CN114107065B - Quinolone antibiotic degrading fungus at low temperature and application thereof - Google Patents
Quinolone antibiotic degrading fungus at low temperature and application thereof Download PDFInfo
- Publication number
- CN114107065B CN114107065B CN202111361219.0A CN202111361219A CN114107065B CN 114107065 B CN114107065 B CN 114107065B CN 202111361219 A CN202111361219 A CN 202111361219A CN 114107065 B CN114107065 B CN 114107065B
- Authority
- CN
- China
- Prior art keywords
- degrading
- enrofloxacin
- microorganism
- strain
- bacterial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/22—Organic substances containing halogen
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/26—Organic substances containing nitrogen or phosphorus
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/28—Organic substances containing oxygen, sulfur, selenium or tellurium, i.e. chalcogen
Abstract
The invention relates to the technical field of biological treatment of antibiotic pollution, relates to a degrading microorganism, and in particular relates to fungus of low-temperature degradable quinolone antibiotics and application thereof. The degrading microorganism is Geotrichum sp.which has been preserved in 2021, 7 and 22 days and has been preserved in China general microbiological culture Collection center, with a preservation number of CGMCC No.23069. The strain used in the invention has high efficiency for degrading enrofloxacin at low temperature.
Description
The invention relates to the technical field of biological treatment of antibiotic pollution, relates to a degrading microorganism, and in particular relates to fungus of low-temperature degradable quinolone antibiotics and application thereof.
Background
Quinolone antibiotics are a class of drugs commonly used by humans and animals. The compound has the characteristics of wide antibacterial spectrum, strong antibacterial activity, no cross drug resistance with other antibacterial drugs, small toxic and side effects and the like, and is widely applied to livestock and aquatic breeding industries, including the breeding of chickens, ducks, geese, pigs, cattle, sheep, fishes, shrimps, crabs and the like for disease prevention and treatment. Enrofloxacin is a kind of quinolone antibiotics, has the characteristics of broad antibacterial spectrum, strong bactericidal power, rapid action, wide in-vivo distribution, no cross resistance among other antibiotics and the like, has good effects of preventing and treating bacterial infection and mycoplasma diseases of livestock and poultry, is designated by China as a special medicine for animals, can be combined with bacterial DNA gyrase subunit A, inhibits enzyme cutting and connecting functions, prevents bacterial DNA replication, and has antibacterial action.
The total daily yield of antibiotics in China is about 21 ten thousand tons and the daily consumption is about 18 ten thousand tons, wherein the total daily yield of antibiotics in livestock and feed industries is as high as 9.7 ten thousand tons, which accounts for about 54 percent. After the antibiotics enter the animal body, a small part of antibiotics are accumulated in the products such as tissues, organs, egg milk and the like in the form of raw materials or metabolites, and the other parts of antibiotics are discharged along with excrement such as excrement, urine and the like in the form of raw materials or metabolites. The generally high antibiotic content of these excreted animal manure has become an important source of antibiotic contamination in the environment. Quinolone antibiotics with the annual energy of more than 350t are used in livestock and poultry raising industry in China, and the quinolone substances are obviously adsorbed on the solid phase medium, so that residues in the environment are not easy to degrade naturally, and the quinolone antibiotics have durability.
Antibiotics enter the soil environment to undergo migration and transformation, so that different degrees of influence on the growth and development and reproduction of plants, soil animals and microorganisms are caused, and the abundance of resistant bacteria and resistant genes is induced to be increased, so that potential threat to human health is caused along with food chains. Degradation generally reduces the efficacy of quinolone antibiotics after they are introduced into the environment, but some metabolites of quinolone antibiotics are of the same or even greater toxicity than the antibiotic parent and may be converted to the antibiotic drug substance.
In recent years, researchers have explored various methods such as electrochemical oxidation, advanced oxidation, photodegradation, material adsorption, and biodegradation methods to remove antibiotic contamination in the environment. The biodegradation method has received a great deal of attention as an environmentally friendly and effective antibiotic removal method, and microorganisms play an important role in the biodegradation of environmental pollutants. Most of researches at present focus on bacterial degradation antibiotics at normal temperature, and few researches on fungus degradation antibiotics at low temperature are carried out, so that the research provides fungus capable of degrading quinolone antibiotics at low temperature, and provides a research foundation for degradation of antibiotics at low temperature.
Disclosure of Invention
The invention aims to break through the low-temperature obstacle and provides fungus of low-temperature degradable quinolone antibiotics and application thereof.
In order to achieve the above purpose, the invention adopts the technical scheme that:
a strain of degrading microorganism is Geotrichum sp.which has been preserved in 2021, 7 and 22 days and China general microbiological culture collection center (CGMCC) No.23069.
The application of the degradation microorganism in degradation of quinolone antibiotics.
The application of the degradation microorganism in degrading quinolone antibiotics at the temperature of 5-15 ℃.
A degradation bacteria preparation contains the degradation microorganism.
The preparation is a bacterial suspension containing degrading microorganisms.
The bacterial suspension is obtained by eluting spores of Geotrichum sp of Geotrichum with sterile water, and collecting spore suspension.
A degrading bacterial formulation, the use of said formulation for degrading quinolone antibiotics.
The application of the degradation microorganism in degrading quinolone antibiotics at the temperature of 5-15 ℃.
The degrading microorganism is applied to degrading enrofloxacin at the temperature of 5-15 ℃.
Compared with the prior art, the invention has the following technical effects:
the invention screens a fungus which can efficiently degrade enrofloxacin at low temperature, and the fungus is identified as Geotrichum sp (Geotrichum) by ITS sequence analysis and is named EZ-8. The preservation number is CGMCC No.23069. The strain used in the invention has high efficiency for degrading enrofloxacin, the initial content of enrofloxacin is 20mg/L, the degradation rate of the strain 20d reaches 67.7% at 15 ℃, and the degradation rate is about 32% higher than that of the strain without adding bacteria; the degradation rate of the strain 20d reaches 59.3 percent at the temperature of 10 ℃, which is about 30 percent higher than that of the blank non-added bacteria; at the temperature of 5 ℃, the degradation rate of the strain 20d reaches 56.5 percent, which is about 27 percent higher than that of the blank non-added bacteria. The invention provides an effective biological way for removing enrofloxacin in the environment.
Drawings
FIG. 1 is a colony morphology of strain EZ-8 provided in an example of the present invention;
FIG. 2 shows the quantitative determination result of HPLC-MS/MS of enrofloxacin degradation by strain EZ-8 at 5℃provided in the examples of the present invention.
FIG. 3 shows the quantitative determination result of HPLC-MS/MS of enrofloxacin degradation by strain EZ-8 at 10℃provided in the examples of the present invention.
FIG. 4 shows the quantitative determination result of HPLC-MS/MS of enrofloxacin degradation by strain EZ-8 at 15℃provided in the examples of the present invention.
Detailed Description
The following description of the embodiments of the present invention is further provided in connection with the accompanying examples, and it should be noted that the embodiments described herein are for the purpose of illustration and explanation only, and are not limiting of the invention.
The drawings of the present invention are only for the purpose of combining the disclosure of the specification, and are not intended to limit the applicable limitations of the present invention, so that any structural modification, proportional changes, or size adjustment should fall within the scope of the disclosure without affecting the efficacy and achievement of the present invention.
The high performance liquid chromatography-tandem mass spectrometry determination method of the invention comprises the following steps: high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) quantitatively analyzes the concentration of enrofloxacin. Atlantis T3 chromatographic column (3 μm, 2.1X105 mm), column temperature is 30deg.C, mobile phase is composed of 98% (v/v) ammonium acetate+0.1% formic acid water solution (A) and 2% (v/v) acetonitrile (B), sample injection speed is 0.4ml/min, and sample injection amount is 10 μl.
The test methods for specific experimental conditions are not noted in the examples below, and are generally performed under conventional experimental conditions or under experimental conditions recommended by the manufacturer. The materials, reagents and the like used, unless otherwise specified, are those obtained commercially.
The apparatus employed in the present invention is conventional in the art, unless otherwise specified.
The preparation method of the culture medium used in the following examples of the invention is as follows:
1. enrichment medium: (NH) 4 ) 2 SO 4 2.0g；K 2 HPO 4 0.5g；NaH 2 PO 4 0.5g; pH 7.0-7.4; 1000ml of distilled water, adjusting the pH to 7.0-7.4, and sterilizing at 121 ℃ for 20min.
Pda medium: 200g of potato, 20g of glucose, 15-20 g of agar, 1000ml of distilled water and natural PH.
3. Common liquid medium: glucose 10g, ammonium tartrate 0.2g, KH 2 PO 4 2g,MgSO 4 ·7H 2 O 0.75g,CaCl 2 0.1g，CuSO 4 0.064mg, vitamin B 1 2mg, tween 801g, distilled water 1L, trace element solution 20ml,20mM tartaric acid buffer solution to adjust pH to 4.5, and sterilizing at 115℃for 30min.
4. Trace element solution: mgSO (MgSO) 4 3g,MnSO 4 0.5g,NaCl 1.0g,FeSO 4 ·7H 2 O 0.1g,CoCl 2 0.1g，ZnSO 4 ·7H 2 O 0.1g,Alk(SO 4 ) 2 ·2H 2 O 10mg,H 3 BO 3 10mg,Na 2 MoO 4 ·2H 2 O10 mg, distilled water 1L.
Example 1: isolation of Geotrichum sp
Is obtained from the soil of a livestock farm in a new area of Shenyang, shenbei province of Liaoning through enrichment, separation and purification, and specifically comprises the following steps:
step one: enrichment of strains
Adding 5g of polluted soil into an enrichment medium containing enrofloxacin with the concentration of 20mg/L, placing the enrichment medium into a shaking table at 15 ℃ for dark culture, inoculating the culture solution into a common medium containing enrofloxacin with the concentration of 50mg/L according to the inoculation amount of 10% after 7d, culturing for 7d under the condition that other conditions are unchanged, and repeating the above operation steps until the enrofloxacin concentration in the enrichment medium is increased by 30mg/L each time until the final concentration of enrofloxacin in the enrichment medium is 200mg/L;
step two: isolation and purification of strains
After enrichment is finished, taking and culturing200 mu L of sterile water is added according to 10 0 、10 -1 、10 -2 、10 -3 Performing gradient dilution, separating the diluted bacterial solutions with different concentrations by adopting a flat plate coating method, picking single bacterial colonies with different bacterial colony morphology and appearance, further separating and purifying by streaking on a PDA solid culture medium according to a conventional mode, picking single bacterial colonies after separating and purifying, inoculating to an inclined plane, numbering and storing;
step three: screening of degradation strains
The separated single strains are inoculated into a common liquid culture medium containing 20mg/L enrofloxacin according to the inoculation amount of 10 percent, shake culture is carried out for 30 days in a shaking table at 15 ℃ and 160rpm, the residual concentration of enrofloxacin is quantitatively detected by using a high performance liquid chromatography-tandem mass spectrometry method, the strain with the enrofloxacin degradation capability is obtained, and the strain with the strongest degradation capability is named EZ-8.
High performance liquid chromatography-tandem mass spectrometry determination method
High performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) quantitatively analyzes the concentration of enrofloxacin. Atlantis T3 chromatographic column (3 μm, 2.1X105 mm), column temperature is 30deg.C, mobile phase is composed of 98% (v/v) ammonium acetate+0.1% formic acid water solution (A) and 2% (v/v) acetonitrile (B), sample injection speed is 0.4ml/min, and sample injection amount is 10 μl.
The strain has degradation effect on enrofloxacin at low temperature and has the following characteristics:
the purified EZ-8 strain was inoculated on PDA solid medium and cultured at 28℃for 7d, and the colony was white powdery and viscous in texture as shown in FIG. 1.
Example 2: identification of Geotrichum sp
(1) Genome extraction
Genomic DNA of strain EZ-8 was extracted according to the protocol using a rapid extraction kit (cat# B518229-0050) for fungal genomic DNA from the division of biological engineering (Shanghai).
(2) PCR amplification
The ITS universal primer is ITS1:5'-TCCGTAGGTGAACCTGCGG-3'; the ITS4:5'-TCCTCCGCTTATTGATATGC-3', PCR has a length of about 400 bp.
PCR reaction system:
PCR reaction parameters:
pre-denaturation at 95℃for 4min, deformation at 94℃for 30s, renaturation at 57℃for 30s, extension at 72℃for 40s, and extension at 72℃for 7min, for a total of 35 cycles.
(3) Gel electrophoresis
Finally, the obtained PCR product was visualized by electrophoresis with 1% agarose gel at 80V for 30min. And (3) delivering the amplified PCR product to Huada gene technology Co.Ltd for sequencing, wherein the sequencing primer is identical with the amplification primer. The nucleotide sequence of the ITS gene of strain EZ-8 was obtained, and the nucleotide sequence of the ITS gene of strain EZ-8 was shown below.
Bacterial strain EZ-8 gene sequence table
GACCTGCGGAAGGATCATTATGAATTATAAATATTTGTGAATTTACCACAGCAAACAAAA 60
ATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCGTA 120
TCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGT 180
TTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTT 240
CTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACA 300
CTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAAGCATATCAATA 353
The above sequence consists of 353 bases (bp). The measured ITS gene sequences are subjected to BLAST search comparison on the National Center for Biological Information (NCBI) website to obtain strains with higher similarity, and analysis results show that the strain EZ-8 is identified as Geotrichum.
The strain EZ-8 fungus is Geotrichum sp.Desmodium, which has been preserved in 2021, 7 and 22 days and has been preserved in China general microbiological culture Collection center, with a preservation number of CGMCC No.23069, address: beijing, chaoyang area, north Chen Xili No. 1, 3, china academy of sciences, microbiological institute.
Example 3: EZ-8 verification of degradation effect of enrofloxacin
Eluting EZ-8 strain spores with sterile water, filtering with warp cloth, and diluting with sterile water to obtain 1×10 6 cfu·mL -1 Is a bacterial suspension of (a).
Then inoculating the strain to the strain containing 20 mg.L according to the 10% inoculum size -1 In the liquid culture medium of enrofloxacin, 3 parallel culture is set, and the culture is respectively carried out at 5 ℃, 10 ℃ and 15 ℃ and 160rpm in shaking light-proof mode, and no bacteria are used as blank control. After the obtained culture broth was sonicated, hyphae were filtered with filter paper, the supernatant was filtered with a 0.22 μm microfilm, and the filtered supernatant was subjected to quantitative detection of enrofloxacin by high performance liquid chromatography tandem mass spectrometry (see fig. 2-4).
The calculation formula is as follows:
the result shows that in the culture medium without EZ-8 strain, the degradation rate of enrofloxacin is 29.5 percent, and in the culture medium with EZ-8 strain, the degradation rate of enrofloxacin is 56.5 percent at the temperature of 5 ℃ for 20 d; in a culture medium without EZ-8 strain, the degradation rate of enrofloxacin is 30.8 percent when the culture medium is 20d at 10 ℃, and in the culture medium with EZ-8 strain, the degradation rate of enrofloxacin is 59.3 percent; in the culture medium without EZ-8 strain, the degradation rate of enrofloxacin is 35.3 percent at 15 ℃ for 20d, and in the culture medium with EZ-8 strain, the degradation rate of enrofloxacin is 67.7 percent.
The foregoing embodiments have been provided for the purpose of illustrating the general principles of the present invention and are not meant to limit the invention thereto, but to limit the invention thereto, and any modifications, equivalents, improvements and alternatives falling within the spirit and principles of the present invention should be included in the scope of the present invention.
The preferred embodiments of the present disclosure have been described in detail above with reference to the accompanying drawings, but the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solutions of the present disclosure within the scope of the technical concept of the present disclosure, and all the simple modifications belong to the protection scope of the present disclosure.
In addition, the specific features described in the foregoing embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, the present disclosure does not further describe various possible combinations.
Moreover, any combination of the various embodiments of the present disclosure may be made without departing from the spirit of the present disclosure, which should also be considered as the subject matter of the invention of the present disclosure.
Sequence listing
<110> Shenyang applied ecological institute of academy of sciences in China
<120> quinolone antibiotic degrading fungus at low temperature and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 353
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gacctgcgga aggatcatta tgaattataa atatttgtga atttaccaca gcaaacaaaa 60
atcatacaat caaaacaaaa ataattaaaa cttttaacaa tggatctctt ggttctcgta 120
tcgatgaaga acgcagcgaa acgcgatatt tcttgtgaat tgcagaagtg aatcatcagt 180
ttttgaacgc acattgcact ttggggtatc ccccaaagta tacttgtttg agcgttgttt 240
ctctcttgga attgctttgc tcttctaaaa tttcgaatca aattcgtttg aaaaacaaca 300
ctattcaacc tcagatcaag taggattacc cgctgaactt aagcatatca ata 353
Claims (8)
1. An enrofloxacin degrading microorganism, which is characterized in that: the degrading microorganism is Geotrichum sp.which is preserved in China general microbiological culture Collection center (CGMCC) with the preservation number of 23069 in the year 7 and 22 of 2021.
2. Use of a degrading microorganism according to claim 1, characterized in that: the application of the degrading microorganism in degrading enrofloxacin.
3. Use of a degrading microorganism according to claim 2, characterized in that: the degrading microorganism is applied to degrading enrofloxacin at the temperature of 5-15 ℃.
4. A degrading bacteria preparation, which is characterized in that: the degrading bacterium preparation comprising the degrading microorganism according to claim 1.
5. The degrading bacterial preparation according to claim 4, wherein: the degrading bacteria preparation is a bacterial suspension containing degrading microorganisms.
6. The degrading bacterial preparation according to claim 5, wherein: the bacterial suspension is obtained by eluting spores of Geotrichum sp. Geotrichum of claim 1 with sterile water, and collecting spore suspension.
7. The use of the degrading bacterial preparation according to claim 4, wherein: the application of the degrading bacteria preparation in degrading enrofloxacin.
8. The use according to claim 7, wherein: the degrading bacteria preparation is applied to degrading enrofloxacin at the temperature of 5-15 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111361219.0A CN114107065B (en) | 2021-11-17 | 2021-11-17 | Quinolone antibiotic degrading fungus at low temperature and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111361219.0A CN114107065B (en) | 2021-11-17 | 2021-11-17 | Quinolone antibiotic degrading fungus at low temperature and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114107065A CN114107065A (en) | 2022-03-01 |
| CN114107065B true CN114107065B (en) | 2023-07-25 |
Family
ID=80396924
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111361219.0A Active CN114107065B (en) | 2021-11-17 | 2021-11-17 | Quinolone antibiotic degrading fungus at low temperature and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107065B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115404186B (en) * | 2022-09-09 | 2024-01-26 | 中国科学院沈阳应用生态研究所 | Low-temperature degradation strain for degrading enrofloxacin and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929442A (en) * | 2017-02-24 | 2017-07-07 | 暨南大学 | One plant of carbostyril antibiotic degradation bacteria and its application |
| CN110591948A (en) * | 2019-09-20 | 2019-12-20 | 广东省农业科学院农业资源与环境研究所 | Compound microbial agent for degrading quinolone antibiotics and preparation method and application thereof |
-
2021
- 2021-11-17 CN CN202111361219.0A patent/CN114107065B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929442A (en) * | 2017-02-24 | 2017-07-07 | 暨南大学 | One plant of carbostyril antibiotic degradation bacteria and its application |
| CN110591948A (en) * | 2019-09-20 | 2019-12-20 | 广东省农业科学院农业资源与环境研究所 | Compound microbial agent for degrading quinolone antibiotics and preparation method and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114107065A (en) | 2022-03-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107090418B (en) | One strain denitrogen paracoccus and its application in livestock and poultry farm wastewater treatment | |
| CN110591988B (en) | Lactobacillus rhamnosus753 and application thereof, silage additive and silage | |
| CN111187726A (en) | Rice blast bactericide prepared by using lysine-resistant bacillus borreliensis as chassis cells | |
| CN109897804B (en) | Zoebelia with nitrification and denitrification functions and application thereof | |
| CN113278550B (en) | Bacillus coagulans for improving intestinal degradation of aflatoxin zearalenone | |
| CN106957805B (en) | Bacillus GBacilus-9 strain with bacteriostatic effect and separation method and application thereof | |
| CN114921385B (en) | Bacillus subtilis and application thereof in feed addition and antibiotic-free cultivation | |
| CN111808765B (en) | Bacillus subtilis capable of efficiently degrading vomitoxin and application thereof | |
| CN110951657A (en) | Bacterial wilt preventing and growth promoting microbial inoculum and application thereof | |
| CN110878265A (en) | Bacillus subtilis for degrading aflatoxin and application thereof | |
| CN107502566B (en) | Lysine bacillus and application thereof in degradation of zearalenone | |
| CN114107065B (en) | Quinolone antibiotic degrading fungus at low temperature and application thereof | |
| CN112608868A (en) | Bacillus altitudinis and application thereof | |
| CN113308413B (en) | Fluoroquinolone antibiotic degrading bacterium and application thereof in compost | |
| CN107603901A (en) | A kind of bacillus subtilis for producing aflatoxin B1 digestive enzyme and its application | |
| CN114410514B (en) | Bacillus stereiensis and application thereof | |
| CN114437964B (en) | Bacillus belicus strain and application thereof | |
| CN116144522A (en) | Paenibacillus pumilus and application thereof in preventing and treating white rot of grape | |
| CN114717140A (en) | Bacillus licheniformis and application thereof | |
| CN110484463B (en) | Bacillus mojavensis B282 and application thereof | |
| CN112795501A (en) | Bacillus beiLeisi D2406 separated from stratiomyiid intestinal tract and application thereof | |
| CN114621885A (en) | Bacillus subtilis for efficiently removing ammoniacal nitrogen and nitrite nitrogen and application thereof in aquaculture | |
| CN114703069B (en) | Epicoccus nigrum fermentation product, preparation method and application thereof | |
| CN108004181A (en) | One plant of Methylotrophic bacillus and its culture and application | |
| CN113980857B (en) | Tetracycline antibiotic degrading bacteria at low temperature and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |