CN116144522A

CN116144522A - Paenibacillus pumilus and application thereof in preventing and treating white rot of grape

Info

Publication number: CN116144522A
Application number: CN202210960434.0A
Authority: CN
Inventors: 袁丽芳; 江航; 尹向田; 魏彦锋; 李廷刚; 蒋锡龙
Original assignee: Shandong Grape Research Institute; Shandong Academy of Agricultural Sciences
Current assignee: Shandong Grape Research Institute; Shandong Academy of Agricultural Sciences
Priority date: 2022-08-11
Filing date: 2022-08-11
Publication date: 2023-05-23

Abstract

The invention discloses a paenibacillus Pityrosporum ZBSF16 and application thereof, wherein the paenibacillus Pityrosporum has the strain number of ZBSF16 and is preserved in China general microbiological culture Collection center (CGMCC) No.24769 at the month-4-26-year of 2022. The paenibacillus pis ZBSF16 and/or the metabolites of the paenibacillus pis ZBSF16 can prevent and/or treat grape white rot, has good growth promoting effect on grape crops such as grapes, and also has good antibacterial effect on anthracnose bacteria, botrytis cinerea, botrytis cinerea, phomopsis, alternaria viticola, mucor clavuligerus, aspergillus niger, fusarium oxysporum, fusarium pseudograminearum, fusarium graminearum, and agrobacterium viticola.

Description

Paenibacillus pumilus and application thereof in preventing and treating white rot of grape

Technical Field

The invention relates to the field of plant protection, in particular to paenibacillus picolinae and application thereof in preventing and treating white rot of grapes.

Background

Grape is classified into fresh grape, which is a fruit rich in nutrition, and wine grape, which can brew wine. White rot of grape is an important fungal disease on grape, and occurs in all areas of the world where grape production is concerned, and the grape white rot mainly damages clusters (including fruit stalks and fruit grains) and also damages young shoots and young leaves of grape, thus bringing about great loss to the grape industry. White rot fungi (Coniella diplodiella (speg.), aschersonia strawberry (c.fragaria), aschersonia chestnut (Pilidiella castaneicola) and white rot fungi (Coniella vitamins) have all been reported to cause white rot of grape, with the white rot fungi (Coniella vitamins) being the main causative bacteria of white rot of grape in China. The white rot of grape is prevented and treated mainly by chemical agents, but the prevention and treatment effect is poor, the drug resistance is caused, the environment is easy to be polluted, and meanwhile, the food safety problem is brought. Therefore, the development of biological prevention and treatment research on grape white rot is particularly important and urgent.

Paenibacillus is widely distributed in various environments including water, soil, plant rhizosphere. Many paenibacillus can be used as a biocontrol bacterium to promote plant growth while inhibiting disease. Researches show that the paenibacillus can inhibit various pathogenic fungi and bacteria and can prevent and treat various diseases on cucumbers, peppers and bananas.

Disclosure of Invention

The invention aims to solve the technical problem of improving the biological control effect of grape white rot.

In order to solve the technical problems, the invention firstly provides a paenibacillus picolinae (Paenibacillus peoriae) ZBSF16.

The registration number of the paenibacillus picolinatus (Paenibacillus peoriae) ZBSF16 provided by the invention in the common microorganism center of the China Committee for culture Collection of microorganisms is CGMCC No.24769. The strain is preserved in China general microbiological culture collection center (CGMCC) for 4 months and 26 days in 2022, and the preservation address is North Xiyi No. 1, 3 and the postal code 100101 in the Korean area of Beijing city. Hereinafter, paenibacillus licheniformis ZBSF16.

The paenibacillus pisifer ZBSF16 has the shape of a rod, zhou Shengduo flagella, smoother surface, no obvious wrinkles, 3-5 mu m of bacterial length and 0.8-1.2 mu m of diameter. The strain is cultured on LB solid medium for 24 hours, the colony is milky white, the single colony is smaller, the surface of the colony is not wrinkled, the edge is irregular, and the colony has viscosity. The bacteria are gram positive bacteria, the NaCl content is 1-2%, the bacteria can grow, and the nitrate reduction reaction and the starch hydrolysis reaction are positive. The bacteria can use mannose, pectin, etc., and can not use citric acid, etc. The optimum growth temperature is 28-37 ℃ and the growth pH value is 7.5-8.2. Paenibacillus subtilis ZBSF16 has 16S rDNA shown in sequence 1 in a sequence table.

(shown as a sequence 1 in a sequence table).

Metabolites of paenibacillus pis ZBSF16 and/or cultures of paenibacillus pis ZBSF16 are also within the scope of the invention.

In the above, the metabolite of paenibacillus pisifer ZBSF16 may be a fermentation broth of paenibacillus pisifer ZBSF16. The fermentation broth of paenibacillus pisifer ZBSF16 can be prepared according to the following method: culturing Paenibacillus subtilis ZBSF16 in a liquid fermentation medium, and collecting fermentation broth (containing Paenibacillus subtilis ZBSF16 and substances secreted into the liquid culture medium), wherein the fermentation broth is a metabolite of Paenibacillus subtilis ZBSF16.

In the above, the culture of Paenibacillus subtilis ZBSF16 is a fermentation product obtained by culturing Paenibacillus subtilis ZBSF16 in a microbial culture medium (e.g., a fermentation broth containing Paenibacillus subtilis ZBSF16 and a substance secreted into a liquid culture medium, or a fermentation broth containing Paenibacillus subtilis ZBSF16 and a substance secreted into a solid culture medium).

The metabolites of the paenibacillus pisifer ZBSF16 and/or the cultures of the paenibacillus pisifer ZBSF16 have the activity of inhibiting the white rot of grape;

or the metabolite of paenibacillus pisifer ZBSF16 and/or the culture of paenibacillus pisifer ZBSF16 has at least one of the following functions of W1-W19:

w1, inhibiting the activity of bacteria;

w2, inhibiting the activity of gram-negative bacteria;

w3, inhibiting the activity of fungi;

w4, inhibiting the activity of white rot fungi (Coniella vitis);

w5, inhibiting the activity of anthrax bacteria (Gloeosporium fructigrum);

w6, inhibiting the activity of Botrytis cinerea;

w7, inhibiting the activity of Puccinia (Botryosphaeria dothidea);

w8, inhibits the activity of Phomopsis (Diadorthes).

W9, inhibiting the activity of alternaria viticola (Alternaria viticola);

w10, inhibiting the activity of Mucor pulmonale (Pestalotiopsis clavispora);

w11, inhibits the activity of aspergillus niger (Aspergillus niger);

w12, inhibiting the activity of Fusarium oxysporum (Fusarium oxysporum);

w13, inhibiting the activity of Fusarium pseudograminearum (Fusarium pseudograminearum);

w14, inhibiting the activity of Fusarium graminearum (Fusarium graminearum);

w15, inhibiting the activity of agrobacterium vitis (Agrobacterium vitis);

w16, activity to promote plant growth;

w17, an activity to promote the growth of Vitaceae plants;

w18, an activity of promoting the growth of Vitis plants;

w19, activity for promoting grape plant growth.

In order to solve the technical problems, the invention also provides a product, which contains paenibacillus picomazbsf 16 or/and metabolites of paenibacillus picomazbsf 16 or/and cultures of paenibacillus picomazbsf 16.

The product can be a microbial agent or a microecological formulation containing the microbial agent.

The product can be specifically any one of the following products:

u1, a product for preventing and/or treating grape white rot;

u2, a product for inhibiting fungi;

u3, a product for inhibiting bacteria;

u4, product for improving plant yield.

In the above products, the plant may be a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plant may be a plant of the family Vitaceae, further may be a plant of the genus Vitis, still further may be Vitis vinifera.

The active ingredients of the product can be paenibacillus picolina ZBSF16 or/and metabolites of paenibacillus picolina ZBSF16 or/and cultures of paenibacillus picolina ZBSF16, the active ingredients of the product can also contain other biological components or non-biological components, and the other active ingredients of the product can be determined by a person skilled in the art according to the effect of the product.

The product can be liquid microbial inoculum or solid microbial inoculum.

The product may also include a carrier. The carrier may be a solid carrier or a liquid carrier. The solid carrier is a mineral material and a biological material; the mineral material may be at least one of turf, clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the biological material is at least one of straws, pine shells, rice straws, peanut shells, corn flour, bean flour, starch, turf and animal excrement of various crops; the liquid carrier may be water; in the product, paenibacillus pisifer ZBSF16 and/or metabolites of paenibacillus pisifer ZBSF16 may be present in the form of living cells being cultured, a fermentation broth of living cells, a filtrate of a cell culture or a mixture of cells and filtrate.

The dosage form of the product can be various dosage forms, such as liquid, emulsion, suspending agent, powder, granule, wettable powder or water dispersible granule.

Surfactants (such as Tween 20, tween 80, etc.), binders, stabilizers (such as antioxidants), pH regulators, etc. can be added to the product as required.

Paenibacillus licheniformis ZBSF16 and/or metabolites of the paenibacillus licheniformis ZBSF16 and/or cultures of the paenibacillus licheniformis ZBSF16 and/or the application of the products in preventing and/or treating grape white rot belong to the protection scope of the invention.

The following uses of Paenibacillus licheniformis ZBSF16 and/or a metabolite of Paenibacillus licheniformis ZBSF16 and/or a culture of Paenibacillus licheniformis ZBSF16 and/or said product are also within the scope of the present invention:

v1, use in inhibiting fungal activity;

v2, use in inhibiting bacterial activity;

v3, application in promoting plant growth.

In the above application, the plant may be a dicotyledonous plant or a monocotyledonous plant. The dicotyledonous plant may be a plant of the family Vitaceae, further may be a plant of the genus Vitis, still further may be Vitis vinifera.

The method for culturing the paenibacillus pisifer ZBSF16 also belongs to the protection scope of the invention.

The method for culturing the paenibacillus pisifer ZBSF16 provided by the invention comprises the step of culturing the paenibacillus pisifer ZBSF16 in a culture medium.

The method of preparing the product is also within the scope of the present invention.

The method for preparing the product comprises the step of taking the paenibacillus pisiformis ZBSF16 or/and a culture of the paenibacillus pisiformis ZBSF16 or/and a metabolite of the paenibacillus pisiformis ZBSF16 as a component of the product to obtain the product.

In the above method, the product may be a liquid microbial agent or a solid microbial agent. In the method, the paenibacillus pis ZBSF16 can be cultured in a fermentation medium to obtain fermentation liquor, and the fermentation liquor is mixed with a carrier to obtain the liquid microbial inoculum. The composition of the fermentation medium may be an LB liquid medium.

Experiments prove that the paenibacillus picolinar ZBSF16 has better antibacterial activity. The paenibacillus picolinae ZBSF16 has good biological control effect on grape white rot, can promote the growth of grape plants and improve the yield. The paenibacillus pisifer ZBSF16 has no environmental pollution problem, has simple culture conditions, is easy to store and convenient to process, and is suitable for development and application.

Drawings

FIG. 1 shows colony morphology and scanning electron micrographs of strain ZBSF16. Panel A of FIG. 1 shows colony morphology of strain ZBSF16 on LB solid medium, and panel B of FIG. 1 shows scanning electron microscope photograph of strain ZBSF16.

FIG. 2 is a phylogenetic tree of the strain ZBSF16.

Fig. 3 is a bacteriostasis spectrum of the strain ZBSF16.

FIG. 4 shows the results of enzyme activity assay of strain ZBSF16. FIG. 4A shows the results of protease activity measurement, and FIG. 4B shows the results of cellulase activity measurement.

FIG. 5 is a graph showing the results of IAA production, ammonia production, phosphate solubilizing ring and ferrite production of ZBSF16 strain. Wherein, the graph A of FIG. 5 shows IAA production of the strain ZBSF16, the graph B of FIG. 5 shows ammonia production capacity of the strain ZBSF16, the graph C of FIG. 5 shows phosphorus dissolving circle of the strain ZBSF16, and the graph D of FIG. 5 shows ferrite production of the strain ZBSF16.

FIG. 6 shows the growth curve and pH change of strain ZBSF16.

FIG. 7 shows the resistance of strain ZBSF16 to various antibiotics.

Fig. 8 shows the effect of the strain ZBSF16 on promoting the growth of grape and controlling white rot of grape. FIG. 8A shows the growth promoting effect, FIG. 8B shows the effect of preventing and treating white rot of grape, wherein a1 and B1 are white rot of grape; a2, b2 are inoculated LB liquid culture media; a3, b3 are inoculated sterile water; a4, b4 are culture solutions inoculated with ZBSF16; a5, b5 is a culture solution inoculated with ZBSF16 after 24 hours of inoculation of the white rot of grape; a6, b6 are the white rot germs of the grape inoculated after 24 hours of the culture solution inoculated with ZBSF16.

Preservation description

Chinese name: paenibacillus Pisi

Latin name: paenibacillus peoriae

Strain number: ZBSF16

Preservation mechanism: china general microbiological culture Collection center (China Committee for culture Collection of microorganisms)

The preservation organization is abbreviated as: CGMCC

Address: beijing city, chaoyang area, north Chenxi Lu No. 1 and 3

Preservation date: 2022, 4 and 26 days

Accession numbers of the preservation center: CGMCC No.24769

Chinese name: white rot of grape

Latin name: coniella vitamins

Strain number: GP1

The preservation organization is abbreviated as: CGMCC

Address: beijing city, chaoyang area, north Chenxi Lu No. 1 and 3

Preservation date: 2021, 12, 1

Accession numbers of the preservation center: CGMCC No.23888

Detailed Description

The following detailed description of the invention is provided in connection with the accompanying drawings that are presented to illustrate the invention and not to limit the scope thereof. The examples provided below are intended as guidelines for further modifications by one of ordinary skill in the art and are not to be construed as limiting the invention in any way.

The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are carried out according to techniques or conditions described in the literature in the field or according to the product specifications. Materials, reagents and the like used in the examples described below are commercially available unless otherwise specified.

1. Pathogenic fungi and pathogenic bacteria

Anthracnose (Gloeosporium fructigrum), white rot of grape (Coniella vines), phomopsis (Diadorthe eres), mucor pulmonale (Pestalotiopsis clavispora), aspergillus niger (Aspergillus niger), alternaria viticola (Alternaria viticola) have been described in the literature "Yin X, li T, jiang X, tang X, zhang J, yuan L, wei Y.support of Grape White Rot Caused by Coniella vitis Using the Potential Biocontrol Agent Paenibacillus peoriae GSBZ09. Pathogs.2022 Feb 14;11 (2) 248.doi:10.3390/pathens 11020248, "publicly available from the applicant's Shandong grape institute to repeat the experiments of the present application.

The agrobacteria (Botryosphaeria dothidea) and fusarium oxysporum (Fusarium oxysporum) are identified in the literature "yishida," Yang Liying, xu Liang, gao Huanhuan, wangmei, wu Xinying. Identification of pathogenic bacteria causing the ear to fester: 493-494", available to the public from the applicant's Shandong grape institute to repeat the experiments of the present application.

Botrytis cinerea has been described in the literature "Yi-to-field Yang Liying, wang Chaoping, chen Yingchun, wu Xinying. Different types of bactericides have been tested for indoor virulence against 6 species of grape rot pathogens. Jiangsu agricultural science, 2021, 49 (03): 99-104", available to the public from the applicant's Shandong grape institute to repeat the experiments of the present application.

Fusarium graminearum (Fusarium graminearum) has been described in the literature "Jiang H, xia A, ye M, ren J, li D, liu H, wang Q, lu P, wu C, wu JR, jiang C.op-posing functions of Fng1 and the Rpd3 HDAC complex in H4 acetylation in Fusarium grating arm. PLoS Genet.2020 Nov 2;16 (11) e1009185.Doi:10.1371/journ al. Pgen.1009185, "available to the public from the applicant Shandong grape institute for the purpose of repeating the tests of the present application.

Fusarium pseudograminearum (Fusarium pseudograminearum) has been disclosed in the literature "Jiang H, ma LG, qi K, zhang YL, zhang B, ma G, qi JS. First Report of Maize Seedling Blight Caused by Fusarium pseudograminearum in China. Plant Dis.2022Mar 12.Doi:10.1094/PDIS-01-22-0099-PDN." and is publicly available from the applicant Shandong grape institute to repeat the experiments of the present application.

Agrobacterium vitis (Agrobacterium vitis) is known in the literature from the field Wei Yanfeng, xu Liang, yang Yang. Screening and identifying pathogenic bacteria of grape root cancer. Agronomic journal, 2019,9 (02): 24-30, available to the public from the applicant's Shandong grape institute to repeat the experiments of the present application.

2. Culture medium

The medium in the examples described below, unless otherwise specified, was at a natural pH.

The preparation method of the LB liquid medium in the following examples is as follows: 10g of tryptone, 5g of yeast extract, 10g of NaCl and 1000mL of distilled water.

The LB solid medium in the following examples was obtained by adding a coagulant (optionally agar) to an LB liquid medium.

The preparation method of the PDA solid medium in the following examples is as follows: 200.0g of potato, 20.0g of glucose and 20.0g of agar are dissolved in 1000mL of distilled water.

The preparation method of the NA liquid medium in the following examples is as follows: 10g of peptone, 3g of beef powder and 5g of NaCl are dissolved in 980mL of distilled water, and the pH value is regulated to 7.0.

The preparation method of the NA solid medium in the following examples is as follows: 10g of peptone, 3g of beef powder, 5g of NaCl, 15g of agar, and the pH value is adjusted to 7.0 by dissolving the mixture in 980mL of distilled water.

The WA medium formulation method in the following examples is as follows: agar 5g, dissolved in 1000mL distilled water.

The preparation method of the protease culture medium (for protease assay) in the following examples was as follows: preparing NA solid culture medium (peptone 10g, beef powder 3g, naCl 5g, agar 15g, dissolving in 980mL distilled water, adjusting pH to 7.0), heating and boiling 20mL skimmed milk at high temperature, and adding into melted NA solid culture medium to obtain protease culture medium.

The CMC medium (used for the measurement of cellulases) in the following examples was prepared as follows: magnesium sulfate 0.1g, ammonium sulfate 1g,10 XP buffer (preparation method: dipotassium hydrogen phosphate 70g, potassium dihydrogen phosphate 20g, dissolved in 1000mL distilled water to obtain 10 XP buffer) 100mL, yeast extract 5g, glycerol 2mL, sodium carboxymethylcellulose 1g, agar 8g, dissolved in 900mL distilled water to obtain CMC culture medium.

The siderophore detection solid medium in the following examples was purchased from Beijing Lei Bo technologies Co., ltd.

The preparation method of the NBRIP medium in the following examples is as follows: glucose 10.0g, tricalcium phosphate (Ca ₃ (PO ₄ ) ₂ ) 5.0g of magnesium chloride (MgCl) ₂ ·7H ₂ O) 5.0g, magnesium sulfate (MgSO ₄ ·7H ₂ O) 0.25g, potassium chloride (KCl) 0.2g, ammonium sulfate ((NH 4) ₂ SO ₄ ) 0.1g of agar 15.0g was dissolved in 1000ml of distilled water, and the pH was adjusted to 7.0 to obtain NBRIP medium.

The preparation method of the protein water culture medium in the following examples is as follows: 10g of peptone, 5g of sodium chloride and 1000ml of distilled water were dissolved to obtain a protease aqueous medium.

The preparation method of DF culture medium in the following examples is as follows: 5.0g of peptone, 1.5g of yeast extract, 1.5g of beef extract and 5.0g of NaCl are dissolved in 1000ml of distilled water, and the pH value is regulated to 7.0, so as to obtain the DF culture medium.

The preparation method of DF+ culture medium in the following examples is as follows: 5.0g of peptone, 1.5g of yeast extract, 1.5g of beef extract, 5.0g of NaCl and 0.5g of tryptophan are dissolved in 1000ml of distilled water, and the pH value is regulated to 7.0, so as to obtain the DF+ culture medium.

Unless otherwise indicated, the quantitative tests in the examples below were all performed in triplicate, and the results averaged.

EXAMPLE 1 isolation, purification and characterization of Strain ZBSF16

1. Bacterial strain separation, purification and screening

Taking a wheat rhizosphere soil sample from Shanghe county in Jinan province of Shandong, separating by adopting a dilution plating method, putting 10g of soil into 90mL of sterilized water, and placing the mixture in a shaking table at a constant temperature of 28 ℃ for shaking culture for 30min. And (3) carrying out gradient dilution on the soil suspension to obtain an LB solid culture medium plate, placing the LB solid culture medium plate in a 28 ℃ constant temperature incubator for culturing for 24 hours, selecting single bacteria on the LB solid culture medium plate by using a sterilized toothpick, marking out and purifying, purifying 21 strains of bacteria altogether, culturing in the 28 ℃ constant temperature incubator for 24 hours, and preserving in a refrigerator at 4 ℃ for later use.

Screening from purified strains by using a counter plate method with white rot fungi (Coniella vinis) as a target, wherein the screening method comprises the following steps:

the strain with antagonism is screened by adopting a flat plate counter method by taking grape white rot germs (Coniella vitis) as targets. And (3) a puncher is used for punching a bacterial cake (with the diameter d=5mm) at the edge of the activated bacterial colony of the indicator fungus grape white rot fungus, the bacterial cake is inoculated to the central position of the PDA flat plate, the mycelium-bearing surface faces downwards, and the bacterial cake is cultivated for 24 hours at the temperature of 28 ℃. Symmetrically inoculating 5 mu L of biocontrol bacterial suspension in a crisscross manner 15mm away from the edge of a culture dish, and repeating each strain for 3 times; setting a blank control of a culture medium only connected with pathogenic indicator bacteria, and culturing at 28 ℃; when the blank control grows to the biocontrol bacteria inoculation point, measuring the control growth quantity (colony diameter) and the treatment growth quantity (growth diameter after bacteria inoculation) of the target bacteria, and calculating the bacteriostasis rate:

antibacterial ratio (%) = "control colony diameter-treated colony diameter)/control colony diameter" ×100

Selecting a strain with high antibacterial rate, and screening the strain ZBSF16.

2. Identification of Strain ZBSF16

Morphological identification

The strain ZBSF16 is cultured on LB solid medium for 24 hours, the colony is milky white, the single colony is smaller, the surface of the colony is not wrinkled, the edge is irregular, and the colony has viscosity. The somatic cells are in a rod shape, zhou Shengduo flagella are smooth in surface and have no obvious wrinkles. The morphological photograph is shown in FIG. 1. The strain has a length of 3-5 μm and a diameter of 0.8-1.2 μm.

Physiological and biochemical identification

The strain ZBSF16 is streaked and inoculated in LB solid medium, and cultured for 24 hours at 28 ℃, and the physiological and biochemical characteristics are identified according to the Bojie's bacteria identification manual and the common bacteria system identification manual. The results are shown in Table 1: the strain ZBSF16 is gram positive bacteria, can grow at 28-37 ℃ and slowly grow at 15 ℃. The culture medium can grow normally when the salt (NaCl) content is 1%, and can not grow when the salt content is higher than 2%. Mannose and pectin can be used. Both nitrate reduction and starch hydrolysis reactions were positive.

TABLE 1 physiological and biochemical characteristics of ZBSF16 strain

Biolog assay

The ZBSF16 single colony of the strain is selected and inoculated on the slant of an LB solid culture medium test tube, and the strain is cultured for 24 hours at 28 ℃. The unique carbon source utilization of the strain ZBSF16 was measured by the China center for type culture Collection of microorganisms (operating according to the kit instructions) using a BIOLOG GENIII kit, and the measurement results are shown in Table 2.

TABLE 2 results of the ZBSF16 Biolog assay for the strains

Note that: "+" indicates positive and "-" indicates negative.

Molecular characterization

After genomic DNA of the strain ZBSF16 was extracted with a general bacterial genomic extraction kit, 16S rDNA of the strain ZBSF16 was PCR-amplified using general primers 27F and 1492R of bacterial 16SrDNA, respectively. The primer sequences were as follows:

27F：5’

AGAGTTTGATCCTGGCTCAG/>

3’；

1492R：5’

ACGGCTACCTTGTTACGACTT/>

3’。

PCR reaction conditions: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 30s, annealing at 60℃for 30s, elongation at 72℃for 1min,34 cycles; extending at 72℃for 10min.

The PCR amplified products were sent to Bio Inc. for sequencing. And constructing a phylogenetic tree by using MEGA7.0 and adopting a maximum likelihood method, and analyzing the relationship.

The sequencing result of the 16S rDNA shows that the 16S rDNA of the strain ZBSF16 has a fragment with nucleotide sequence 1 in a sequence table. The BLAST comparison of the 16S rDNA sequencing result shows that the strain ZBSF16 has higher consistency with the paenibacillus. The 16S rDNA phylogenetic tree was constructed and the results are shown in FIG. 2, in which the strain ZBSF16 was clustered with the standard strain of Paenibacillus picolina. The strain ZBSF16 belongs to Paenibacillus Pitussilago (Paenibacillus peoriae) in combination with morphological identification, physiological and biochemical identification, BIOLOG measurement and molecular identification results.

Preservation of Strain ZBSF16

Paenibacillus Pisi (Paenibacillus peoriae) ZBSF16 was preserved in China general microbiological culture Collection center (CGMCC) at 4 and 26 months of 2022, and the preservation number is CGMCC No.24769. Paenibacillus licheniformis (Paenibacillus peoriae) ZBSF16, abbreviated as Paenibacillus licheniformis ZBSF16.

Example 2 Paenibacillus subtilis ZBSF16 bacteriostasis Spectrometry

1. Detecting inhibition rate of paenibacillus picomajoris ZBSF16 on various pathogenic fungi by adopting plate counter method

The pathogenic fungi used are in particular: white rot of grape (Coniella vitamins), anthracnose (Gloeosporium fructigrum), botrytis cinerea (Botrytis cinerea), botrytis cinerea (Botryosphaeria dothidea), phomopsis pseudobulb (Diadorthes), alternaria viticola (Alternaria viticola), mucor pulmonale (Pestalotiopsis clavispora), aspergillus niger (Aspergillus niger), fusarium oxysporum (Fusarium oxysporum), fusarium pseudograminearum (Fusarium pseudograminearum), and Fusarium graminearum (Fusarium graminearum).

The specific method for detecting the plate counter method is as follows: picking up single colony of Paenibacillus Pityrosporum ZBSF16, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL is ZBSF16 bacterial suspension; inoculating pathogenic fungi cake with diameter of 5mm in the center of PDA solid culture medium plate, inoculating 5 μl ZBSF16 bacterial suspension at a position 3.5cm away from the center of plate, and culturing with LB liquid culture mediumFor the control of ZBSF16 bacterial suspension, expressed by CK, cultured for 5d at 28 ℃, then the diameter of the bacterial colony of pathogenic bacteria is measured, and the bacteriostasis rate is calculated:

bacteriostasis rate (%) = 100× (control-ZBSF 16 bacterial colony diameter)/control-pathogenic colony diameter. The experiment was performed in triplicate, with 5 plates per treatment.

2. Antagonistic activity of strain ZBSF16 against Agrobacterium vitis (Agrobacterium vitis) was examined by double-layer culture

The specific method comprises the following steps: (1) ZBSF16 single colony is selected and inoculated in LB liquid culture medium, and shake culture is carried out at 28 ℃ and 180r/min until the bacterial concentration is 1 multiplied by 10 ⁸ cfu/mL to obtain ZBSF16 bacterial suspension. (2) Inoculating 5 mu L of ZBSF16 bacterial suspension in the center of a PDA culture medium plate, culturing at 28 ℃ for 24 hours, inverting the culture dishes, adding 3mL of chloroform into each culture dish in a fume hood, and standing for 12 hours to inactivate the strain ZBSF16; (3) inoculating Agrobacterium vitis to NB liquid culture medium, shake culturing at 28deg.C at 180r/min until bacterial concentration is 1×10 ⁸ cfu/mL; (4) 100. Mu.L of the Agrobacterium vitis suspension WAs added to 4mL of WA medium, and after mixing, poured onto the PDA medium plate after completion of step (2) as the upper layer, followed by incubation at 28℃for 24 hours, and then the zone of inhibition WAs observed and measured. Experiments were performed in triplicate, with 5 plates each time. The bacteriostatic effect of strain ZBSF16 is shown in fig. 3 and table 3:

TABLE 3 bacteriostatic Effect of Strain ZBSF16

Note that: the different lowercase letters in the inhibition ratio column represent significant differences (P < 0.05) in the inhibition ratio of strain ZBSF16 against different pathogenic bacteria.

Example 3 measurement of growth-promoting disease-preventing index of Strain ZBSF16

1. Detection of proteases

Selecting single colony of ZBSF16 strain, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL to obtain ZBSF16 bacterial suspension. Bacterial ZBSF16 suspension was inoculated at the center of the protease medium, each treatment was repeated 3 times, and the culture was carried out at 28℃for 72 hours, and then the digestion ring was observed.

The results of the assay are shown in panel A of FIG. 4, which illustrates that strain ZBSF16 can produce protease.

2. Detection of cellulases

Selecting single colony of ZBSF16 strain, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL to obtain ZBSF16 bacterial suspension. Bacterial strain ZBSF16 bacterial suspension is inoculated at the central position of CMC culture medium, after culturing for 72 hours at 28 ℃,3mL of 0.2% (w/v) Congo red solution is dyed for 30min,5mL of 1mol/L NaCl solution is decolorized for 15min, each treatment is repeated 3 times, and a digestion ring is observed.

The results of the assay are shown in panel B of FIG. 4, which illustrates that strain ZBSF16 can produce cellulase.

3. Detection of siderophores

Bacterial suspension of ZBSF16 (1X 10) cultured overnight ⁸ cfu/mL) was inoculated on a siderophore detection solid medium plate, cultured for 7d, and the colony was observed for the presence or absence of orange halo formation.

The measurement results are shown in the D graph of FIG. 5, which shows that the strain ZBSF16 is capable of producing ferrites.

4. Phosphorus dissolution detection

Selecting single colony of ZBSF16 strain, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL to obtain ZBSF16 bacterial suspension; a sterilized qualitative filter paper sheet (diameter d=0.5 cm) was placed in the center of the NBRIP solid medium plate, 10. Mu.l of the bacterial suspension was pipetted with a pipette and spotted onto the filter paper sheet, and dried under aseptic conditions. The culture was conducted for 7d, and then each of the treated phosphate solubilizing circles was observed and its diameter was measured. Each treatment was repeated 3 times.

The measurement result is shown in a graph C of FIG. 5, and the strain ZBSF16 can generate a phosphate solubilizing ring with the diameter of 2.81+/-0.12 cm, which shows that the strain has the phosphate solubilizing effect.

5. Ammonia production capacity detection

The concentration was 1X 10 ⁸ cfu/mL ZBSF16 bacterial suspension is inoculated in 10mL according to the proportion of 0.1%

The culture was carried out overnight in a protease culture medium, 0.5mL of Nessler's reagent was added, and after 3 days of culture at 28℃it was observed whether the culture broth turned from yellow to deep yellow or brown.

As a result of measurement, see FIG. 5B, ZBSF16 was able to produce ammonia to change the culture broth from yellow to deep yellow.

6. IAA production ability assay

Picking up single colony of Paenibacillus Pityrosporum ZBSF16, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL is ZBSF16 bacterial suspension. Inoculating ZBSF16 bacterial suspension into DF culture medium and DF+ culture medium respectively at 0.1% (bacterial liquid amount/culture medium amount, v/v), culturing at 28deg.C for 7d, centrifuging 12000r/min for 5min, collecting 1ml supernatant, adding 50 μl Solution I into test tube

(10 mmol/L phosphoric acid) and 2ml Solution II (1 ml 0.5mol/L FeCl) ₃ Dissolved in 50ml of 35% HClO ₄ ) The reaction solution was reacted at room temperature for 25min after being mixed uniformly, absorbance at 530nm was detected, and IAA yield was compared on a standard curve and calculated. The results were averaged and repeated 3 times.

Weighing IAA pure product, dissolving in 1ml absolute ethanol, mixing, sucking 100 μl, adding deionized water to dilute to 1ml, and obtaining 100 μg ml ^-1 IAA mother liquor. The following aqueous IAA solutions were then prepared separately: 5 μg ml ^-1 、10μg ml ^-1 、15μg ml ^-1 、20μg ml ^-1 、25μg ml ^-1 、30μg ml ^-1 . Deionized water was used as a blank. And detecting the light absorption values of IAA solutions with different concentrations at 530nm, and drawing an IAA content standard curve.

The photograph of the IAA-producing ability is shown in the graph A of FIG. 5, and the result of the measurement is that ZBSF16 can produce IAA with the IAA content of 28.67 mu g ml ^-1 。

Example 4 Strain ZBSF16 growth Curve and pH determination

Picking up PaenibacillusInoculating single colony of bacillus ZBSF16 into LB liquid culture medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL is ZBSF16 bacterial suspension. The bacterial suspension is prepared according to the following ratio of 1:1000 were added to LB liquid medium and cultured at 28℃with shaking. OD of 48h strain was measured continuously every 4h ₆₀₀ The values, viable count and pH were repeated 3 times.

The measurement results are shown in FIG. 6, which shows that the strain ZBSF16 grows exponentially and OD 12-16h after inoculation ₆₀₀ A value of 1.0; the pH of the strain gradually increased to 8.35 during growth.

EXAMPLE 5 tolerance level of Strain ZBSF16 to antibiotics

9 antibiotics are selected: ampicillin (Amp), kanamycin (Kan), chloramphenicol (Chl), streptomycin (Str), tetracycline (Tet), gentamicin (Gen), rifampin (Rif), vancomycin (Van), spectinomycin (Spe), respectively preparing LB liquid media containing different antibiotics: ampicillin concentration in the prepared ampicillin-containing LB liquid medium was 50. Mu.g/mL, kanamycin concentration in the prepared kanamycin-containing LB liquid medium was 50. Mu.g/mL, chloramphenicol concentration in the prepared chloramphenicol-containing LB liquid medium was 50. Mu.g/mL, streptomycin concentration in the prepared streptomycin-containing LB liquid medium was 50. Mu.g/mL, tetracycline concentration in the prepared tetracycline-containing LB liquid medium was 50. Mu.g/mL, gentamicin concentration in the prepared gentamicin-containing LB liquid medium was 50. Mu.g/mL, rifampicin concentration in the prepared rifampicin-containing LB liquid medium was 50. Mu.g/mL, vancomycin concentration in the prepared vancomycin-containing LB liquid medium was 50. Mu.g/mL, and spectinomycin concentration in the prepared spectinomycin-containing LB liquid medium was 50. Mu.g/mL.

The preparation method of the ZBSF16 bacterial suspension comprises the following steps: selecting single colony of ZBSF16 strain, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL。

Inoculating 1×10 of 0.1% concentration respectively into the above 9 LB liquid media (control CK is LB liquid media) containing different antibiotics ⁸ cfu/mLZBSF16 bacterial suspension, and observing growth condition, and repeating for 3 times.

The results are shown in fig. 7, which demonstrate: the strain ZBSF16 is more sensitive to various antibiotics and has stronger resistance to spectinomycin (Spe) and streptomycin (Str).

Example 6 detection of the Effect of Strain ZBSF16 on control of white rot of grape

The white rot prevention effect of the grape (variety: red earth) is measured by adopting a spray inoculation method on the isolated leaves and fruits of the grape.

The test sets up 6 treatments in total:

(1) Inoculating white rot of grape

Scraping spores of strain GP1 of white rot fungus (Coniella vitis), preparing spore suspension with sterile water to 1×10 ⁸ And (5) spores/mL to obtain the white rot fungus spore liquid. Spraying and inoculating the isolated leaves and fruits of the grape with the white rot fungus spore liquid of the grape, and after culturing for 5 days at 28 ℃, counting the morbidity and the disease index. The grape white rot germ strain GP1 is preserved in the grape microorganism center of China Committee for culture Collection of microorganisms, and the accession number of the preservation center is recorded: CGMCC No.23888.

(2) Inoculating LB liquid culture medium

And (3) carrying out spray inoculation treatment on the isolated leaves and fruits of the grape by using an LB liquid culture medium, and counting the morbidity and the disease index after culturing for 5 days at 28 ℃.

(3) Inoculation sterile water

Spraying and inoculating in sterile water to the isolated leaves and fruits of grape, and culturing at 28deg.C for 5 days to count morbidity and disease index.

(4) Culture solution inoculated with ZBSF16

Selecting single colony of ZBSF16 strain, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL, diluted 100 times, and the culture solution of ZBSF16 was obtained. The culture solution of ZBSF16 is used for carrying out spray inoculation treatment on the isolated leaves and fruits of the grape, and after culturing for 5 days at 28 ℃, the morbidity and the disease index are counted.

(5) Inoculating the white rot of grape for 24 hours, and then inoculating a culture solution of ZBSF16 (grape white rot control experiment): the white rot fungus spore liquid (1 multiplied by 10) of the grape in the step (1) ⁸ Individual spores/mL) versus grapeAnd (3) carrying out spray inoculation treatment on the isolated leaves and fruits, carrying out spray inoculation treatment on the isolated leaves and fruits of the grape by using the culture solution of ZBSF16 in the step (4) after 24 hours, and counting the morbidity and the disease index after culturing for 5 days at 28 ℃.

(6) Inoculating white rot of grape (experiment for preventing white rot of grape) after inoculating culture solution of ZBSF16 for 24 hours: spraying the culture solution of ZBSF16 of (4) on the isolated leaves and fruits of grape for 24 hr, and collecting the spore solution (1×10) of white rot fungus of grape of (1) ⁸ Individual spores/mL) the in vitro leaves and fruits of the grape were subjected to spray inoculation treatment, and after 5 days of culture at 28 ℃, the morbidity and the disease index were counted. .

Each treatment was repeated 3 times for 10 plants. The condition of the in vitro leaves and fruits was observed daily thereafter, and the results are shown in panel B of FIG. 8.

Wherein, the classification standard of grape white rot leaves and fruits is as follows;

level 0: does not cause disease;

stage 1: the disease spots account for 0% -5% of the area of the disease leaves (disease fruits);

3 stages: the disease spots account for 5% -25% of the area of the disease leaves (disease fruits);

5 stages: the disease spots account for 25% -50% of the area of the disease leaves (disease fruits);

7 stages: the disease spots account for 50% -75% of the area of the disease leaves (disease fruits);

stage 9: the disease spots occupy more than 75% of the area of the disease leaves (disease fruits).

Calculating morbidity, disease index and prevention and treatment effect.

Morbidity = number of attacks/total number of surveys

Disease index = 100×Σ (number of leaves at each stage x representative value at each stage)/(total leaves investigated x representative value at highest stage);

preventive effect = (control disease index-treatment disease index)/control disease index x 100

Control effect = (control disease index-treatment disease index)/control disease index x 100

The results are shown in Table 4, and show that the culture solution of ZBSF16 is sprayed before the infection of the grape white rot, has good prevention effect on the grape white rot, and the culture solution of ZBSF16 is sprayed after the infection of the grape white rot, has good prevention effect on the grape white rot.

TABLE 4 control Effect of ZBSF16 strain on white rot fruits and leaves of grape

Note that: the different lower case letters in each column represent significant differences (P < 0.05).

EXAMPLE 7 determination of grape growth promoted by Strain ZBSF16

And (5) carrying out grape seedling growth promotion measurement by adopting a root irrigation method.

Selecting single colony of ZBSF16 strain, inoculating into LB liquid medium, shake culturing at 28deg.C and 180r/min to 1×10 ⁸ cfu/mL to obtain ZBSF16 bacterial suspension.

Under laboratory conditions, grape seedlings (about 3 leaves of annual seedlings of red earth) are root-irrigated, and the root-irrigated amount of each seedling is 50mL and the concentration is 10 ⁸ cfu/ml ZBSF16 bacterial suspension is irrigated once every two weeks for 4 times, and 9 strains are treated each by taking sterile water as a control. After two months, the young shoots of grape seedlings were measured for root length, fresh weight and dry weight of the above-ground and below-ground parts. The results of promoting grape growth by the strain ZBSF16 are shown in the A diagram of FIG. 8 and Table 5, and the effect of promoting grape growth by the strain ZBSF16 is obvious:

TABLE 5 action of Strain ZBSF16 on promoting grape growth

The present invention is described in detail above. It will be apparent to those skilled in the art that the present invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with respect to specific embodiments, it will be appreciated that the invention may be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The application of some of the basic features may be done in accordance with the scope of the claims that follow.

Claims

1. Paenibacillus picolinatus, characterized in that: the paenibacillus picolina is paenibacillus picolina (Paenibacillus peoriae), the strain number of the paenibacillus picolina is ZBSF16, and the registration number of the paenibacillus picolina in the common microorganism center of the China Committee for culture Collection of microorganisms is CGMCC No.24769.

2. A metabolite or culture of paenibacillus, characterized by: the metabolite is the fermentation broth of Paenibacillus picolinae according to claim 1; the culture is a substance obtained by culturing Paenibacillus cereus according to claim 1 in a microorganism culture medium.

3. The metabolite or culture of claim 2, characterized in that: the metabolite or culture has at least one of the following functions W1-W19:

w1, inhibiting the activity of bacteria;

w2, inhibiting the activity of gram-negative bacteria;

w3, inhibiting the activity of fungi;

w4, inhibiting the activity of white rot fungi (Coniella vitis);

w5, inhibiting the activity of anthrax bacteria (Gloeosporium fructigrum);

w6, inhibiting the activity of Botrytis cinerea;

w7, inhibiting the activity of Puccinia (Botryosphaeria dothidea);

w8, inhibiting the activity of Phomopsis (Diaporthe eres);

w9, inhibiting the activity of alternaria viticola (Alternaria viticola);

w10, inhibiting the activity of Mucor pulmonale (Pestalotiopsis clavispora);

w11, inhibits the activity of aspergillus niger (Aspergillus niger);

w12, inhibiting the activity of Fusarium oxysporum (Fusarium oxysporum);

w14, inhibiting the activity of Fusarium graminearum (Fusarium graminearum);

w15, inhibiting the activity of agrobacterium vitis (Agrobacterium vitis);

w16, activity to promote plant growth;

w17, an activity to promote the growth of Vitaceae plants;

w18, an activity of promoting the growth of Vitis plants;

w19, activity for promoting grape plant growth.

4. A product, characterized in that: the product comprises Paenibacillus picolinae according to claim 1 or/and the metabolite or culture according to any of claims 2 to 3.

5. The product according to claim 4, wherein: the product is any one of the following products:

u1, a product for preventing and/or treating grape white rot;

u2, a product for inhibiting fungi;

u3, a product for inhibiting bacteria;

u4, product for improving plant yield.

6. Use of paenibacillus picolinae according to claim 1 or/and of a metabolite or culture according to any of claims 2 to 3 or/and of a product according to claim 4 or 5 for the prevention and/or treatment of white rot of grape.

7. Use of paenibacillus pis ZBSF16 according to claim 1 or/and the metabolite or culture according to any of claims 2-3 or/and the product according to claim 4 or 5 for any of the following:

v1, use in inhibiting fungal activity;

v2, use in inhibiting bacterial activity;

v3, application in promoting plant growth.

8. A method of culturing paenibacillus ZBSF16 according to claim 1, wherein: comprising the step of culturing Paenibacillus licheniformis ZBSF16 according to claim 1 in a medium.

9. A method of preparing the product of claim 4 or 5, characterized in that: comprising the step of obtaining a product according to claim 1 comprising paenibacillus pis or/and a metabolite or culture according to any of claims 2-3 as a component of said product.