CN114107065A - Quinolone antibiotic degrading fungus at low temperature and application thereof - Google Patents
Quinolone antibiotic degrading fungus at low temperature and application thereof Download PDFInfo
- Publication number
- CN114107065A CN114107065A CN202111361219.0A CN202111361219A CN114107065A CN 114107065 A CN114107065 A CN 114107065A CN 202111361219 A CN202111361219 A CN 202111361219A CN 114107065 A CN114107065 A CN 114107065A
- Authority
- CN
- China
- Prior art keywords
- degrading
- strain
- enrofloxacin
- microorganism
- low temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D3/00—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances
- A62D3/02—Processes for making harmful chemical substances harmless or less harmful, by effecting a chemical change in the substances by biological methods, i.e. processes using enzymes or microorganisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/22—Organic substances containing halogen
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/26—Organic substances containing nitrogen or phosphorus
-
- A—HUMAN NECESSITIES
- A62—LIFE-SAVING; FIRE-FIGHTING
- A62D—CHEMICAL MEANS FOR EXTINGUISHING FIRES OR FOR COMBATING OR PROTECTING AGAINST HARMFUL CHEMICAL AGENTS; CHEMICAL MATERIALS FOR USE IN BREATHING APPARATUS
- A62D2101/00—Harmful chemical substances made harmless, or less harmful, by effecting chemical change
- A62D2101/20—Organic substances
- A62D2101/28—Organic substances containing oxygen, sulfur, selenium or tellurium, i.e. chalcogen
Abstract
The invention relates to the technical field of antibiotic pollution treatment by a biological method, relates to a degrading microorganism, and particularly relates to a fungus capable of degrading quinolone antibiotics at a low temperature and application thereof. The degrading microorganism is Geotrichum sp, which is preserved in 22.7.2021 and China general microbiological culture Collection center with the preservation number of CGMCC No. 23069. The strain provided by the invention has high efficiency for degrading enrofloxacin at low temperature.
Description
The invention relates to the technical field of antibiotic pollution treatment by a biological method, relates to a degrading microorganism, and particularly relates to a fungus capable of degrading quinolone antibiotics at a low temperature and application thereof.
Background
Quinolone antibiotics are a class of drugs commonly used by humans and animals. The antibacterial agent has the characteristics of wide antibacterial spectrum, strong antibacterial activity, no cross drug resistance with other antibacterial drugs, small toxic and side effects and the like, and is widely applied to livestock breeding, aquatic product breeding and other breeding industries, including disease control in breeding of chickens, ducks, geese, pigs, cattle, sheep, fish, shrimps, crabs and the like. Enrofloxacin is one of quinolone antibiotics, has the characteristics of wide antibacterial spectrum, strong bactericidal power, quick action, wide in-vivo distribution, no cross drug resistance with other antibiotics and the like, has good effects of preventing and treating bacterial infection and mycoplasmosis of livestock and poultry, is specified as a special animal drug by the nation, can be combined with a bacterial DNA gyrase subunit A, thereby inhibiting the cutting and connecting functions of enzyme, preventing the replication of bacterial DNA and showing an antibacterial effect.
According to statistics, the total annual domestic antibiotic yield is about 21 ten thousand tons, the domestic consumption is about 18 ten thousand tons, and the antibiotic used in livestock raising and feed industries is up to 9.7 ten thousand tons and accounts for about 54 percent. After the antibiotics enter an animal body, a small part of the antibiotics are accumulated in tissues, organs, egg, milk and other products in the form of original forms or metabolites, and a considerable part of the antibiotics are discharged along with excrement, urine and other excrement in the form of original forms or metabolites. The antibiotic content in the discharged animal feces is generally high, and the antibiotic content becomes an important source of antibiotic pollution in the environment. In China, more than 350 tons of quinolone antibiotics are used in livestock and poultry breeding every year, and because quinolone substances are obviously adsorbed on a solid-phase medium, residues in the environment are not easy to naturally degrade, and the quinolone antibiotics have durability.
Antibiotics enter the soil environment and are subjected to migration and transformation, so that the antibiotics have different degrees of influence on the growth, development and reproduction of plants, soil animals and microorganisms, and can also induce the abundance of resistant bacteria and resistant genes to increase, thereby causing potential threat to human health along with a food chain. Degradation of quinolone antibiotics after entry into the environment generally reduces their efficacy, but some metabolites of quinolone antibiotics have the same or even greater toxicity than the parent antibiotic and may be converted into the parent antibiotic.
In recent years, researchers have explored a variety of methods such as electrochemical oxidation, advanced oxidation, photodegradation, material adsorption, and biodegradation to remove antibiotic contamination from the environment. Biodegradation has received wide attention as an environmentally friendly and effective antibiotic removal method, and microorganisms play an important role in biodegradation of environmental pollutants. At present, most of researches are focused on bacterial degradation of antibiotics at normal temperature, and few researches on degradation of antibiotics by fungi at low temperature are carried out.
Disclosure of Invention
The invention aims to break through low-temperature obstacles and provides a fungus capable of degrading quinolone antibiotics at low temperature and application thereof.
In order to achieve the purpose, the invention adopts the technical scheme that:
a strain of degrading microorganism is Geotrichum sp, which is preserved in 2021 at 7 months and 22 days and China general microbiological culture Collection center with the preservation number of CGMCC No. 23069.
The degrading microorganism is applied to degrading quinolone antibiotics.
The degrading microorganism is applied to degrading quinolone antibiotics at the temperature of 5-15 ℃.
A degrading bacteria preparation contains the degrading microorganism.
The preparation is a bacterial suspension containing degrading microorganisms.
And the bacterial suspension is obtained by carrying out spore elution on Geotrichum sp with sterile water and then collecting the spore suspension.
A degrading bacterium preparation, and application of the preparation in degrading quinolone antibiotics.
The degrading microorganism is applied to degrading quinolone antibiotics at the temperature of 5-15 ℃.
The degrading microorganism is applied to degrading enrofloxacin at the temperature of 5-15 ℃.
Compared with the prior art, the invention has the following technical effects:
the invention obtains a strain of fungus which can efficiently degrade enrofloxacin at low temperature by screening, the strain is identified as Geotrichum sp (Geotrichum sp) by ITS sequence analysis, and the strain is named as EZ-8. The preservation number is CGMCC No. 23069. The strain used in the invention has high efficiency for degrading enrofloxacin, the initial content of enrofloxacin is 20mg/L, the degradation rate of the strain 20d reaches 67.7 percent at the temperature of 15 ℃, and the degradation rate is about 32 percent higher than that of the blank strain without adding bacteria; the 20d degradation rate of the strain reaches 59.3 percent at the temperature of 10 ℃, which is about 30 percent higher than that of the blank strain without adding bacteria; when the temperature is 5 ℃, the 20d degradation rate of the strain reaches 56.5 percent, which is about 27 percent higher than that of the blank strain without adding bacteria. The invention provides an effective biological way for removing enrofloxacin in the environment.
Drawings
FIG. 1 is a colony morphology of strain EZ-8 provided in the examples of the present invention;
FIG. 2 is an HPLC-MS/MS quantitative detection result of enrofloxacin degradation by strain EZ-8 at 5 ℃ provided by the embodiment of the invention.
FIG. 3 is an HPLC-MS/MS quantitative detection result of enrofloxacin degradation by strain EZ-8 at 10 ℃ provided by the embodiment of the invention.
FIG. 4 is an HPLC-MS/MS quantitative detection result of enrofloxacin degradation by strain EZ-8 at 15 ℃ provided by the embodiment of the invention.
Detailed Description
The following examples are presented to further illustrate embodiments of the present invention, and it should be understood that the embodiments described herein are for purposes of illustration and explanation only and are not intended to limit the invention.
The structures, proportions, sizes, and other dimensions shown in the drawings and described in the specification are for understanding and reading only, and are not intended to limit the scope of the invention, which is defined in the appended claims, and are not intended to be limiting of the invention.
The high performance liquid chromatography-tandem mass spectrometry determination method comprises the following steps: and (3) quantitatively analyzing the concentration of the enrofloxacin by using high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Atlantis T3 chromatographic column (3 μm, 2.1 x 150mm), column temperature 30 deg.C, mobile phase composed of 98% (v/v) ammonium acetate + 0.1% formic acid aqueous solution (A) and 2% (v/v) acetonitrile (B), sample injection speed 0.4ml/min, sample injection amount 10 μ l.
The test methods in the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional experimental conditions or according to the experimental conditions recommended by the manufacturer. The materials, reagents and the like used are, unless otherwise specified, reagents and materials obtained from commercial sources.
The equipment used in the present invention is conventional in the art unless otherwise specified.
The preparation method of the culture medium used in the following examples of the invention is as follows:
1. enrichment culture medium: (NH)4)2SO4 2.0g；K2HPO4 0.5g；NaH2PO40.5 g; pH 7.0-7.4; distilled water 1000ml, adjusting pH to 7.0-7.4, sterilizing at 121 deg.C for 20 min.
PDA medium: 200g of potato, 20g of glucose, 15-20 g of agar, 1000ml of distilled water and natural pH.
3. Ordinary liquid medium: 10g of glucose, 0.2g of ammonium tartrate and KH2PO4 2g,MgSO4·7H2O 0.75g,CaCl2 0.1g，CuSO40.064mg, vitamin B12mg, Tween 801g, distilled water 1L, trace element solution 20ml, 20mM tartaric acid buffer solution to adjust pH to 4.5, and sterilizing at 115 deg.C for 30 min.
4. Solution of trace elements: MgSO (MgSO)4 3g,MnSO4 0.5g,NaCl 1.0g,FeSO4·7H2O 0.1g,CoCl20.1g，ZnSO4·7H2O 0.1g,Alk(SO4)2·2H2O 10mg,H3BO3 10mg,Na2MoO4·2H2O10 mg, distilled water 1L.
Example 1: isolation of Geotrichum sp
The soil is obtained from soil of a livestock and poultry farm in Shenbei new area in Shenyang city of Liaoning province through enrichment, separation and purification, and specifically comprises the following steps:
the method comprises the following steps: enrichment of strains
Adding 5g of contaminated soil into an enrichment medium containing enrofloxacin with the concentration of 20mg/L, placing the enrichment medium into a shaking table at the temperature of 15 ℃ for dark culture, taking a culture solution after 7d, inoculating the culture solution into a common culture medium containing enrofloxacin with the concentration of 50mg/L again according to the inoculation amount of 10%, culturing the enrichment medium for 7d while keeping other conditions unchanged, repeating the above operation steps and increasing the enrofloxacin concentration by 30mg/L every time until the final concentration of enrofloxacin in the enrichment medium is 200 mg/L;
step two: isolation and purification of the strains
After the enrichment is finished, 200 μ L of culture solution is added with 10 μ L of sterile water0、10-1、10-2、10-3Gradient dilution is carried out, bacteria liquid after dilution with different concentrations are separated by adopting a plate coating method, single bacteria with different colony forms and appearances are selected to fall on a PDA solid culture medium for further separation and purification by streaking according to a conventional mode, the single bacteria colony is selected to be inoculated to an inclined plane after separation and purification, and the serial number is stored;
step three: screening of degrading strains
And respectively inoculating each separated single strain into a common liquid culture medium containing 20mg/L enrofloxacin according to the inoculation amount of 10 percent, carrying out shaking table vibration culture for 30d in a dark place at the temperature of 15 ℃ and the rpm of 160, quantitatively detecting the residual concentration of the enrofloxacin by using a high performance liquid chromatography-tandem mass spectrometry method to obtain the strain with the enrofloxacin degradation capability, and naming the strain with the strongest degradation capability as EZ-8.
High performance liquid chromatography-tandem mass spectrometry determination method
And (3) quantitatively analyzing the concentration of the enrofloxacin by using high performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS). Atlantis T3 chromatographic column (3 μm, 2.1 x 150mm), column temperature 30 deg.C, mobile phase composed of 98% (v/v) ammonium acetate + 0.1% formic acid aqueous solution (A) and 2% (v/v) acetonitrile (B), sample injection speed 0.4ml/min, sample injection amount 10 μ l.
The strain has a degradation effect on enrofloxacin at a low temperature, and has the following characteristics:
the purified EZ-8 strain was inoculated on PDA solid medium and cultured at 28 ℃ for 7 days, and the colony was white powder and viscous in texture as shown in FIG. 1.
Example 2: identification of Geotrichum sp
(1) Genome extraction
The genomic DNA of strain EZ-8 was extracted using a rapid extraction kit for fungal genomic DNA (cat. No.: B518229-0050) from Biotechnology engineering (Shanghai) Ltd, according to the instructions.
(2) PCR amplification
The ITS universal primer is ITS1: 5'-TCCGTAGGTGAACCTGCGG-3'; the ITS4: 5'-TCCTCCGCTTATTGATATGC-3', PCR is about 400bp in length.
And (3) PCR reaction system:
PCR reaction parameters:
pre-denaturation at 95 ℃ for 4min, denaturation at 94 ℃ for 30s, renaturation at 57 ℃ for 30s, extension at 72 ℃ for 40s, and extension at 72 ℃ for 7min for 35 cycles.
(3) Gel electrophoresis
Finally, the PCR product obtained is electrophoresed and observed by using 1% agarose gel and 80V for 30 min. And (3) sending the PCR product successfully amplified to Huada gene science and technology limited for sequencing, wherein the sequencing primer is the same as the amplification primer. The nucleotide sequence of the ITS gene of strain EZ-8 was obtained, and the nucleotide sequence of the ITS gene of strain EZ-8 is shown below.
Strain EZ-8 gene sequence table
ATCATACAATCAAAACAAAAATAATTAAAACTTTTAACAATGGATCTCTTGGTTCTCGTA 120
TCGATGAAGAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGT 180
TTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTT 240
CTCTCTTGGAATTGCTTTGCTCTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACA 300
CTATTCAACCTCAGATCAAGTAGGATTACCCGCTGAACTTAAGCATATCAATA 353
The above sequence consists of 353 bases (bp). The determined ITS gene sequence is subjected to BLAST search comparison on a National Center for Biotechnology Information (NCBI) website to obtain a strain with higher similarity, and the analysis result shows that the strain EZ-8 is identified as geotrichum.
The strain EZ-8 fungus is Geotrichum sp, which is preserved in 22 months at 7 and 2021 and is preserved in the China general microbiological culture Collection center of China Committee for culture Collection of microorganisms, the preservation number is CGMCC No.23069, and the address is as follows: xilu No. 1, Beijing, Chaoyang, Beijing, and institute for microbiology, China academy of sciences.
Example 3: demonstration of degradation effect of EZ-8 on enrofloxacin
Eluting EZ-8 strain spore with sterile water, filtering with warp cloth, diluting with sterile water to obtain 1 × 106cfu·mL-1The bacterial suspension of (4).
Then inoculating the strain to a strain containing 20 mg.L according to the inoculation amount of 10 percent-1In the liquid culture medium of enrofloxacin, 3 groups are arranged in parallel, and are respectively cultured in a shaking and light-proof way at 5 ℃, 10 ℃ and 15 ℃ and 160rpm, and no bacteria are added as blank control. Subjecting the obtained culture solution to ultrasonic treatment, filtering mycelia with filter paper, collecting supernatant, filtering with 0.22 μm microfilm, and subjecting the filtered supernatant to high performance liquid chromatography-tandem mass spectrometry for quantitative detection of enrofloxacin (see FIGS. 2-4).
The calculation formula is as follows:
the result shows that the degradation rate of the enrofloxacin in the culture medium without the EZ-8 strain is 29.5 percent at the temperature of 5 ℃ for 20 days, and the degradation rate of the enrofloxacin in the culture medium with the EZ-8 strain is 56.5 percent; the degradation rate of the enrofloxacin is 30.8% in a culture medium without the EZ-8 strain at 10 ℃ for 20 days, and the degradation rate of the enrofloxacin is 59.3% in the culture medium with the EZ-8 strain; the degradation rate of the enrofloxacin is 35.3% in a culture medium without the EZ-8 strain at 15 ℃ for 20 days, and the degradation rate of the enrofloxacin is 67.7% in a culture medium with the EZ-8 strain.
The above-mentioned embodiments are intended to illustrate the objects, technical solutions and the like of the present invention in further detail, and it should be noted that the above-mentioned embodiments are merely preferred embodiments of the present invention, and should not be construed as limiting the present invention, and any modifications, equivalent substitutions, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
The preferred embodiments of the present disclosure are described in detail with reference to the accompanying drawings, however, the present disclosure is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present disclosure within the technical idea of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.
It should be noted that, in the foregoing embodiments, various features described in the above embodiments may be combined in any suitable manner, and in order to avoid unnecessary repetition, various combinations that are possible in the present disclosure are not described again.
In addition, any combination of the various embodiments of the present disclosure can be made, and the same should be considered as the inventive content of the present disclosure, as long as the combination does not depart from the spirit of the present disclosure.
Sequence listing
<110> Shenyang application ecological research institute of Chinese academy of sciences
<120> quinolone antibiotic degrading fungus at low temperature and application thereof
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 353
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gacctgcgga aggatcatta tgaattataa atatttgtga atttaccaca gcaaacaaaa 60
atcatacaat caaaacaaaa ataattaaaa cttttaacaa tggatctctt ggttctcgta 120
tcgatgaaga acgcagcgaa acgcgatatt tcttgtgaat tgcagaagtg aatcatcagt 180
ttttgaacgc acattgcact ttggggtatc ccccaaagta tacttgtttg agcgttgttt 240
ctctcttgga attgctttgc tcttctaaaa tttcgaatca aattcgtttg aaaaacaaca 300
ctattcaacc tcagatcaag taggattacc cgctgaactt aagcatatca ata 353
Claims (9)
1. A degrading microorganism, which is characterized in that: the degrading microorganism is Geotrichum sp, which is preserved in 22.7.2021 and China general microbiological culture Collection center with the preservation number of CGMCC No. 23069.
2. Use of a degrading microorganism according to claim 1, characterized in that: the degrading microorganism is applied to degrading quinolone antibiotics.
3. Use of a degrading microorganism according to claim 2, characterized in that: the degrading microorganism is applied to degrading quinolone antibiotics at the temperature of 5-15 ℃.
4. A degrading bacteria preparation, which is characterized in that: the preparation contains the degrading microorganism according to claim 1.
5. The degrading bacteria preparation according to claim 4, wherein: the preparation is a bacterial suspension containing degrading microorganisms.
6. The degrading bacteria preparation according to claim 5, wherein: the bacterial suspension is obtained by carrying out spore elution on Geotrichum sp. of Geotrichum in claim 1 by using sterile water and then collecting the spore suspension.
7. A degrading bacterial preparation according to claim 4, wherein: the application of the preparation in degrading quinolone antibiotics.
8. Use according to claim 7, characterized in that: the degrading microorganism is applied to degrading quinolone antibiotics at the temperature of 5-15 ℃.
9. Use according to claim 8, characterized in that: the degrading microorganism is applied to degrading enrofloxacin at the temperature of 5-15 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111361219.0A CN114107065B (en) | 2021-11-17 | 2021-11-17 | Quinolone antibiotic degrading fungus at low temperature and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111361219.0A CN114107065B (en) | 2021-11-17 | 2021-11-17 | Quinolone antibiotic degrading fungus at low temperature and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114107065A true CN114107065A (en) | 2022-03-01 |
| CN114107065B CN114107065B (en) | 2023-07-25 |
Family
ID=80396924
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111361219.0A Active CN114107065B (en) | 2021-11-17 | 2021-11-17 | Quinolone antibiotic degrading fungus at low temperature and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114107065B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115404186A (en) * | 2022-09-09 | 2022-11-29 | 中国科学院沈阳应用生态研究所 | Low-temperature degradation strain for degrading enrofloxacin and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929442A (en) * | 2017-02-24 | 2017-07-07 | 暨南大学 | One plant of carbostyril antibiotic degradation bacteria and its application |
| CN110591948A (en) * | 2019-09-20 | 2019-12-20 | 广东省农业科学院农业资源与环境研究所 | Compound microbial agent for degrading quinolone antibiotics and preparation method and application thereof |
-
2021
- 2021-11-17 CN CN202111361219.0A patent/CN114107065B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106929442A (en) * | 2017-02-24 | 2017-07-07 | 暨南大学 | One plant of carbostyril antibiotic degradation bacteria and its application |
| CN110591948A (en) * | 2019-09-20 | 2019-12-20 | 广东省农业科学院农业资源与环境研究所 | Compound microbial agent for degrading quinolone antibiotics and preparation method and application thereof |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115404186A (en) * | 2022-09-09 | 2022-11-29 | 中国科学院沈阳应用生态研究所 | Low-temperature degradation strain for degrading enrofloxacin and application thereof |
| CN115404186B (en) * | 2022-09-09 | 2024-01-26 | 中国科学院沈阳应用生态研究所 | Low-temperature degradation strain for degrading enrofloxacin and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114107065B (en) | 2023-07-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107090418B (en) | One strain denitrogen paracoccus and its application in livestock and poultry farm wastewater treatment | |
| CN106957805B (en) | Bacillus GBacilus-9 strain with bacteriostatic effect and separation method and application thereof | |
| CN114921385B (en) | Bacillus subtilis and application thereof in feed addition and antibiotic-free cultivation | |
| CN107502566B (en) | Lysine bacillus and application thereof in degradation of zearalenone | |
| CN110878265A (en) | Bacillus subtilis for degrading aflatoxin and application thereof | |
| CN112608868A (en) | Bacillus altitudinis and application thereof | |
| CN114107065B (en) | Quinolone antibiotic degrading fungus at low temperature and application thereof | |
| CN104694412B (en) | A kind of bacillus cereus and its preparation and application | |
| CN113308413B (en) | Fluoroquinolone antibiotic degrading bacterium and application thereof in compost | |
| JP2019037192A (en) | Isolation method of genus raoultella microbe, production method of vegetable waste treatment agent and vegetable waste treatment method | |
| CN114621885A (en) | Bacillus subtilis for efficiently removing ammoniacal nitrogen and nitrite nitrogen and application thereof in aquaculture | |
| KR101898662B1 (en) | Bacillus amyloliquefaciens strain KJ5 and environmentally sustainable food waste processing microbial agent | |
| CN113755400B (en) | Bacillus cereus for degrading aureomycin and application thereof | |
| RU2488630C1 (en) | STRAIN Micrococcus luteus, HAVING CATALASE ACTIVITY AND PERFORMING TRANSFORMATIONS OF ORGANIC REMAINS OF NATURAL ORIGIN | |
| CN113801827B (en) | Acidomyces acidothermus strain and application thereof in leaching copper-containing pollutants of waste circuit boards | |
| CN114717140A (en) | Bacillus licheniformis and application thereof | |
| CN114703069A (en) | Epicoccum nigrum fermentation product, preparation method and application thereof | |
| CN113564081A (en) | Devorax SCS-3 for producing vomitoxin degrading enzyme and application thereof | |
| KR101455925B1 (en) | Bacillus spp., identified from lugworm and microbial cleaning agent. | |
| Fitriyanto et al. | Isolation and characterization of Alcaligenes sp. LS2T from poultry farm at Yogyakarta city and the growth ability in animal’s urine medium | |
| KR101898660B1 (en) | Bacillus licheniformis strain SN1 and environmentally sustainable food waste processing microbial agent | |
| CN114410514B (en) | Bacillus stereiensis and application thereof | |
| CN113980857B (en) | Tetracycline antibiotic degrading bacteria at low temperature and application thereof | |
| Ramachandiran et al. | Identification and characterization of gut associated bacteria in Epilachna vigintioctopunctata Fab.(Coleoptera: Coccinellidae) | |
| CN114149943B (en) | Sulfanilamide antibiotic degrading bacteria at low temperature and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |