CN114507656B - Method for preparing fucoidan rich in guluronic acid - Google Patents

Abstract

The invention provides a method for preparing fucoidan rich in guluronic acid, which comprises the steps of isomerizing mannuronic acid M in algin into guluronic acid G by using algin isomerase; and then the amino acid sequence is SEQ ID NO:1 to prepare the fucoidan by catalysis. The invention establishes a method for preparing the fucoidan rich in guluronic acid based on the screening to obtain a novel algin lyase, and the prepared fucoidan has definite structure and stable composition; has application prospect in the fields of medicine and the like.

Description

Method for preparing fucoidan rich in guluronic acid

Technical Field

The invention relates to a method for preparing fucoidan capable of being used for biological medicine from marine organisms, namely a method for preparing fucoidan rich in guluronic acid; belongs to the technical field of marine organism resource seaweed polysaccharide preparation.

Background

Algins are polysaccharides extracted from seaweed and are formed by connecting two sugar units, namely mannuronic acid (M) and guluronic acid (G), which are epimers to each other through beta-1, 4 glycosidic bonds. The degradation product brown alginate oligosaccharides have various biological activities such as antioxidation, bacteriostasis, anti-tumor, immunoregulation and the like, and have wide application prospects in the fields of innovative ocean medicines, special medical foods and the like.

A great deal of research shows that the activity of the brown alginate oligosaccharides is directly related to the structural composition, for example, brown alginate oligosaccharides with the polymerization degree of 5 are superior to those of other brown alginate oligosaccharides with the polymerization degree in the aspects of enhancing the antibacterial activity of macrophages and promoting the recovery of bone tumor patients. However, how to efficiently prepare the brown alginate oligosaccharides with definite structure and single polymerization degree is still a difficult problem, which results in few types and high price of the brown alginate oligosaccharides supplied in the market at present and is not beneficial to the rapid development of the industry chain of the brown alginate oligosaccharides. For example, the recommended daily dose of the brown alginate-derived oligosaccharide is calculated to be 10 mg/day/person according to experiments, however, the price of D-mannuronic acid pentasaccharide per 10mg is 650 yuan, and the high price greatly limits the wide application of the homogeneous brown alginate-derived oligosaccharide in the fields of medicines and the like.

At present, the main reasons of high preparation cost of the homogeneous oligosaccharides are complicated process, poor repeatability and difficult purification of products. The enzymatic hydrolysis method has the advantages of high catalytic efficiency, mild reaction conditions, environmental friendliness and high specificity, and is an important method for the industrialized development of the homogeneous brown alginate oligosaccharides in the future. There is therefore an urgent need for intensive research into algin-modifying enzymes useful for homogeneous oligosaccharide preparation. The uniformity of the brown alginate oligosaccharides relates to two aspects of chemical composition and polymerization degree.

Disclosure of Invention

The invention aims to provide a method for preparing fucoidan rich in guluronic acid, which can prepare high-purity fucoidan.

The invention provides an algin lyase, which comprises:

1) Protease with the amino acid sequence of SEQ ID NO. 1;

MKFKSLFCFILVCSFLLLGLAGCGSSSPTNEATSVDDETQMAQGNEPVTSDLAEDEPYQWINFDFSSPITLSAVHISFYDGDEDAIYFRFESSNDNKNWSTHLNTVNSTSKLEFETFNLDENVTARYFRLASLGTSNNNQTSIAEVTFSATNEQDTFAIPGLVEAEDYSAFYDSTAGNQGGEYRDDDVDIEQTSDITGNYNIDFITDGEWLAYPINVGSGGEYNAKLRVSSANGGGSIIIYVDDLEKGRLAVPATTQWETKNIQLGVLSSGEHTLKVLFTAGEFELNWIELSRATLKASTLDPNLPPSGNFDLSQWYLGAPIDDNADGKSDSISESQLAAGYEHPQWFYTADDGAMVFKVEIDAPKTSTNTSYSRSELREMLRAGDTSISTQGINKNNWVFSTYSSDDKNAAGGIDGELTATLKVDYVTTTGESSQVGRVIIGQIHAKDDEPARLYYRKLKDNSKGSIYLAHEPNGGNDQLYNMIGTSSSTAVDPVDGIELGEIFTYSIKVTGNTLLVTIMRDGKPDVTQSVDMSNSGYHTGYDQYMYFKAGVYNQNNTGDPSDYVQASFYRLFTSHN；

2) Substitution, deletion, addition of one or several amino acids in 1), protease derived from 1) having the enzymatic hydrolysis effect in 1);

the specific sequence of the gene for encoding the algin lyase is SEQ ID NO. 2;

ATGAAGTTTAAATCATTGTTTTGTTTTATCTTAGTTTGTAGTTTTTTGCTGTTAGGGCTAGCAGGCTGTGGCTCATCATCACCAACTAATGAGGCTACTTCAGTAGATGATGAAACGCAGATGGCACAAGGTAACGAACCTGTAACAAGTGACTTAGCAGAGGATGAACCTTATCAATGGATTAACTTTGATTTTTCATCGCCTATTACACTAAGTGCTGTGCATATTTCATTTTATGACGGTGACGAGGATGCAATTTATTTTAGATTCGAGTCATCTAATGACAATAAAAATTGGTCTACCCATCTGAATACAGTTAATTCAACGAGTAAGCTCGAATTTGAAACATTCAACTTAGATGAAAATGTAACTGCTCGTTATTTTAGATTAGCCAGCTTGGGTACTTCGAATAACAATCAAACAAGCATAGCGGAAGTTACATTTAGCGCAACCAATGAGCAAGACACTTTTGCTATACCTGGGTTAGTTGAGGCTGAAGATTATAGCGCTTTTTATGACTCAACTGCTGGGAATCAAGGTGGGGAATACCGCGATGATGATGTTGATATAGAGCAGACGTCTGATATCACAGGAAACTATAACATAGATTTTATTACCGATGGAGAGTGGTTAGCGTATCCTATTAACGTGGGCAGTGGTGGTGAGTATAATGCGAAGCTGCGTGTTTCTTCTGCTAATGGCGGTGGTTCAATTATTATTTATGTTGATGACCTAGAAAAAGGTCGCTTAGCAGTACCAGCAACAACACAATGGGAAACTAAAAATATTCAATTAGGTGTATTGTCATCCGGTGAGCATACGCTCAAGGTTTTATTTACAGCTGGTGAATTTGAACTTAATTGGATTGAGTTATCTAGGGCTACTTTAAAAGCATCGACGTTAGATCCGAATTTGCCACCTTCGGGTAATTTTGATTTGTCTCAGTGGTATTTAGGCGCACCCATTGATGACAATGCTGATGGTAAGTCTGATTCTATCTCAGAATCTCAGCTAGCAGCTGGTTATGAGCATCCTCAATGGTTTTATACTGCAGATGATGGGGCAATGGTTTTTAAGGTTGAGATTGATGCTCCAAAGACATCAACTAACACAAGCTATAGCCGTAGTGAACTACGCGAAATGCTTAGAGCGGGTGATACGAGTATCAGCACGCAGGGGATAAACAAAAATAACTGGGTATTTTCTACCTATTCGTCGGATGATAAAAATGCAGCTGGTGGCATTGACGGTGAATTAACAGCGACACTTAAAGTTGATTACGTAACTACAACTGGTGAAAGCTCTCAGGTTGGACGCGTTATTATTGGGCAAATTCATGCAAAAGACGATGAACCAGCGCGTCTGTATTACCGTAAATTAAAAGACAACAGCAAAGGCTCAATTTACCTAGCTCATGAACCTAATGGTGGAAATGATCAGCTTTATAACATGATCGGCACAAGTAGTAGCACAGCAGTTGATCCTGTTGATGGTATTGAACTTGGTGAAATCTTTACTTATTCCATAAAAGTAACTGGAAATACCTTGTTGGTTACTATTATGCGTGATGGTAAGCCTGATGTAACTCAATCAGTTGATATGAGCAATAGCGGGTATCATACCGGCTATGATCAATATATGTATTTTAAAGCAGGTGTATATAATCAAAATAATACTGGTGATCCAAGTGATTATGTACAAGCCTCATTCTATCGCTTATTTACTTCACATAATTAA。

the invention also provides a recombinant expression vector, wherein a nucleic acid fragment for encoding the algin lyase gene is inserted into the recombinant expression vector;

the invention also provides a recombinant engineering strain, which comprises the recombinant expression vector.

The invention also provides application of the algin lyase in preparing fucoidan.

The invention also provides a method for preparing the brown algae tetrasaccharide, which comprises the steps of isomerizing mannuronic acid (M) in the brown algae into guluronic acid (G) by using the algin isomerase; then the algin lyase is used for preparing the brown algae tetraose in a catalytic way;

the isomerase, which is specifically described as an embodiment of the present invention, is algin isomerase AlgE4 and/or AlgE6;

wherein the amino acid sequences of AlgE4 and AlgE6 are SEQ ID NO 3 and SEQ ID NO 4 respectively.

MDYNVKDFGALGDGVSDDRASIQAAIDAAYAAGGGTVYLPAGEYRVSAAGEPGDGCLMLKDGVYLAGAGMGETVIKLIDGSDQKITGMVRSAYGEETSNFGMRDLTLDGNRDNTSGKVDGWFNGYIPGGDGADRDVTIERVEVREMSGYGFDPHEQTINLTIRDSVAHDNGLDGFVADYLVDSVFENNVAYANDRHGFNVVTSTHDFVMTNNVAYGNGSSGLVVQRGLEDLALPSNILIDGGAYYDNAREGVLLKMTSDITLQNADIHGNGSSGVRVYGAQDVQILDNQIHDNAQAAAVPEVLLQSFDDTAGASGTYYTTLNTRIEGNTISGSANSTYGIQERNDGTDYSSLIDNDIAGVQQPIQLYGPHSTVSGEPGATPQQPSTGSDGEPLVGGDTDDQLQGGSGADRLDGGAGDDILDGGAGRDRLSGGAGADTFVFSAREDSYRTDTAVFNDLILDFEASEDRIDLSALGFSGLGDGYGGTLLLKTNAEGTRTYLKSFEADAEGRRFEVALDGDHTGDLSAANVVFAATGTTTELEVLGDSGTQAGAIV(SEQ ID NO:3)；

MDYNVKDFGALGDGVSDDRVAIQAAIDAAHAAGGGTVYLPPGEYRVSAAGEPSDGCLTLRDNVYLAGAGMGQTVIKLVDGSAQKITGIVRSPFGEETSNFGMRDLTLDGNRANTVDKVDGWFNGYAPGQPGADRNVTIERVEVREMSGYGFDPHEQTINLVLRDSVAHHNGLDGFVADYQIGGTFENNVAYANDRHGFNIVTSTNDFVMRNNVAYGNGGNGLVVQRGSENLAHPENILIDGGSYYDNGLEGVLVKMSNNVTVQNADIHGNGSSGVRVYGAQGVQILGNQIHDNAKTAVAPEVLLQSYDDTLGVSGNYYTTLNTRVEGNTITGSANSTYGVQERNDGTDFSSLVGNTINGVQEAAHLYGPNSTVSGTVSAPPQGTDGNDVLIGSDVGEQISGGAGDDRLDGGAGDDLLDGGAGRDRLTGGLGADTFRFALREDSHRSPLGTFSDLILDFDPSQDKIDVSALGFIGLGNGYAGTLAVSLSADGLRTYLKSYDADAQGRSFELALDGNHAATLSAGNIVFAAATPVDPSAEAQPIVGSDLDDQLHGTLLGEEISGGGGADQLYGYGGGDLLDGGAGRDRLTGGEGADTFRFALREDSHRSAAGTFSDLILDFDPTQDKLDVSALGFTGLGNGYAGTLAVSVSDDGTRTYLKSYETDAEGRSFEVSLQGNHAAALSADNILFATPVPVDPGVEGTPVVGSDLDDELHGTLGSEQILGGGGADQLYGYAGNDLLDGGAGRDKLSGGEGADTFRFALREDSHRSPLGTFGDRILDFDPSQDRIDVSALGFSGLGNGYAGSLAVSVSDDGTRTYLKSYEADAQGLSFEVALEGDHAAALSADNIVFAATDAAAAGELGVIGASGQPDDPAV(SEQ ID NO:4)。

The invention establishes a method for preparing the fucoidan rich in guluronic acid based on the screening to obtain a novel algin lyase, and the prepared fucoidan has definite structure and stable composition; has application prospect in the fields of medicine and the like.

Drawings

Fig. 1: schematic representation of algin lyase AlyPC1 domain;

fig. 2: alyPC1 multisequence alignment, wherein PA1167 is from Pseudomonas aeruginosa PAO (AAG 04556.1); A1-II' is from Sphingomonas sp.A1 (BAD 16656.1); alyA is from Klebsiella pneumoniae (AAA 25049.1); alyQ is from Persicobacter sp.CCB-QB2 (WP_ 053404615.1); algAT5, alyB from Vibrio spendidus OU02;

fig. 3: alyPC1 gene PCR amplification results, lane M:2000bp DNA marker; lane 1: amplified AlyPC1 gene fragment.

Fig. 4: alyPC1 protein purification results, lane M: protein marker; lane 1: the thalli are induced by IPTG; lane 2: ultrasonic AlyPC1 supernatant; lane 3: alyPC1 after protease digestion;

fig. 5: alyPC1 degradation process diagram for different substrates;

fig. 6: electropherograms after AlyE4, alyE6 purification, wherein lane 1: pGEX-6P-1-AlgE4; lane 2: pGEX-6P-1-AlgE6;

fig. 7: alyPC1 reacted with Al-E1 in TLC and HPLC analysis chart, wherein M in chart A is AOS (DP 2, DP 3) with known molecular weight; 1 is TLC analysis AlyPC1 and Al-E1 reaction products; FIG. B is a diagram of HPLC analysis of AlyPC1 and Al-E1 reaction products;

fig. 8: TLC (A) and HPLC (B) analysis of gel filtration sample composition.

Detailed Description

The novel algin lyase obtained by screening can specifically cleave G-enriched algin to generate fucoidan. The specific amino acid sequence is SEQ ID NO. 1. However, one of ordinary skill in the art can obtain a derivative protein which also has the effect of isomerizing mannuronic acid (M) to guluronic acid (G) by substitution, deletion, addition of one or several amino groups to the amino acid of SEQ ID NO. 1.

The specific nucleotide sequence of the gene for encoding the algin lyase is SEQ ID NO. 2; but may be other specific sequences encoding the above proteins.

The invention also provides a method for preparing the fucoidin rich in guluronic acid, which comprises the steps of isomerizing the fucoidin by using the fucoidin isomerase, then treating the fucoidin by using the fucoidin lyase obtained by screening, and purifying an enzymolysis product by a conventional fucoidin purifying method, such as a glue chromatography technology, thereby preparing the fucoidin rich in guluronic acid G.

The present invention will be described in detail with reference to the following examples and the accompanying drawings.

Example 1: screening and recombinant expression of novel algin lyase AlyPC1

1. Sequence and correlation analysis of algin lyase AlyPC1

The inventor screens and obtains a novel algin lyase AlyPC1, which has the effect of preferentially identifying poly G (polyguluronic acid), and the tetraose content in the product distribution is very high (more than 50 percent) at a specific time.

The novel algin lyase gene provided by the invention is named AlyPC1.AlyPC1 has 1737bp (SEQ ID NO: 2) cDNA encoding 578 amino acids (SEQ ID NO: 1).

The signal peptide of AlyPC1 was predicted via SignalP5.0 (https:// services. Healthcare. Dtu. Dk/services. SignalP-5.0), where the first 22 amino acids of AlyPC1 were signal peptides. The amino acid sequence from which the signal peptide was removed was predicted in SMART (letronic, khedkar, & Bork, 2021) and Pram (mix et al, 2021), as shown in FIG. 1, alyPC1 consisted of 3 domains, including two non-catalytic domains, F5_F8_type_C and CBM6, respectively, and a catalytic domain, the algin lyase of the PL7 family.

The AlyPC1 catalytic domain was aligned with the alginate lyase of the existing crystal structure in multiple sequences, as shown in FIG. 2, the homology of AlyPC1 catalytic domain with AlyA was only 58.5%. The protein sequence NCBI blast shows that the highest homology is 69%, which indicates that the algin lyase AlyPC1 of the invention is a novel algin lyase.

2. Preparation and Activity study of AlyPC1 enzyme

1) Construction of AlyPC1 prokaryotic expression System and protein purification

AlyPC1 was cloned using Pseudomonas sp.as a template, and the amplification primers were introduced with the cleavage sites BamHI and XhoI, respectively, the sequences of which are shown in Table 1. Firstly cloning AlyPC1 fragment, detecting by 1% agarose gel electrophoresis (figure 3), cloning correct fragment, and recovering gel to obtain PCR product with higher purity. Simultaneously extracting plasmid pET32a, carrying out enzyme digestion on the plasmid and the purified PCR product by utilizing BamHI and XhoI restriction enzymes, reacting for 20 hours at 37 ℃ as shown in a digestion system in a table 2a and a table 2b, purifying an enzyme section according to the specification of a purification kit after enzyme digestion, connecting the linear pET32a plasmid with the enzyme section by utilizing T4 ligase, converting the plasmid into E.coli.BL21 (DE 3), picking a monoclonal strain, carrying out sequencing analysis and preserving the strain in a refrigerator at-80 ℃.

Table 1: alyPC1 clone primer table

Note that: primers F and R have BamHI and XhoI cleavage sites, respectively

Table 2A: alyPC1 cleavage System Table

TABLE 2 Table of plasmid pET32a cleavage System

Activating strain with correct sequence, performing amplification culture, inoculating the activated strain into conical flask containing 1L of liquid LB culture medium according to 1% inoculum size, culturing at 37deg.C for about 1.5 hr, and measuring culture solution at OD ₆₀₀ Is sucked by (a)Collecting the value, waiting for OD ₆₀₀ 400. Mu.L of IPTG (final concentration 0.1 mM) was added to the medium at a value of 0.6-0.8. The culture was carried out at 16℃and 180rpm for 20 hours. The cells were collected by centrifugation at 3500g for 30min at 4 ℃. The cells were resuspended in 15mL of buffer (20 mM Tris-HCl,500mM NaCl,10mM imidazole), disrupted using a sonicator, followed by centrifugation at 12000g for 30min, and the supernatant was collected. Mixing the supernatant with balanced Ni-NTA agarose gel column, combining at 4deg.C for about 1 hr, washing the column with binding buffer, detecting the flowing out hetero protein with Coomassie brilliant blue until no hetero protein flows out, and performing enzyme digestion on the tag on AlyPC1 with protease, according to the target protein and protease 100:1, adding protease in proportion, carrying out enzyme digestion for 4 hours at 4 ℃, and after the enzyme digestion is finished, the target protein flows out along with a buffer solution, and samples are taken in each purification step for SDS-PSGE electrophoresis detection. As shown in FIG. 4, alyPC1 protein with higher purity (FIG. 4, lane 3, shows a single band) was obtained after Ni-NTA agarose gel purification, and the molecular weight was 61kDa, which matches the predicted molecular weight.

Example 2: substrate specificity Studies of AlyPC1 protease

The two substrates, poly M and poly G, were dissolved in 20mM Tris-HCl (pH 8.5) 200mM NaCl (substrate concentration is 2 mg/ml) and reacted in a 200. Mu.L reaction system containing 190. Mu.L of the substrate and 10. Mu.L (0.02 mg/ml) of the enzyme AlyPC1, and the change in the reaction at 235nm was detected in a 96 well plate at 30℃using a microplate reader (SYNERGY-H1, bio-tek).

The results are shown in fig. 5, and the results show that the novel algin lyase AlyCP1 obtained by screening of the invention can specifically degrade ployG substrates, and no degradation activity is detected on the PolyM substrates under the experimental conditions. The enzyme has strong substrate recognition specificity, and can further improve the content of G in degradation products.

Example 3: preparation of fucoidan rich in guluronic acid

1. Method for preparing polyG by isomerase method

Algin isomerase, also known as mannuronic acid C-5 epimerase, is an enzyme having the ability to catalyze the conversion of beta-D- (1, 4) -mannuronic acid to alpha-L- (1, 4) -guluronic acid by isomerization.

Algin isomerase Alg E4 (SEQ ID NO: 3) and Alg E6 (SEQ ID NO: 4) are used, substrates derived from marine kelp are selected, and the two isomerases are matched to obtain an algin sample with Gao Guluo uronic acid G content.

1. Recombinant expression of AlgE4 and AlgE6

AlgE4 (1662 bp) and AlgE6 (2625 bp) were synthesized by Shanghai Biotechnology, plasmid was constructed with vector pUC57, restriction sites were digested according to BamH I and Xho I restriction sites at both ends of the fragment, and E.coli BL21 (DE 3) was transformed with expression vector pGEX-6P-1 to construct prokaryotic expression vector.

Forward primer AlgE4 BamH I: CGGGATCCATGGATTACAACGTCAAGGATTTCG (V),

Reverse primer AlgE4 Xho I: CCCTCGAGCTAGACGATCGCCCCGGCCTG (V),

Forward primer AlgE6 BamH I: CGGGATCCATGGATTACAACGTCAAGGATTTCG (V),

Reverse primer AlgE6 Xho I: CCCTCGAGTCAGACGGCCGGATCGTCCG.

2. Purification of AlgE4 and AlgE6

0.5L LB liquid culture medium, 1% inoculation amount, culture at 37 ℃ to OD ₆₀₀ When reaching 0.4-0.6, IPTG was added to the medium to a final concentration of 0.2mM and expression was induced overnight at 16 ℃. The cells were collected by centrifugation at 3000g for 30min at 4℃and resuspended in 1 XPBS buffer, sonicated for 15min (sonicated for 2s at 4s,50% power) in an ice-water bath, and the mixture after disruption was centrifuged at 12 g for 30min at 4℃to collect the supernatant.

Purifying the target protein by using an affinity chromatography and on-column enzyme digestion method. And adding a proper amount of GST-Sepharose 4B gel filler into the chromatographic column, balancing the column by using 1 XPBS buffer solution, and fully combining the supernatant after ultrasonic treatment with the gel filler in an environment of 4 ℃. After the completion of the binding, the protein not bound to the gel filler was eluted, and the gel filler was washed by adding 40 times the filler volume of 1 XPBS buffer to remove the remaining protein and foreign protein not bound to the gel filler. A proper amount of 1 XPBS buffer and PreScission enzyme (the mass ratio of enzyme to target protein is about 1:80) were added to the gel pack, and the column was subjected to cleavage at 4℃for 3h. After the enzyme digestion reaction is completed, the effluent is collected, and the purified target protein is obtained, and the result is shown in figure 6. Wherein the pGEX-6P-1-AlgE4 protein is about 84kDa and the pGEX-6P-1-AlgE6 protein is about 116kDa. As can be seen from FIG. 6, specific bands were obtained at the expected target protein size after presision protease cleavage.

3. Isomerization reaction

The reaction buffer was 20mM Tris-HCl,20mM NaCl,pH 7.5, the substrate was 1% (m/v) algin 10mL, 1.5mL AlgE4 (0.23 mg/mL) and 0.5mL AlgE6 (0.94 mg/mL) added in advance and incubated on ice for 30min, the final concentration of Ca2+ in the reaction system was 1mM, the reaction was carried out at 37℃and 120rpm, and 0.9mL AlgE4 and 0.2mL AlgE6 were added at 21h, and 0.6mL AlgE4 and 0.2mL AlgE6 (AlgE4 concentration was 0.23mg/mL and AlgE6 concentration was 0.94 mg/mL) were added at 45 h. And heating the products with different reaction times at 100 ℃ for 5min to terminate the reaction, so as to detect the isomerism effect in the reaction process. And (3) centrifuging 12000g of the reacted algin sample for 10min, dialyzing for 2.5-3 h at room temperature, dialyzing the outer liquid into deionized water, and freeze-drying the sample after the dialysis is finished.

4. Detection of isomerization efficiency

Algin samples before and after the isomerization reaction were prepared as 20mL of 1mg/mL algin aqueous solution, respectively. The pH of the two algin solutions is respectively adjusted to 5.6 by HCl (1 mol/L,0.1 mol/L), and the algin solutions are placed in a water bath with the temperature of 100 ℃ for reaction for 1h; then HCl (1 mol/L,0.1 mol/L) is used for adjusting the pH value to 3.8, and the mixture is placed in a water bath at 100 ℃ for reaction for 30min; then NaOH (1 mol/L,0.1 mol/L) is used for regulating the pH value to 7-8, and the obtained sample solution is freeze-dried (48 h); the lyophilized sample was re-used with 99.9% D ₂ After O (1 mL) was dissolved, the solution was again freeze-dried (about 20 h). Taking 10mg of the obtained freeze-dried sample powder, using D ₂ O (1 mL) is dissolved and then TTHA (triethyltetramine hexaacetic acid, D) ₂ The O is prepared according to the concentration of 0.3mol/L, and the pH value is regulated to 5 to 5.5 by DCl or NaOD, and the solution is clear. ) A solution. Detection was performed on a BRUKER AVANCE III 400 nuclear magnetic resonance spectrometer. Temperature 353K was tested.

¹ H-NMR data calculation (specific data calculation method refers to the people's commonplace)And the result of the national medical industry standard YY/T1654-2019 tissue engineering medical appliance sodium alginate, wherein the content of G in the algin sample before isomerization reaction is 2.3 times of the content of M; after the isomerization reaction, the content of G in the algin sample is 4.8 times of the content of M, and the content of G is obviously increased, which indicates that the isomerization reaction converts part of M in algin into G, and the isomerization reaction has obvious effect.

2. Preparation and characterization of brown algae tetroses

1. Enzymatic hydrolysis for preparing brown algae tetraose

100mg of the isomerized algin solution is dissolved in 4mL of deionized water, and AlyPC1 protease with the concentration of 1.9mg/mL is added for 30min reaction. The degradation products were analyzed by TLC and HPLC, respectively, after the completion of the reaction.

1) TLC detection: taking a silica gel plate with proper size, uniformly spotting a sample to a position 1.5cm away from the lower end of the silica gel plate, then placing the silica gel plate in a chromatographic bar containing a developing agent (the developing agent is n-butanol, formic acid and water are added according to a ratio of 4:6:1 (v: v: v)), taking out the silica gel plate after the chromatographic liquid is developed to a position 1cm away from the uppermost end of the silica gel plate, placing the silica gel plate in a color developing agent to develop color for 10 seconds after the sample is dried, wherein the color developing agent contains diphenylamine (2 g), aniline (2 mL), acetone (100 mL), phosphoric acid (10 mL) and concentrated hydrochloric acid (1 mL), and baking for 10min at a high temperature (> 100 ℃), and observing the distribution of products.

2) HPLC detection

YMC-Pack ODS-AM 150x 4.6mmI.D. column was connected to an UltiMate 3000 system with an elution buffer of 5nm tetrabutylammonium bromide (TBAB) (A) and acetonitrile (B) at a flow rate of 1mL/min, the sample was subjected to an alcohol precipitation and then filtered through an organic filter (0.22. Mu.M), 5. Mu.L was taken for loading, elution was started from an isocratic elution of 20% B for 5min, and then from a 13min gradient of 20% to 45% B. The remaining compounds on the column were then washed with a gradient of 55% b over 7min, followed by elution with 90% b for 5min.

Results: combining the results of TLC and HPLC detection, the enzymatic hydrolysate was found to be a mixture of DP 4-based brown alginate oligosaccharides, with a DP4 ratio of about 50% (FIG. 7).

2. Fucoidan sample purification

The Bio-Gel P-2Gel column (column volume 500 ml) was connected to an ATKA pure protein purifier using 0.2M NH ₄ HCO ₃ As a flow property, the enzymatic hydrolysate was separated and purified at a flow rate of 0.7mL/min, and the elution peak was collected by detecting an absorption value at 235 nm. TLC and HPLC analysis of the purified samples gave AOS with > 95% purity.

3. NMR test and data analysis

Lyophilizing the obtained tetrasaccharide sample solution, and then using D ₂ O dissolved samples were examined on a BRUKER AVANCE III nuclear magnetic resonance spectrometer. The test temperature was 353K.

¹ H-NMR data calculation results show that in the obtained fucoidan, the content of guluronic acid G of the monosaccharide connected with delta (delta represents that the 4,5 position of alpha-L-guluronic acid or beta-D-mannuronic acid is subjected to beta-elimination due to enzymolysis of lyase, and unsaturated monosaccharide with conjugated double bond at the 4,5 position is generated) is 8 times of the content of mannuronic acid M; the content of guluronic acid G in the reducing end monosaccharide is 13.5 times of the content of mannuronic acid M; the content of guluronic acid G in the oligosaccharide after enzymolysis is obviously increased compared with the content of guluronic acid G in the used isomerization algin, and the result shows that the novel algin lyase AlyPC1 has important application and development prospects in the preparation of the fucoidan with the content of Gao Guluo uronic acid G.

Sequence listing

<110> university of ocean in China

<120> a method for preparing guluronic acid-rich fucoidan

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 578

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 1

Met Lys Phe Lys Ser Leu Phe Cys Phe Ile Leu Val Cys Ser Phe Leu

1 5 10 15

Leu Leu Gly Leu Ala Gly Cys Gly Ser Ser Ser Pro Thr Asn Glu Ala

20 25 30

Thr Ser Val Asp Asp Glu Thr Gln Met Ala Gln Gly Asn Glu Pro Val

35 40 45

Thr Ser Asp Leu Ala Glu Asp Glu Pro Tyr Gln Trp Ile Asn Phe Asp

50 55 60

Phe Ser Ser Pro Ile Thr Leu Ser Ala Val His Ile Ser Phe Tyr Asp

65 70 75 80

Gly Asp Glu Asp Ala Ile Tyr Phe Arg Phe Glu Ser Ser Asn Asp Asn

85 90 95

Lys Asn Trp Ser Thr His Leu Asn Thr Val Asn Ser Thr Ser Lys Leu

100 105 110

Glu Phe Glu Thr Phe Asn Leu Asp Glu Asn Val Thr Ala Arg Tyr Phe

115 120 125

Arg Leu Ala Ser Leu Gly Thr Ser Asn Asn Asn Gln Thr Ser Ile Ala

130 135 140

Glu Val Thr Phe Ser Ala Thr Asn Glu Gln Asp Thr Phe Ala Ile Pro

145 150 155 160

Gly Leu Val Glu Ala Glu Asp Tyr Ser Ala Phe Tyr Asp Ser Thr Ala

165 170 175

Gly Asn Gln Gly Gly Glu Tyr Arg Asp Asp Asp Val Asp Ile Glu Gln

180 185 190

Thr Ser Asp Ile Thr Gly Asn Tyr Asn Ile Asp Phe Ile Thr Asp Gly

195 200 205

Glu Trp Leu Ala Tyr Pro Ile Asn Val Gly Ser Gly Gly Glu Tyr Asn

210 215 220

Ala Lys Leu Arg Val Ser Ser Ala Asn Gly Gly Gly Ser Ile Ile Ile

225 230 235 240

Tyr Val Asp Asp Leu Glu Lys Gly Arg Leu Ala Val Pro Ala Thr Thr

245 250 255

Gln Trp Glu Thr Lys Asn Ile Gln Leu Gly Val Leu Ser Ser Gly Glu

260 265 270

His Thr Leu Lys Val Leu Phe Thr Ala Gly Glu Phe Glu Leu Asn Trp

275 280 285

Ile Glu Leu Ser Arg Ala Thr Leu Lys Ala Ser Thr Leu Asp Pro Asn

290 295 300

Leu Pro Pro Ser Gly Asn Phe Asp Leu Ser Gln Trp Tyr Leu Gly Ala

305 310 315 320

Pro Ile Asp Asp Asn Ala Asp Gly Lys Ser Asp Ser Ile Ser Glu Ser

325 330 335

Gln Leu Ala Ala Gly Tyr Glu His Pro Gln Trp Phe Tyr Thr Ala Asp

340 345 350

Asp Gly Ala Met Val Phe Lys Val Glu Ile Asp Ala Pro Lys Thr Ser

355 360 365

Thr Asn Thr Ser Tyr Ser Arg Ser Glu Leu Arg Glu Met Leu Arg Ala

370 375 380

Gly Asp Thr Ser Ile Ser Thr Gln Gly Ile Asn Lys Asn Asn Trp Val

385 390 395 400

Phe Ser Thr Tyr Ser Ser Asp Asp Lys Asn Ala Ala Gly Gly Ile Asp

405 410 415

Gly Glu Leu Thr Ala Thr Leu Lys Val Asp Tyr Val Thr Thr Thr Gly

420 425 430

Glu Ser Ser Gln Val Gly Arg Val Ile Ile Gly Gln Ile His Ala Lys

435 440 445

Asp Asp Glu Pro Ala Arg Leu Tyr Tyr Arg Lys Leu Lys Asp Asn Ser

450 455 460

Lys Gly Ser Ile Tyr Leu Ala His Glu Pro Asn Gly Gly Asn Asp Gln

465 470 475 480

Leu Tyr Asn Met Ile Gly Thr Ser Ser Ser Thr Ala Val Asp Pro Val

485 490 495

Asp Gly Ile Glu Leu Gly Glu Ile Phe Thr Tyr Ser Ile Lys Val Thr

500 505 510

Gly Asn Thr Leu Leu Val Thr Ile Met Arg Asp Gly Lys Pro Asp Val

515 520 525

Thr Gln Ser Val Asp Met Ser Asn Ser Gly Tyr His Thr Gly Tyr Asp

530 535 540

Gln Tyr Met Tyr Phe Lys Ala Gly Val Tyr Asn Gln Asn Asn Thr Gly

545 550 555 560

Asp Pro Ser Asp Tyr Val Gln Ala Ser Phe Tyr Arg Leu Phe Thr Ser

565 570 575

His Asn

<210> 2

<211> 1737

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgaagttta aatcattgtt ttgttttatc ttagtttgta gttttttgct gttagggcta 60

gcaggctgtg gctcatcatc accaactaat gaggctactt cagtagatga tgaaacgcag 120

atggcacaag gtaacgaacc tgtaacaagt gacttagcag aggatgaacc ttatcaatgg 180

attaactttg atttttcatc gcctattaca ctaagtgctg tgcatatttc attttatgac 240

ggtgacgagg atgcaattta ttttagattc gagtcatcta atgacaataa aaattggtct 300

acccatctga atacagttaa ttcaacgagt aagctcgaat ttgaaacatt caacttagat 360

gaaaatgtaa ctgctcgtta ttttagatta gccagcttgg gtacttcgaa taacaatcaa 420

acaagcatag cggaagttac atttagcgca accaatgagc aagacacttt tgctatacct 480

gggttagttg aggctgaaga ttatagcgct ttttatgact caactgctgg gaatcaaggt 540

ggggaatacc gcgatgatga tgttgatata gagcagacgt ctgatatcac aggaaactat 600

aacatagatt ttattaccga tggagagtgg ttagcgtatc ctattaacgt gggcagtggt 660

ggtgagtata atgcgaagct gcgtgtttct tctgctaatg gcggtggttc aattattatt 720

tatgttgatg acctagaaaa aggtcgctta gcagtaccag caacaacaca atgggaaact 780

aaaaatattc aattaggtgt attgtcatcc ggtgagcata cgctcaaggt tttatttaca 840

gctggtgaat ttgaacttaa ttggattgag ttatctaggg ctactttaaa agcatcgacg 900

ttagatccga atttgccacc ttcgggtaat tttgatttgt ctcagtggta tttaggcgca 960

cccattgatg acaatgctga tggtaagtct gattctatct cagaatctca gctagcagct 1020

ggttatgagc atcctcaatg gttttatact gcagatgatg gggcaatggt ttttaaggtt 1080

gagattgatg ctccaaagac atcaactaac acaagctata gccgtagtga actacgcgaa 1140

atgcttagag cgggtgatac gagtatcagc acgcagggga taaacaaaaa taactgggta 1200

ttttctacct attcgtcgga tgataaaaat gcagctggtg gcattgacgg tgaattaaca 1260

gcgacactta aagttgatta cgtaactaca actggtgaaa gctctcaggt tggacgcgtt 1320

attattgggc aaattcatgc aaaagacgat gaaccagcgc gtctgtatta ccgtaaatta 1380

aaagacaaca gcaaaggctc aatttaccta gctcatgaac ctaatggtgg aaatgatcag 1440

ctttataaca tgatcggcac aagtagtagc acagcagttg atcctgttga tggtattgaa 1500

cttggtgaaa tctttactta ttccataaaa gtaactggaa ataccttgtt ggttactatt 1560

atgcgtgatg gtaagcctga tgtaactcaa tcagttgata tgagcaatag cgggtatcat 1620

accggctatg atcaatatat gtattttaaa gcaggtgtat ataatcaaaa taatactggt 1680

gatccaagtg attatgtaca agcctcattc tatcgcttat ttacttcaca taattaa 1737

<210> 3

<211> 553

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 3

Met Asp Tyr Asn Val Lys Asp Phe Gly Ala Leu Gly Asp Gly Val Ser

1 5 10 15

Asp Asp Arg Ala Ser Ile Gln Ala Ala Ile Asp Ala Ala Tyr Ala Ala

20 25 30

Gly Gly Gly Thr Val Tyr Leu Pro Ala Gly Glu Tyr Arg Val Ser Ala

35 40 45

Ala Gly Glu Pro Gly Asp Gly Cys Leu Met Leu Lys Asp Gly Val Tyr

50 55 60

Leu Ala Gly Ala Gly Met Gly Glu Thr Val Ile Lys Leu Ile Asp Gly

65 70 75 80

Ser Asp Gln Lys Ile Thr Gly Met Val Arg Ser Ala Tyr Gly Glu Glu

85 90 95

Thr Ser Asn Phe Gly Met Arg Asp Leu Thr Leu Asp Gly Asn Arg Asp

100 105 110

Asn Thr Ser Gly Lys Val Asp Gly Trp Phe Asn Gly Tyr Ile Pro Gly

115 120 125

Gly Asp Gly Ala Asp Arg Asp Val Thr Ile Glu Arg Val Glu Val Arg

130 135 140

Glu Met Ser Gly Tyr Gly Phe Asp Pro His Glu Gln Thr Ile Asn Leu

145 150 155 160

Thr Ile Arg Asp Ser Val Ala His Asp Asn Gly Leu Asp Gly Phe Val

165 170 175

Ala Asp Tyr Leu Val Asp Ser Val Phe Glu Asn Asn Val Ala Tyr Ala

180 185 190

Asn Asp Arg His Gly Phe Asn Val Val Thr Ser Thr His Asp Phe Val

195 200 205

Met Thr Asn Asn Val Ala Tyr Gly Asn Gly Ser Ser Gly Leu Val Val

210 215 220

Gln Arg Gly Leu Glu Asp Leu Ala Leu Pro Ser Asn Ile Leu Ile Asp

225 230 235 240

Gly Gly Ala Tyr Tyr Asp Asn Ala Arg Glu Gly Val Leu Leu Lys Met

245 250 255

Thr Ser Asp Ile Thr Leu Gln Asn Ala Asp Ile His Gly Asn Gly Ser

260 265 270

Ser Gly Val Arg Val Tyr Gly Ala Gln Asp Val Gln Ile Leu Asp Asn

275 280 285

Gln Ile His Asp Asn Ala Gln Ala Ala Ala Val Pro Glu Val Leu Leu

290 295 300

Gln Ser Phe Asp Asp Thr Ala Gly Ala Ser Gly Thr Tyr Tyr Thr Thr

305 310 315 320

Leu Asn Thr Arg Ile Glu Gly Asn Thr Ile Ser Gly Ser Ala Asn Ser

325 330 335

Thr Tyr Gly Ile Gln Glu Arg Asn Asp Gly Thr Asp Tyr Ser Ser Leu

340 345 350

Ile Asp Asn Asp Ile Ala Gly Val Gln Gln Pro Ile Gln Leu Tyr Gly

355 360 365

Pro His Ser Thr Val Ser Gly Glu Pro Gly Ala Thr Pro Gln Gln Pro

370 375 380

Ser Thr Gly Ser Asp Gly Glu Pro Leu Val Gly Gly Asp Thr Asp Asp

385 390 395 400

Gln Leu Gln Gly Gly Ser Gly Ala Asp Arg Leu Asp Gly Gly Ala Gly

405 410 415

Asp Asp Ile Leu Asp Gly Gly Ala Gly Arg Asp Arg Leu Ser Gly Gly

420 425 430

Ala Gly Ala Asp Thr Phe Val Phe Ser Ala Arg Glu Asp Ser Tyr Arg

435 440 445

Thr Asp Thr Ala Val Phe Asn Asp Leu Ile Leu Asp Phe Glu Ala Ser

450 455 460

Glu Asp Arg Ile Asp Leu Ser Ala Leu Gly Phe Ser Gly Leu Gly Asp

465 470 475 480

Gly Tyr Gly Gly Thr Leu Leu Leu Lys Thr Asn Ala Glu Gly Thr Arg

485 490 495

Thr Tyr Leu Lys Ser Phe Glu Ala Asp Ala Glu Gly Arg Arg Phe Glu

500 505 510

Val Ala Leu Asp Gly Asp His Thr Gly Asp Leu Ser Ala Ala Asn Val

515 520 525

Val Phe Ala Ala Thr Gly Thr Thr Thr Glu Leu Glu Val Leu Gly Asp

530 535 540

Ser Gly Thr Gln Ala Gly Ala Ile Val

545 550

<210> 4

<211> 874

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Met Asp Tyr Asn Val Lys Asp Phe Gly Ala Leu Gly Asp Gly Val Ser

1 5 10 15

Asp Asp Arg Val Ala Ile Gln Ala Ala Ile Asp Ala Ala His Ala Ala

20 25 30

Gly Gly Gly Thr Val Tyr Leu Pro Pro Gly Glu Tyr Arg Val Ser Ala

35 40 45

Ala Gly Glu Pro Ser Asp Gly Cys Leu Thr Leu Arg Asp Asn Val Tyr

50 55 60

Leu Ala Gly Ala Gly Met Gly Gln Thr Val Ile Lys Leu Val Asp Gly

65 70 75 80

Ser Ala Gln Lys Ile Thr Gly Ile Val Arg Ser Pro Phe Gly Glu Glu

85 90 95

Thr Ser Asn Phe Gly Met Arg Asp Leu Thr Leu Asp Gly Asn Arg Ala

100 105 110

Asn Thr Val Asp Lys Val Asp Gly Trp Phe Asn Gly Tyr Ala Pro Gly

115 120 125

Gln Pro Gly Ala Asp Arg Asn Val Thr Ile Glu Arg Val Glu Val Arg

130 135 140

Glu Met Ser Gly Tyr Gly Phe Asp Pro His Glu Gln Thr Ile Asn Leu

145 150 155 160

Val Leu Arg Asp Ser Val Ala His His Asn Gly Leu Asp Gly Phe Val

165 170 175

Ala Asp Tyr Gln Ile Gly Gly Thr Phe Glu Asn Asn Val Ala Tyr Ala

180 185 190

Asn Asp Arg His Gly Phe Asn Ile Val Thr Ser Thr Asn Asp Phe Val

195 200 205

Met Arg Asn Asn Val Ala Tyr Gly Asn Gly Gly Asn Gly Leu Val Val

210 215 220

Gln Arg Gly Ser Glu Asn Leu Ala His Pro Glu Asn Ile Leu Ile Asp

225 230 235 240

Gly Gly Ser Tyr Tyr Asp Asn Gly Leu Glu Gly Val Leu Val Lys Met

245 250 255

Ser Asn Asn Val Thr Val Gln Asn Ala Asp Ile His Gly Asn Gly Ser

260 265 270

Ser Gly Val Arg Val Tyr Gly Ala Gln Gly Val Gln Ile Leu Gly Asn

275 280 285

Gln Ile His Asp Asn Ala Lys Thr Ala Val Ala Pro Glu Val Leu Leu

290 295 300

Gln Ser Tyr Asp Asp Thr Leu Gly Val Ser Gly Asn Tyr Tyr Thr Thr

305 310 315 320

Leu Asn Thr Arg Val Glu Gly Asn Thr Ile Thr Gly Ser Ala Asn Ser

325 330 335

Thr Tyr Gly Val Gln Glu Arg Asn Asp Gly Thr Asp Phe Ser Ser Leu

340 345 350

Val Gly Asn Thr Ile Asn Gly Val Gln Glu Ala Ala His Leu Tyr Gly

355 360 365

Pro Asn Ser Thr Val Ser Gly Thr Val Ser Ala Pro Pro Gln Gly Thr

370 375 380

Asp Gly Asn Asp Val Leu Ile Gly Ser Asp Val Gly Glu Gln Ile Ser

385 390 395 400

Gly Gly Ala Gly Asp Asp Arg Leu Asp Gly Gly Ala Gly Asp Asp Leu

405 410 415

Leu Asp Gly Gly Ala Gly Arg Asp Arg Leu Thr Gly Gly Leu Gly Ala

420 425 430

Asp Thr Phe Arg Phe Ala Leu Arg Glu Asp Ser His Arg Ser Pro Leu

435 440 445

Gly Thr Phe Ser Asp Leu Ile Leu Asp Phe Asp Pro Ser Gln Asp Lys

450 455 460

Ile Asp Val Ser Ala Leu Gly Phe Ile Gly Leu Gly Asn Gly Tyr Ala

465 470 475 480

Gly Thr Leu Ala Val Ser Leu Ser Ala Asp Gly Leu Arg Thr Tyr Leu

485 490 495

Lys Ser Tyr Asp Ala Asp Ala Gln Gly Arg Ser Phe Glu Leu Ala Leu

500 505 510

Asp Gly Asn His Ala Ala Thr Leu Ser Ala Gly Asn Ile Val Phe Ala

515 520 525

Ala Ala Thr Pro Val Asp Pro Ser Ala Glu Ala Gln Pro Ile Val Gly

530 535 540

Ser Asp Leu Asp Asp Gln Leu His Gly Thr Leu Leu Gly Glu Glu Ile

545 550 555 560

Ser Gly Gly Gly Gly Ala Asp Gln Leu Tyr Gly Tyr Gly Gly Gly Asp

565 570 575

Leu Leu Asp Gly Gly Ala Gly Arg Asp Arg Leu Thr Gly Gly Glu Gly

580 585 590

Ala Asp Thr Phe Arg Phe Ala Leu Arg Glu Asp Ser His Arg Ser Ala

595 600 605

Ala Gly Thr Phe Ser Asp Leu Ile Leu Asp Phe Asp Pro Thr Gln Asp

610 615 620

Lys Leu Asp Val Ser Ala Leu Gly Phe Thr Gly Leu Gly Asn Gly Tyr

625 630 635 640

Ala Gly Thr Leu Ala Val Ser Val Ser Asp Asp Gly Thr Arg Thr Tyr

645 650 655

Leu Lys Ser Tyr Glu Thr Asp Ala Glu Gly Arg Ser Phe Glu Val Ser

660 665 670

Leu Gln Gly Asn His Ala Ala Ala Leu Ser Ala Asp Asn Ile Leu Phe

675 680 685

Ala Thr Pro Val Pro Val Asp Pro Gly Val Glu Gly Thr Pro Val Val

690 695 700

Gly Ser Asp Leu Asp Asp Glu Leu His Gly Thr Leu Gly Ser Glu Gln

705 710 715 720

Ile Leu Gly Gly Gly Gly Ala Asp Gln Leu Tyr Gly Tyr Ala Gly Asn

725 730 735

Asp Leu Leu Asp Gly Gly Ala Gly Arg Asp Lys Leu Ser Gly Gly Glu

740 745 750

Gly Ala Asp Thr Phe Arg Phe Ala Leu Arg Glu Asp Ser His Arg Ser

755 760 765

Pro Leu Gly Thr Phe Gly Asp Arg Ile Leu Asp Phe Asp Pro Ser Gln

770 775 780

Asp Arg Ile Asp Val Ser Ala Leu Gly Phe Ser Gly Leu Gly Asn Gly

785 790 795 800

Tyr Ala Gly Ser Leu Ala Val Ser Val Ser Asp Asp Gly Thr Arg Thr

805 810 815

Tyr Leu Lys Ser Tyr Glu Ala Asp Ala Gln Gly Leu Ser Phe Glu Val

820 825 830

Ala Leu Glu Gly Asp His Ala Ala Ala Leu Ser Ala Asp Asn Ile Val

835 840 845

Phe Ala Ala Thr Asp Ala Ala Ala Ala Gly Glu Leu Gly Val Ile Gly

850 855 860

Ala Ser Gly Gln Pro Asp Asp Pro Ala Val

865 870

Claims (10)

1. The algin lyase is characterized in that the amino acid sequence of the algin lyase is SEQ ID NO. 1.

2. A gene encoding the algin lyase according to claim 1.

3. The gene according to claim 2, wherein the nucleotide sequence of the gene is SEQ ID NO. 2.

4. A recombinant expression vector into which the nucleic acid fragment of the gene of claim 2 has been inserted.

5. A recombinant engineering strain, which is characterized in that the recombinant engineering strain comprises the recombinant expression vector of claim 4.

6. The use of the algin lyase of claim 1 for preparing alginate oligosaccharides.

7. The use according to claim 6, wherein the brown alginate oligosaccharide is brown alginate.

8. A method for preparing fucoidan, which is characterized in that alginate isomerase is used to isomerize mannuronic acid in alginate into guluronic acid; the algin lyase of claim 1 is used for catalyzing and preparing the fucoidan.

9. The method of claim 8, wherein the algin isomerase has the amino acid sequence of SEQ ID NO. 3.

10. The method of claim 8, wherein the algin isomerase has the amino acid sequence of SEQ ID NO. 4.

Images