sulfate with the fucoidan sulfate-degrading enzyme OUC-FaFcn1 of claim 1 to obtain a low molecular weight fucoidan sulfate product.
5. The method of degrading fucoidan sulfate/preparing low molecular weight fucoidan sulfate according to claim 4, wherein the method comprises the steps of: the degradation conditions are as follows: the concentration of the fucosan sulfate is 0.1-0.3%, the enzyme adding amount is 0.02U, the temperature is 40-50 ℃, and the pH value is 8.0-9.0.
6. An enzyme preparation comprising the fucoidan-degrading enzyme OUC-FaFcn1 of claim 1.
7. Use of the enzyme preparation of claim 6 for the degradation/preparation of low molecular weight fucoidan sulfates.
8. A recombinant expression vector carrying the gene encoding the fucoidan-degrading enzyme OUC-FaFcn1 of claim 2.
9. A recombinant engineered bacterium having the gene encoding the fucoidan-degrading enzyme OUC-FaFcn1 of claim 2 inserted into its genome, and capable of expressing the fucoidan-degrading enzyme OUC-FaFcn 1.
10. The recombinant expression vector of claim 8 or the recombinant engineered bacterium of claim 9, for use in the preparation of fucoidan sulfate-degrading enzyme OUC-FaFcn 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111568039.XA CN114107260B (en) | 2021-12-21 | 2021-12-21 | Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111568039.XA CN114107260B (en) | 2021-12-21 | 2021-12-21 | Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114107260A true CN114107260A (en) | 2022-03-01 |
| CN114107260B CN114107260B (en) | 2022-11-11 |
Family
ID=80362326
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111568039.XA Active CN114107260B (en) | 2021-12-21 | 2021-12-21 | Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107260B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1582338A (en) * | 2001-09-05 | 2005-02-16 | 宝生物工程株式会社 | Sulfated fucogalactan digesting enzyme gene |
| CN105821061A (en) * | 2016-03-28 | 2016-08-03 | 山东洁晶集团股份有限公司 | Nucleotide sequence of encoded fucoidin glucoside hydrolase and application thereof |
| CN108531470A (en) * | 2017-11-01 | 2018-09-14 | 中国科学院过程工程研究所 | A kind of sulfuric acid fucoidin lyases TFLFM and its preparation method and application |
| CN112980815A (en) * | 2021-03-09 | 2021-06-18 | 中国海洋大学 | alpha-L-fucosidase OUCJdch-16 and application thereof |
-
2021
- 2021-12-21 CN CN202111568039.XA patent/CN114107260B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1582338A (en) * | 2001-09-05 | 2005-02-16 | 宝生物工程株式会社 | Sulfated fucogalactan digesting enzyme gene |
| CN105821061A (en) * | 2016-03-28 | 2016-08-03 | 山东洁晶集团股份有限公司 | Nucleotide sequence of encoded fucoidin glucoside hydrolase and application thereof |
| CN108531470A (en) * | 2017-11-01 | 2018-09-14 | 中国科学院过程工程研究所 | A kind of sulfuric acid fucoidin lyases TFLFM and its preparation method and application |
| CN112980815A (en) * | 2021-03-09 | 2021-06-18 | 中国海洋大学 | alpha-L-fucosidase OUCJdch-16 and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114107260B (en) | 2022-11-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109295043B (en) | Alginate lyase, and preparation method and application thereof | |
| CN113980937B (en) | Lambda-carrageenase OUC-G150-L7 and application thereof | |
| PH12015500661B1 (en) | Glucosyltransferase enzymes for production of glucan polymers | |
| CN114015675B (en) | Lambda-carrageenase OUC-LuV and application thereof | |
| EP3059309B1 (en) | Agarooligosaccharide hydrolase and method for producing 3,6-anhydro-l-galactose and galactose from agarose by using same | |
| CN112708609B (en) | Chitosanase OUC-CsnPa and application thereof | |
| CN114410611B (en) | Kunmu polysaccharide degrading enzyme OUC-BsLam26 and application thereof | |
| CN112725319B (en) | Alginate lyase FaAly7 with polyG substrate specificity and application thereof | |
| CN116024198B (en) | Application of lambda-carrageenan CglA-FFWV33 in preparation of lambda-carrageenan oligosaccharides | |
| CN114480350B (en) | Application of carrageenase in degrading kappa-carrageenan and furcellaran | |
| CN111187764B (en) | Deep-sea-derived chitosanase CSN5, and coding gene and application thereof | |
| CN109609485B (en) | Chitin deacetylase and application thereof | |
| CN114107260B (en) | Fucoidan sulfate degrading enzyme OUC-FaFcn1 and application thereof | |
| CN115820608B (en) | Lambda-carrageenan enzyme mutant OUC-CglA-DPQQ and application thereof | |
| CN114196655B (en) | Heat-resistant Kunmu polysaccharide degrading enzyme OUC-SaLam66 and application thereof | |
| CN114457057B (en) | Chitosan mutant and application thereof | |
| CN111849949B (en) | Mannuronic acid C-5 epimerase/alginate lyase coding gene, enzyme, preparation and application | |
| DK2582810T3 (en) | Ulvanlyase, method of producing it and uses thereof | |
| CN111471667B (en) | Chitosanase Csn-PT and application thereof | |
| CN104087604A (en) | Genetic expression sequence of inulin fructotransferase | |
| CN114507656B (en) | Method for preparing fucoidan rich in guluronic acid | |
| CN114908076B (en) | Algin lyase for directionally obtaining fucoidan trisaccharide product and application thereof | |
| CN113151223B (en) | Method for preparing kelp hydrolysate | |
| CN111979218B (en) | Arthrobacter sp. AW19M34-1 chitin deacetylase mutant | |
| CN112979819B (en) | Method for preparing kelp hydrolysate by using artificial enzyme |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |