CN114085837A - Cell line with gene YTHDF1 knocked out and construction method thereof - Google Patents

Abstract

The invention discloses a cell line with a knockout gene YTHDF1 and a construction method thereof. The method utilizes a gRNA for knocking out YTHDF1 gene, and the coding sequence of the gRNA is shown in SEQ ID NO: 1, or a fragment thereof. The invention utilizes the gRNA designed by the inventor to accurately and efficiently knock out YTHDF1 gene through CRISPR/Cas9 system, thereby effectively constructing a YTHDF1 gene knock-out cell which can be regulated and controlled in real time and avoiding the risk of cell death caused by directly knocking out YTHDF1 gene. The establishment of YTHDF1 gene knockout cells further provides an effective cell model for the research of autophagy.

Description

Cell line with gene YTHDF1 knocked out and construction method thereof

Technical Field

The invention relates to the technical field of genetic engineering, in particular to a cell line with a knockout gene YTHDF1 and a construction method thereof.

Background

Autophagy (autophagy) is a catabolic mechanism possessed by the body and responsible for the degradation and recovery of macromolecular substances. Under physiological conditions, autophagy can degrade redundant cytoplasmic components, abnormal proteins, aged or damaged organelles, and the degraded products are recycled by the body, so that normal cellular homeostasis is maintained; under conditions of starvation, hypoxia and endoplasmic reticulum stress, the body relies on autophagy to maintain survival.

Autophagy is an ancient and highly conserved cytoprotective mechanism that not only plays an important role in maintaining homeostasis, but also participates in the development and progression of various diseases. Numerous studies have shown that autophagy dysfunction is closely related to the development of aging, tumors, neurodegenerative diseases, muscle-degenerative diseases, diabetes and immune diseases. Therefore, the method has important significance for the research of the autophagy control mechanism and the accurate diagnosis and the accurate treatment of human diseases.

YTHDF1 is RNA m localized in cytoplasm⁶A decorated reader capable of selectively recognizing m⁶A modified RNA and enhanced translation by interacting with translation initiation factors and ribosomes. In view of its role in regulating target mRNA translation, YTHDF1 plays an important role in tumorigenesis and development, etc. For example, YTHDF1 is expressed by m⁶The A-dependent manner promotes the translation of EIF3C mRNA, thereby promoting the development and metastasis of ovarian cancer (Jin, S., et al, USP19 models autophagy and anti viral animal responses by deubiquitting Beclin-1.EMBO J,2016.35(8): p.866-80). In addition, YTHDF1 also promotes the translation of the suppressor gene HINT2 mRNA in melanoma. However, the role of YTHDF1 in autophagy is not clear (Jia, r., et al., m.)⁶A modification suppresses ocular melanoma through modulating HINT2 mRNA translation.Mol Cancer,2019.18(1):p.161.)。

Disclosure of Invention

In order to overcome the defects of the prior art, the invention provides a cell line with a knockout gene YTHDF1 and a construction method thereof, and provides an effective cell model.

The first purpose of the invention is to provide a gRNA with YTHDF1 gene knocked out.

It is a second object of the present invention to provide a primer for synthesizing the above gRNA.

The third purpose of the invention is to provide the application of the gRNA and/or the primer in constructing YTHDF1 gene knockout cells.

The fourth purpose of the invention is to provide a method for constructing YTHDF1 gene knockout cells.

The fifth purpose of the invention is to provide YTHDF1 gene knockout type cells prepared by the method.

The sixth purpose of the invention is to provide the application of the YTHDF1 gene knockout cell in autophagy.

In order to achieve the purpose, the invention is realized by the following scheme:

a gRNA with YTHDF1 gene knocked out has a coding sequence shown in SEQ ID NO: 1, or a fragment thereof.

The nucleotide sequence of the primer for synthesizing the gRNA is shown as SEQ ID NO: 2 to 3.

The application of the gRNA and/or the primer in constructing YTHDF1 gene knockout cells is also within the protection scope of the invention.

A method for constructing YTHDF1 gene knockout cells comprises the following steps: the nucleotide sequence is shown as SEQ ID NO: 2-3, carrying out annealing reaction; connecting the obtained annealing product to a lentiviral vector to obtain a recombinant knockout vector; transferring the recombinant knockout vector into a receptor cell; inducing gene knockout by doxycycline to obtain the YTHDF1 gene knockout cell; the recipient cell is a cell that incorporates a vector expressing Cas 9; the construction method of the Cas9 expression vector comprises the following steps: cloning the Cas9 sequence on the PX330 vector to a pENTR-D-TOPO vector to obtain a pENTR-Cas9-TOPO vector; the Cas9 sequence was cloned by LR reaction using the pENTR-Cas9-TOPO vector to a nucleotide sequence as shown in SEQ ID NO: 4, namely a vector for expressing the Cas 9.

Preferably, the vector for expressing the Cas9 is Phage-tet-N-3xflag-SpCas9-DEST-UBC-neo1, and the nucleotide sequence of the vector is shown in SEQ ID NO: 5, respectively.

Preferably, the system of the annealing reaction is: the nucleotide sequence is shown as SEQ ID NO: 2, 4. mu.L; the nucleotide sequence is shown as SEQ ID NO: 3, 4. mu.L; 10 XNEB Buffer, 1. mu.L; ddH₂O，1μL。

Preferably, the annealing reaction procedure is: 10 minutes at 95 ℃; the mixture was left at room temperature for 2 hours.

Preferably, the lentiviral vector is lenti-sgRNA-PURO.

Preferably, the transfer is by packaging the recombinant knock-out vector as a lentivirus and infecting the recipient cells with the lentivirus.

More preferably, the lentiviral packaging plasmids psPAX2 and pmd2.g are also used for packaging of lentiviruses.

YTHDF1 gene knockout cells prepared by the method also fall within the protection scope of the present invention.

The application of the YTHDF1 gene knockout cell in autophagy is also within the protection scope of the invention.

Preferably, the YTHDF1 gene knock-out cell is induced to autophagy by using a medicament.

More preferably, the drug is rapamycin.

Compared with the prior art, the invention has the following beneficial effects:

the invention utilizes the gRNA designed by the inventor and adopts a CRISPR/Cas9 system to accurately and efficiently knock out YTHDF1 gene, thereby effectively constructing a YTHDF1 gene knock-out cell which can be regulated and controlled in real time and avoiding the risk of cell death caused by directly knocking out YTHDF1 gene. The establishment of YTHDF1 gene knockout cells further provides an effective cell model for the research of autophagy.

Drawings

FIG. 1 is a schematic diagram of lenti-sgRNA-PURO as a lentiviral expression vector.

FIG. 2 is a schematic representation of the vector Phage-tet-N-3xflag-SpCas9-DEST-UBC-neo 1.

FIG. 3 shows the identification of YTHDF1 gene knockout cell line.

FIG. 4 shows the confocal detection results of autophagy-related protein LC3 in YTHDF1 knockout cell line; a is LC3 foci generated when inducing autophagy in the YTHDF1 knock-out cell line; b is the statistical result of the LC3 aggregation number in A.

FIG. 5 shows the detection results of autophagy-related proteins in YTHDF1 knockout cell line.

Detailed Description

The present invention will be described in further detail with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 determination of knockout target site of YTHDF1 Gene and gRNA

A sequence of 240bp to 266bp corresponding to the first exon of a coding region of YTHDF1 Gene (Gene number Gene ID: 54915) is selected as a knockout target site, and a plurality of gRNAs are designed in total, wherein the specific sequences are shown as follows:

gRNA-1：TACCTGGGTGTCCACGCTGGTGG(SEQ ID NO：1)；

gRNA-2：CGCTACCTGGGTGTCCACGCTGG；

gRNA-3：GTAACCCGGCCCCGCTACCTGGG；

gRNA-4：GGCCACCAGCGTGGACACCCAGG。

example 2 construction of gRNA expression vector

First, experiment method

(1) DNA oligos for synthesizing gRNA were designed based on gRNA designed in example 1, and specific reference

The sequence of the substance is shown as follows:

gRNA1-FP：CACCGTACCTGGGTGTCCACGCTGG(SEQ ID NO：2)；

gRNA1-RP：AAACCCAGCGTGGACACCCAGGTA(SEQ ID NO：3)；

gRNA2-FP：CACCGCGCTACCTGGGTGTCCACGC；

gRNA2-RP：AAACGCGTGGACACCCAGGTAGCG；

gRNA3-FP：CACCGGTAACCCGGCCCCGCTACCT；

gRNA3-RP：AAACAGGTAGCGGGGCGGGTTAC；

gRNA4-FP：CACCGGGCCACCAGCGTGGACACCC；

gRNA4-RP：AAACGGGTGTCCACGCTGGTGGCC。

(2) the DNA oligos of 8 gRNAs synthesized above were treated with ddH₂O was dissolved and the concentration was adjusted to 100. mu.M.

The annealing reaction system is as follows: 4 μ L of gRNA1-FP or gRNA2-FP or gRNA3-FP or gRNA 4-FP; gRNA1-RP or gRNA2-RP orgRNA3-RP or gRNA4-RP, 4 μ L; 10 XNEB Buffer, 1. mu.L; ddH₂O，1μL。

The annealing reaction procedure is as follows: 10 minutes at 95 ℃; the mixture was left at room temperature for 2 hours.

Obtaining annealing products YTHDF1-sgRNA-1, YTHDF1-sgRNA-2, YTHDF1-sgRNA-3 and YTHDF 1-sgRNA-4.

(3) The lentivirus gRNA expression vector lenti-sgRNA-PURO is subjected to enzyme digestion by using endonuclease BmbI. The structure of the lenti-sgRNA-PURO vector is shown in FIG. 1.

The enzyme cutting system of the lenti-sgRNA-PURO vector is as follows: lenti-sgRNA-PURO, 1. mu.g; NEBbuffer 3.1, 2. mu.L; bsimb I, 2 μ L; add ddH₂O to 20. mu.L.

After digestion at 37 ℃ for 2 hours, the digestion vector was recovered by electrophoresis using 1% agarose gel, followed by gel recovery kit.

(4) YTHDF1-sgRNA-1, YTHDF1-sgRNA-2, YTHDF1-sgRNA-3 and YTHDF1-sgRNA-4 are respectively connected to the enzyme-digested lenti-sgRNA-PURO vector.

The system of the ligation reaction is: lenti-sgRNA-PURO, 25 ng; annealing products (YTHDF1-sgRNA-1, YTHDF1-sgRNA-2, YTHDF1-sgRNA-3, YTHDF1-sgRNA-4), 0.5 μ L; 10 XT 4 DNA ligase buffer, 0.5. mu.L; t4 DNA ligase, 0.25. mu.L; add ddH₂O to 5. mu.L.

And (5) connecting for 30-60 minutes at room temperature to obtain a connecting product.

(5) After transformation of the ligation products into DH 5. alpha. competent cells, monoclonal colonies were picked up in LB liquid medium containing ampicillin resistance, cultured overnight at 37 ℃ and 200rpm for 16 hours, endotoxin-free plasmids were extracted with a plasmid extraction kit using endotoxin and sent to the company for sequencing. And reserving recombinant plasmids with correct sequencing, namely gRNA expression vectors which are named as lenti-YTHDF1-gRNA-1, lenti-YTHDF1-gRNA-2, lenti-YTHDF1-gRNA-3 and lenti-YTHDF 1-gRNA-4.

Example 3 construction of YTHDF1 Gene knockout cell line

First, experiment method

(1) Construction of HeLa-GFP-LC3B cell capable of inducing expression of Cas9

Constructing a Phage-tet-N-3Xflag-SpCas9-DEST-UBC-neo1 vector shown in figure 2, wherein the specific method comprises the following steps: the Cas9 sequence on the PX330 vector was cloned into pENTR-D-TOPO vector by enzymatic ligation, and then the Cas9 sequence was cloned into pHAGE-Tet-N-3 XFLAG-DEST-UBC-neo vector by LR reaction (nucleotide sequence shown in SEQ ID NO: 4). Thus obtaining a vector for expressing Cas9, and the vector is named as Phage-tet-N-3xflag-SpCas9-DEST-UBC-neo1 (the nucleotide sequence is shown as SEQ ID NO: 5).

HEK293T cells were seeded into 6-well cell culture plates and transient transfection experiments were performed the next day when cell density reached 70%.

The specific method of transient transfection assay is as follows: add 1.2. mu.g of Phage-tet-N-3xflag-SpCas9-DEST-UBC-neo1 and 0.9. mu.g of psPAX2 and 0.3. mu.g of pMD2.G of lentiviral packaging plasmid to 200. mu.L of Opti-MEM medium and mix well; adding a StarFect transfection reagent of 7.2 mu of LGENStar into the Opti-MEM culture medium containing the plasmid, uniformly mixing by vortex oscillation, standing at room temperature for 15-20 minutes, adding into a cell culture medium, uniformly mixing, and placing at 37 ℃ in CO₂And culturing the cells in a constant-temperature incubator.

And after 6-8 hours of transfection, replacing the old culture medium with a fresh culture medium, and continuing to culture.

48 hours after transfection, the supernatant of HEK293T cells was collected, at which time the supernatant contained a lentivirus packaged with Phage-tet-N-3xflag-SpCas9-DEST-UBC-neo1 vector and was designated V-Cas 9.

After slow filtration of the supernatant with a 0.45 μ M filter, a virus solution containing V-Cas9 was obtained. Virus fluid volume as V-Cas 9: fresh medium volume 2: 1 to obtain a mixed solution of V-Cas9 virus solution and fresh culture medium.

Adding cationic polymer polybrene into the obtained mixed solution of the V-Cas9 virus solution and a fresh culture medium, wherein the volume ratio of polybrene to the mixed solution is 1: 800, mixing uniformly, adding into a mixture of 3.0 × 10⁵Density per well HeLa-GFP-LC3B cells seeded into 6 well cell culture plates (same as "HeLa-GFP-LC 3B cells" in "DOI: 10.15252/embj.201593596").

The infection was carried out by centrifugation at 600g for 90min at 37 ℃. And taking out the cells after the centrifugation is finished, and placing the cells in an incubator to continuously infect for 6-8 hours.

The culture was continued for 24 hours with replacement of fresh medium to restore the cell state.

Collecting cells, inoculating 30% of the cells into a new 6-well plate, adding Neomycin with the final concentration of 100 mu g/mL for suspension drug screening until all negative cells die, selecting positive monoclonals, inoculating the positive monoclonals into a 96-well plate, and carrying out expanded culture. The obtained positive cells are HeLa-GFP-LC3B cells expressing Cas 9.

(2) Construction of YTHDF1 gene inducible expression type knockout cell line

HEK293T cells were seeded into 6-well cell culture plates and transient transfection experiments were performed the next day when cell density reached 70%.

The specific method of transient transfection assay is as follows: mu.g of gRNA expression vectors (lenti-YTHDF1-gRNA-1, lenti-YTHDF1-gRNA-2, lenti-YTHDF1-gRNA-3, lenti-YTHDF1-gRNA-4) and 0.9. mu.g of psPAX2 and 0.3. mu.g of pMD2.G of lentivirus packaging plasmid were added to 200. mu.L of Opti-MEM medium and mixed well; adding 7.2 mu L of StarFect transfection reagent of GenStar into the above Opti-MEM medium containing the plasmid, vortexing, shaking, standing at room temperature for 15-20 min, adding into cell culture medium, mixing, and placing at 37 deg.C in CO₂And culturing the cells in a constant-temperature incubator.

And after 6-8 hours of transfection, replacing the old culture medium with a fresh culture medium, and continuing to culture.

After transfection for 48 hours, the supernatants of 4 HEK293T cells were collected, at this time, lentiviruses packaged with lenti-YTHDF1-gRNA-1, lenti-YTHDF1-gRNA-2, lenti-YTHDF1-gRNA-3, and lenti-YTHDF1-gRNA-4 vectors were contained in the supernatants, and the lentiviruses were named V-YTHDF1-gRNA-1, V-YTHDF1-gRNA-2, V-YTHDF1-gRNA-3, and V-YTHDF1-gRNA-4 in this order.

After the supernatant was slowly filtered through a 0.45. mu.M filter, viral solutions containing V-YTHDF1-gRNA-1, V-YTHDF1-gRNA-2, V-YTHDF1-gRNA-3, and V-YTHDF1-gRNA-4, respectively, were obtained. According to the volume of virus liquid: fresh medium volume 2: 1 to obtain a mixed solution 1 of V-YTHDF1-gRNA-1 virus liquid and a fresh culture medium, a mixed solution 2 of V-YTHDF1-gRNA-2 virus liquid and a fresh culture medium, a mixed solution 3 of V-YTHDF1-gRNA-3 virus liquid and a fresh culture medium, and a mixed solution 4 of V-YTHDF1-gRNA-4 virus liquid and a fresh culture medium.

Respectively adding cationic polymer polybrene into the obtained mixed solution 1-4, wherein the volume ratio of polybrene to the mixed solution is 1: 800, mixing uniformly, adding into a mixture of 3.0 × 10⁵Density of/well HeLa-GFP-LC3B cells expressing Cas9 were seeded into 6-well cell culture plates.

The infection was carried out by centrifugation at 600g for 90min at 37 ℃. And taking out the cells after the centrifugation is finished, and placing the cells in an incubator to continuously infect for 6-8 hours.

The culture was continued for 24 hours with replacement of fresh medium to restore the cell state. The obtained cell is an inducible YTHDF1 gene knockout cell line.

Doxycycline is added into the culture medium to be induced for 7 days, so that 4 YTHDF1 gene knockout cell lines which are named as HeLa-YTHDF1-gRNA-1, HeLa-YTHDF1-gRNA-2, HeLa-YTHDF1-gRNA-3 and HeLa-YTHDF1-gRNA-4 can be obtained.

The treatment groups were 4 YTHDF1 gene-knocked-out cell lines, which were designated as gRNA-1 group, gRNA-2 group, gRNA-3 group, and gRNA-4 group, respectively.

(3) Construction of sg _ NC cell lines

HEK293T cells were seeded into 6-well cell culture plates and transient transfection experiments were performed the next day when cell density reached 70%.

The specific method of transient transfection assay is as follows: mu.g of lentivirus gRNA expression vector lenti-sgRNA-PURO as well as 0.9. mu.g of psPAX2 and 0.3. mu.g of pMD2.G of the lentivirus packaging plasmid were added to 200. mu.L of Opti-MEM medium and mixed well; adding 7.2 mu L of StarFect transfection reagent of GenStar into the above Opti-MEM medium containing the plasmid, vortexing, shaking, standing at room temperature for 15-20 min, adding into cell culture medium, mixing, and placing at 37 deg.C in CO₂And culturing the cells in a constant-temperature incubator.

And after 6-8 hours of transfection, replacing the old culture medium with a fresh culture medium, and continuing to culture.

48 hours after transfection, the supernatant of HEK293T cells was collected, and this supernatant contained lentivirus packaged with the lenti-sgRNA-PURO vector and was designated V-sg _ NC.

After the supernatant was slowly filtered through a 0.45. mu.M filter, a virus solution containing V-sg _ NC was obtained. According to the volume of virus liquid: fresh medium volume 2: 1 to obtain a mixed solution of virus solution of V-sg _ NC and fresh culture medium.

Adding cationic polymer polybrene into the obtained virus solution of V-sg _ NC and fresh culture medium, wherein the volume ratio of polybrene to the mixed solution is 1: 800, mixing uniformly, adding into a mixture of 3.0 × 10⁵Density of/well HeLa-GFP-LC3B cells expressing Cas9 were seeded into 6-well cell culture plates.

The infection was carried out by centrifugation at 600g for 90min at 37 ℃. And taking out the cells after the centrifugation is finished, and placing the cells in an incubator to continuously infect for 6-8 hours.

The culture was continued for 24 hours with replacement of fresh medium to restore the cell state. The resulting cells were the sg _ NC cell line. The sg _ NC cell line was used as a control group without knockout of YTHDF1 gene, and named as SgNC group.

(4) Cell identification

YTHDF1 gene knock-out cell line and sg _ NC cell line were collected separately, lysed with RIPA at 12000rpm for 10min, the supernatant was collected, 6 × protein loading buffer was added, and the sample was boiled in a metal bath at 100 ℃ for 5 min. The protein expression level of YTHDF1 in each cell line was detected by Western blot experiment.

Second, experimental results

As shown in FIG. 3, in comparison with sgNC group, YTHDF1 gene-induced knockdown of 4 gRNAs designed in example 1 resulted in a decrease in the expression level of YTHDF1 proteins of HeLa-YTHDF1-gRNA-1, HeLa-YTHDF1-gRNA-2, HeLa-YTHDF1-gRNA-3, and HeLa-YTHDF1-gRNA-4, wherein the expression level of YTHDF1 protein of HeLa-YTHDF1-gRNA-1 was the lowest, indicating that the gRNA-1 designed in example 1 had the best effect of knocking down YTHDF1 gene.

Example 4 knockdown of YTHDF1 Gene positively regulates autophagy

First, experiment method

(1) Cell culture

The sg _ NC cell line obtained in example 3 and HeLa-YTHDF1-gRNA-1 were each expressed at 1X 10⁵Cells seeded on glass substrate at a density of one/mLPlacing in a culture dish at 37 deg.C and 5% CO₂Cultured in an incubator.

(2) Cell processing

An equal volume of DMSO was added to the sg _ NC cell line obtained in example 3 and HeLa-YTHDF1-gRNA-1, respectively, for 18 hours. The cells obtained were designated as sg _ NC-Mock and sg _ YTHDF 1-Mock.

The sg _ NC cell line obtained in example 3 and HeLa-YTHDF1-gRNA-1 were treated with Rapamycin (Rapamycin) at a final concentration of 250nM for 18 hours, respectively, to induce autophagy. The cells obtained were designated as sg _ NC-Rapamycin group and sg _ YTHDF1-Rapamycin group.

(3) Laser confocal detection of expression of autophagy-related protein LC3

The original medium was discarded and replaced with a medium without Rapamycin. And (3) shooting by using a laser confocal microscope, and adjusting parameters of the image by Zen 2008 software.

Second, experimental results

As shown in fig. 4A and fig. 4B, after knockout of YTHDF1, the aggregation point of LC3 was significantly reduced during the process of Rapamycin induced autophagy, indicating that YTHDF1 has the effect of promoting autophagy.

Example 5 Effect of knocking out YTHDF1 Gene on autophagy-related proteins

First, experiment method

(1) Cell culture

The sg _ NC cell line obtained in example 3 and HeLa-YTHDF1-gRNA-1 were each expressed at 1X 10⁵The cells/mL were plated on a cell culture dish with a glass bottom and placed at 37 ℃ in 5% CO₂Cultured in an incubator. The cells obtained were designated as sg _ NC group and sg _ YTHDF1 group.

(2) The sg _ NC and sg _ YTHDF1 groups were treated with or without Rapamycin at a final concentration of 250nM for 18 hours; the sg _ NC group and sg _ YTHDF1 group were treated with or without BafA1 at a final concentration of 0.5. mu.M for 18 hours.

(3) Western blot detection of expression level of autophagy-related protein

The influence of knocking out YTHDF1 gene on autophagy is further confirmed by indicating the progress of autophagy flow by detecting the degradation of autophagy substrate p 62. The method comprises the following specific steps:

1.120 mu L of low-salt lysate is used for cell lysis, protein concentration is measured, and 30 mu g of protein is taken for gel electrophoresis.

Electrophoresis at 2.80V for about 30min, and then 120V until bromophenol blue reaches the bottom of the gel.

3. After the electrophoresis, the proteins on the gel were transferred to PVDF membrane, wet-transferred at 100V for 100 min.

Sealing 4.5% skimmed milk at room temperature for 1 hr.

5. Primary antibody was incubated overnight. The primary antibody used is shown in table 1.

TABLE 1 information on primary and secondary antibodies used

6. After the primary antibody incubation was completed, the cells were washed 3 times with TBST for 5min, and incubated with secondary antibody at room temperature for 1 h. The secondary antibodies used are shown in table 1.

7. After the secondary antibody incubation was completed, the cells were washed 3 times with TBST for 5min each.

8. The chemical developer ECL emits light and is imaged using a Bio-rad gel chemical imaging System.

Second, experimental results

As shown in FIG. 5, it was found that the protein levels of LC 3I and LC3 II were decreased in the sg _ YTHDF1 group and the protein level of autophagy substrate p62 was increased in the sg _ NC group, compared to the sg _ NC group, after activation of autophagy with Rapamycin by Western blot assay. The YTHDF1 has the function of promoting autophagy.

When Rapamycin is used for activating autophagy, and BafA1 is added to inhibit autophagosome and lysosome from combining and stopping autophagy reaction, the proteins of LC 3I and LC3 II of the sg _ NC group are accumulated in a large amount, the protein level of a cell autophagy substrate p62 is increased, the proteins of LC 3I and LC3 II of the sg _ YTHDF1 group are accumulated in a small amount, and the protein level of a cell autophagy substrate p62 is basically unchanged, so that YTHDF1 is knocked out to further inhibit the progress of autophagy flow under the condition that the autophagy reaction is stopped. Indicating that YTHDF1 was indeed able to positively regulate autophagy.

It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.

Sequence listing

<110> Zhongshan university

<120> cell line with gene YTHDF1 knocked out and construction method thereof

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

tacctgggtg tccacgctgg tgg 23

<210> 2

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

caccgtacct gggtgtccac gctgg 25

<210> 3

<211> 24

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aaacccagcg tggacaccca ggta 24

<210> 4

<211> 11759

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60

cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120

tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca 180

ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240

agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300

agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg 360

ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420

cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480

gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540

tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600

agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag 660

cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720

caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780

aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg 840

aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg 900

caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct 960

gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat 1020

cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca 1080

ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc 1140

aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag 1200

tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 1260

aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 1320

gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 1380

cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 1440

gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 1500

ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 1560

actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 1620

gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 1680

aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 1740

ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 1800

tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 1860

actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 1920

cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 1980

cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccgaa ttcacaaatg 2040

gcagtattca tccacaattt taaaagaaaa ggggggattg gggggtacag tgcaggggaa 2100

agaatagtag acataatagc aacagacata caaactaaag aattacaaaa acaaattaca 2160

aaaattcaaa attttcgggt ttattacagg gacagcagag atccagtttg gactaggatc 2220

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 2280

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 2340

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 2400

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 2460

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 2520

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 2580

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 2640

gaccgatcca gcctccgcgg ccccgaacta gtccagtgtg gtggaattct gcagatatca 2700

acaagtttgt acaaaaaagc aggctccgcg gccgccccct tcaccatgga gaaaaaaatc 2760

actggatata ccaccgttga tatatcccaa tggcatcgta aagaacattt tgaggcattt 2820

cagtcagttg ctcaatgtac ctataaccag accgttcagc tggatattac ggccttttta 2880

aagaccgtaa agaaaaataa gcacaagttt tatccggcct ttattcacat tcttgcccgc 2940

ctgatgaatg ctcatccgga attccgtatg gcaatgaaag acggtgagct ggtgatatgg 3000

gatagtgttc acccttgtta caccgttttc catgagcaaa ctgaaacgtt ttcatcgctc 3060

tggagtgaat accacgacga tttccggcag tttctacaca tatattcgca agatgtggcg 3120

tgttacggtg aaaacctggc ctatttccct aaagggttta ttgagaatat gtttttcgtc 3180

tcagccaatc cctgggtgag tttcaccagt tttgatttaa acgtggccaa tatggacaac 3240

ttcttcgccc ccgttttcac catgggcaaa tattatacgc aaggcgacaa ggtgctgatg 3300

ccgctggcga ttcaggttca tcatgccgtc tgtgatggct tccatgtcgg cagaatgctt 3360

aatgaattac aacagtactg cgatgagtgg cagggcgggg cgtaaagatc tggatccggc 3420

ttactaaaag ccagataaca gtatgcgtat ttgcgcgctg atttttgcgg tataagaata 3480

tatactgata tgtatacccg aagtatgtca aaaagaggtg tgctatgaag cagcgtatta 3540

cagtgacagt tgacagcgac agctatcagt tgctcaaggc atatatgatg tcaatatctc 3600

cggtctggta agcacaacca tgcagaatga agcccgtcgt ctgcgtgccg aacgctggaa 3660

agcggaaaat caggaaggga tggctgaggt cgcccggttt attgaaatga acggctcttt 3720

tgctgacgag aacagggact ggtgaaatgc agtttaaggt ttacacctat aaaagagaga 3780

gccgttatcg tctgtttgtg gatgtacaga gtgatattat tgacacgccc gggcgacgga 3840

tggtgatccc cctggccagt gcacgtctgc tgtcagataa agtctcccgt gaactttacc 3900

cggtggtgca tatcggggat gaaagctggc gcatgatgac caccgatatg gccagtgtgc 3960

cggtctccgt tatcggggaa gaagtggctg atctcagcca ccgcgaaaat gacatcaaaa 4020

acgccattaa cctgatgttc tggggaatat aataagaatt cctagagctc gctgatcaga 4080

agggtgggcg cgccgaccca gctttcttgt acaaagtggt tgatatccag cacagtggcg 4140

gccgctcgat cgagaaagaa accgctgctg ctaaattcga acgccagcac atggacagcg 4200

gagccggcgc aggagccggc gctgacgcgc ctgactacaa agacgatgac gacaagggag 4260

attacaagga tgacgatgac aaaggcgcgt cgatggacga gaagaccacc ggctggcggg 4320

gcggccacgt ggtggagggc ctggccggcg agctggagca gctgcgggcc aggctggagc 4380

accaccctca gggccagcgg gagccctagt tcgaaggatc ccccatacga cgtcccagac 4440

tacgcttagt aatgattaat taaactagaa attctaccgg gtaggggagg cgcttttccc 4500

aaggcagtct ggagtaaccc acccaagatc tggcctccgc gccgggtttt ggcgcctccc 4560

gcgggcgccc ccctcctcac ggcgagcgct gccacgtcag acgaagggcg cagcgagcgt 4620

cctgatcctt ccgcccggac gctcaggaca gcggcccgct gctcataaga ctcggcctta 4680

gaaccccagt atcagcagaa ggacatttta ggacgggact tgggtgactc tagggcactg 4740

gttttctttc cagagagcgg aacaggcgag gaaaagtagt cccttctcgg cgattctgcg 4800

gagggatctc cgtggggcgg tgaacgccga tgattatata aggacgcgcc gggtgtggca 4860

cagctagttc cgtcgcagcc gggatttggg tcgcggttct tgtttgtgga tcgctgtgat 4920

cgtcacttgg tgagtagcgg gctgctgggc tggccggggc tttcgtggcc gccgggccgc 4980

tcggtgggac ggaagcgtgt ggagagaccg ccaagggctg tagtctgggt ccgcgagcaa 5040

ggttgccctg aactgggggt tggggggagc gcagcaaaat ggcggctgtt cccgagtctt 5100

gaatggaaga cgcttgtgag gcgggctgtg aggtcgttga aacaaggtgg ggggcatggt 5160

gggcggcaag aacccaaggt cttgaggcct tcgctaatgc gggaaagctc ttattcgggt 5220

gagatgggct ggggcaccat ctggggaccc tgacgtgaag tttgtcactg actggagaac 5280

tcggtttgtc gtctgttgcg ggggcggcag ttatggcggt gccgttgggc agtgcacccg 5340

tacctttggg agcgcgcgcc ctcgtcgtgt cgtgacgtca cccgttctgt tggcttataa 5400

tgcagggtgg ggccacctgc cggtaggtgt gcggtaggct tttctccgtc gcaggacgca 5460

gggttcgggc ctagggtagg ctctcctgaa tcgacaggcg ccggacctct ggtgagggga 5520

gggataagtg aggcgtcagt ttctttggtc ggttttatgt acctatcttc ttaagtagct 5580

gaagctccgg ttttgaacta tgcgctcggg gttggcgagt gtgttttgtg aagtttttta 5640

ggcacctttt gaaatgtaat catttgggtc aatatgtaat tttcagtgtt agactagtaa 5700

attgtccgct aaattctggc cgtttttggc ttttttgtta gacgaagctt ggtaccgagc 5760

tcggatctcc accccgtacc ggtcctgcag tcgaattcac catgtctaga ctggacaaga 5820

gcaaagtcat aaacggagct ctggaattac tcaatggtgt cggtatcgaa ggcctgacga 5880

caaggaaact cgctcaaaag ctgggagttg agcagcctac cctgtactgg cacgtgaaga 5940

acaagcgggc cctgctcgat gccctgccaa tcgagatgct ggacaggcat catacccact 6000

tctgccccct ggaaggcgag tcatggcaag actttctgcg gaacaacgcc aagtcatacc 6060

gctgtgctct cctctcacat cgcgacgggg ctaaagtgca tctcggcacc cgcccaacag 6120

agaaacagta cgaaaccctg gaaaatcagc tcgcgttcct gtgtcagcaa ggcttctccc 6180

tggagaacgc actgtacgct ctgtccgccg tgggccactt tacactgggc tgcgtattgg 6240

aggaacagga gcatcaagta gcaaaagagg aaagagagac acctaccacc gattctatgc 6300

ccccacttct gagacaagca attgagctgt tcgaccggca gggagccgaa cctgccttcc 6360

ttttcggcct ggaactaatc atatgtggcc tggagaaaca gctaaagtgc gaaagcggcg 6420

ggccgaccga cgcccttgac gattttgact tagacatgct cccagccgat gcccttgacg 6480

actttgacct tgatatgctg cctgctgacg ctcttgacga ttttgacctt gacatgctcc 6540

ccgggtaact aagtaaggat ccgcggccgc actagaggaa ttccgcccct ctccctcccc 6600

cccccctaac gttactggcc gaagccgctt ggaataaggc cggtgtgtgt ttgtctatat 6660

gttattttcc accatattgc cgtcttttgg caatgtgagg gcccggaaac ctggccctgt 6720

cttcttgacg agcattccta ggggtctttc ccctctcgcc aaaggaatgc aaggtctgtt 6780

gaatgtcgtg aaggaagcag ttcctctgga agcttcttga agacaaacaa cgtctgtagc 6840

gaccctttgc aggcagcgga accccccacc tggcgacagg tgcctctgcg gccaaaagcc 6900

acgtgtataa gatacacctg caaaggcggc acaaccccag tgccacgttg tgagttggat 6960

agttgtggaa agagtcaaat ggctctcctc aagcgtagtc aacaaggggc tgaaggatgc 7020

ccagaaggta ccccattgta tgggaatctg atctggggcc tcggtgcaca tgctttacat 7080

gtgtttagtc gaggttaaaa aaacgtctag gccccccgaa ccacggggac gtggttttcc 7140

tttgaaaaac acgatgataa gcttaccggt ccaccatgat tgaacaagat ggattgcacg 7200

caggttctcc ggccgcttgg gtggagaggc tattcggcta tgactgggca caacagacaa 7260

tcggctgctc tgatgccgcc gtgttccggc tgtcagcgca ggggcgcccg gttctttttg 7320

tcaagaccga cctgtccggt gccctgaatg aactgcaaga cgaggcagcg cggctatcgt 7380

ggctggccac gacgggcgtt ccttgcgcag ctgtgctcga cgttgtcact gaagcgggaa 7440

gggactggct gctattgggc gaagtgccgg ggcaggatct cctgtcatct caccttgctc 7500

ctgccgagaa agtatccatc atggctgatg caatgcggcg gctgcatacg cttgatccgg 7560

ctacctgccc attcgaccac caagcgaaac atcgcatcga gcgagcacgt actcggatgg 7620

aagccggtct tgtcgatcag gatgatctgg acgaagagca tcaggggctc gcgccagccg 7680

aactgttcgc caggctcaag gcgagcatgc ccgacggcga ggatctcgtc gtgacccatg 7740

gcgatgcctg cttgccgaat atcatggtgg aaaatggccg cttttctgga ttcatcgact 7800

gtggccggct gggtgtggcg gaccgctatc aggacatagc gttggctacc cgtgatattg 7860

ctgaagagct tggcggcgaa tgggctgacc gcttcctcgt gctttacggt atcgccgctc 7920

ccgattcgca gcgcatcgcc ttctatcgcc ttcttgacga gttcttctga tgtacaagta 7980

aagcggccgc gactctagat cataatcagc cataccacat ttgtagaggt tttacttgct 8040

ttaaaaaacc tcccacacct ccccctgaac ctgaaacata aaatgaatgc aattgttgtt 8100

gtttagtccc tcccaattcg atatcaagct tatcgatcga tagatcctaa tcaacctctg 8160

gattacaaaa tttgtgaaag attgactggt attcttaact atgttgctcc ttttacgcta 8220

tgtggatacg ctgctttaat gcctttgtat catgctattg cttcccgtat ggctttcatt 8280

ttctcctcct tgtataaatc ctggttgctg tctctttatg aggagttgtg gcccgttgtc 8340

aggcaacgtg gcgtggtgtg cactgtgttt gctgacgcaa cccccactgg ttggggcatt 8400

gccaccacct gtcagctcct ttccgggact ttcgctttcc ccctccctat tgccacggcg 8460

gaactcatcg ccgcctgcct tgcccgctgc tggacagggg ctcggctgtt gggcactgac 8520

aattccgtgg tgttgtcggg gaaatcatcg tcctttcctt ggctgctcgc ctgtgttgcc 8580

acctggattc tgcgcgggac gtccttctgc tacgtccctt cggccctcaa tccagcggac 8640

cttccttccc gcggcctgct gccggctctg cggcctcttc cgcgtcttcg ccttcgccct 8700

cagacgagtc ggatctccct ttgggccgcc tccccgcctg agatccttta agaccaatga 8760

cttacaaggc agctgtagat cttagccact ttttaaaaga aaagggggga ctggaagggc 8820

taattcactc ccaacgaaga caagatctgc tttttgcttg tactgggtct ctctggttag 8880

accagatctg agcctgggag ctctctggct aactagggaa cccactgctt aagcctcaat 8940

aaagcttgcc ttgagtgctt caagtagtgt gtgcccgtct gttgtgtgac tctggtaact 9000

agagatccct cagacccttt tagtcagtgt ggaaaatctc tagcagtagt agttcatgtc 9060

atcttattat tcagtattta taacttgcaa agaaatgaat atcagagagt gagaggcccg 9120

ggttaattaa ggaaagggct agatcattct tgaagacgaa agggcctcgt gatacgccta 9180

tttttatagg ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg 9240

ggaaatgtgc gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg 9300

ctcatgagac aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt 9360

attcaacatt tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt 9420

gctcacccag aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg 9480

ggttacatcg aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa 9540

cgttttccaa tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtgtt 9600

gacgccgggc aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag 9660

tactcaccag tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt 9720

gctgccataa ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga 9780

ccgaaggagc taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt 9840

tgggaaccgg agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta 9900

gcaatggcaa caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg 9960

caacaattaa tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc 10020

cttccggctg gctggtttat tgctgataaa tctggagccg gtgagcgtgg gtctcgcggt 10080

atcattgcag cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg 10140

gggagtcagg caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg 10200

attaagcatt ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa 10260

cttcattttt aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa 10320

atcccttaac gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga 10380

tcttcttgag atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg 10440

ctaccagcgg tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact 10500

ggcttcagca gagcgcagat accaaatact gttcttctag tgtagccgta gttaggccac 10560

cacttcaaga actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg 10620

gctgctgcca gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg 10680

gataaggcgc agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga 10740

acgacctaca ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc 10800

gaagggagaa aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg 10860

agggagcttc cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc 10920

tgacttgagc gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc 10980

agcaacgcgg cctttttacg gttcctggcc ttttgctggc cttttgctca catgttcttt 11040

cctgcgttat cccctgattc tgtggataac cgtattaccg cctttgagtg agctgatacc 11100

gctcgccgca gccgaacgac cgagcgcagc gagtcagtga gcgaggaagc ggaagagcgc 11160

ccaatacgca aaccgcctct ccccgcgcgt tggccgattc attaatgcag caagctcatg 11220

gctgactaat tttttttatt tatgcagagg ccgaggccgc ctcggcctct gagctattcc 11280

agaagtagtg aggaggcttt tttggaggcc taggcttttg caaaaagctc cccgtggcac 11340

gacaggtttc ccgactggaa agcgggcagt gagcgcaacg caattaatgt gagttagctc 11400

actcattagg caccccaggc tttacacttt atgcttccgg ctcgtatgtt gtgtggaatt 11460

gtgagcggat aacaatttca cacaggaaac agctatgaca tgattacgaa tttcacaaat 11520

aaagcatttt tttcactgca ttctagttgt ggtttgtcca aactcatcaa tgtatcttat 11580

catgtctgga tcaactggat aactcaagct aaccaaaatc atcccaaact tcccacccca 11640

taccctatta ccactgccaa ttacctgtgg tttcatttac tctaaacctg tgattcctct 11700

gaattatttt cattttaaag aaattgtatt tgttaaatat gtactacaaa cttagtagt 11759

<210> 5

<211> 14721

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

tggaagggct aattcactcc caaagaagac aagatatcct tgatctgtgg atctaccaca 60

cacaaggcta cttccctgat tagcagaact acacaccagg gccaggggtc agatatccac 120

tgacctttgg atggtgctac aagctagtac cagttgagcc agataaggta gaagaggcca 180

ataaaggaga gaacaccagc ttgttacacc ctgtgagcct gcatgggatg gatgacccgg 240

agagagaagt gttagagtgg aggtttgaca gccgcctagc atttcatcac gtggcccgag 300

agctgcatcc ggagtacttc aagaactgct gatatcgagc ttgctacaag ggactttccg 360

ctggggactt tccagggagg cgtggcctgg gcgggactgg ggagtggcga gccctcagat 420

cctgcatata agcagctgct ttttgcctgt actgggtctc tctggttaga ccagatctga 480

gcctgggagc tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct 540

tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc 600

agaccctttt agtcagtgtg gaaaatctct agcagtggcg cccgaacagg gacttgaaag 660

cgaaagggaa accagaggag ctctctcgac gcaggactcg gcttgctgaa gcgcgcacgg 720

caagaggcga ggggcggcga ctggtgagta cgccaaaaat tttgactagc ggaggctaga 780

aggagagaga tgggtgcgag agcgtcagta ttaagcgggg gagaattaga tcgcgatggg 840

aaaaaattcg gttaaggcca gggggaaaga aaaaatataa attaaaacat atagtatggg 900

caagcaggga gctagaacga ttcgcagtta atcctggcct gttagaaaca tcagaaggct 960

gtagacaaat actgggacag ctacaaccat cccttcagac aggatcagaa gaacttagat 1020

cattatataa tacagtagca accctctatt gtgtgcatca aaggatagag ataaaagaca 1080

ccaaggaagc tttagacaag atagaggaag agcaaaacaa aagtaagacc accgcacagc 1140

aagcggccgg ccgctgatct tcagacctgg aggaggagat atgagggaca attggagaag 1200

tgaattatat aaatataaag tagtaaaaat tgaaccatta ggagtagcac ccaccaaggc 1260

aaagagaaga gtggtgcaga gagaaaaaag agcagtggga ataggagctt tgttccttgg 1320

gttcttggga gcagcaggaa gcactatggg cgcagcgtca atgacgctga cggtacaggc 1380

cagacaatta ttgtctggta tagtgcagca gcagaacaat ttgctgaggg ctattgaggc 1440

gcaacagcat ctgttgcaac tcacagtctg gggcatcaag cagctccagg caagaatcct 1500

ggctgtggaa agatacctaa aggatcaaca gctcctgggg atttggggtt gctctggaaa 1560

actcatttgc accactgctg tgccttggaa tgctagttgg agtaataaat ctctggaaca 1620

gatttggaat cacacgacct ggatggagtg ggacagagaa attaacaatt acacaagctt 1680

aatacactcc ttaattgaag aatcgcaaaa ccagcaagaa aagaatgaac aagaattatt 1740

ggaattagat aaatgggcaa gtttgtggaa ttggtttaac ataacaaatt ggctgtggta 1800

tataaaatta ttcataatga tagtaggagg cttggtaggt ttaagaatag tttttgctgt 1860

actttctata gtgaatagag ttaggcaggg atattcacca ttatcgtttc agacccacct 1920

cccaaccccg aggggacccg acaggcccga aggaatagaa gaagaaggtg gagagagaga 1980

cagagacaga tccattcgat tagtgaacgg atctcgacgg tatcgccgaa ttcacaaatg 2040

gcagtattca tccacaattt taaaagaaaa ggggggattg gggggtacag tgcaggggaa 2100

agaatagtag acataatagc aacagacata caaactaaag aattacaaaa acaaattaca 2160

aaaattcaaa attttcgggt ttattacagg gacagcagag atccagtttg gactaggatc 2220

ctttaccact ccctatcagt gatagagaaa agtgaaagtc gagtttacca ctccctatca 2280

gtgatagaga aaagtgaaag tcgagtttac cactccctat cagtgataga gaaaagtgaa 2340

agtcgagttt accactccct atcagtgata gagaaaagtg aaagtcgagt ttaccactcc 2400

ctatcagtga tagagaaaag tgaaagtcga gtttaccact ccctatcagt gatagagaaa 2460

agtgaaagtc gagtttacca ctccctatca gtgatagaga aaagtgaaag tcgagctcgg 2520

tacccgggtc gaggtaggcg tgtacggtgg gaggcctata taagcagagc tcgtttagtg 2580

aaccgtcaga tcgcctggag acgccatcca cgctgttttg acctccatag aagacaccgg 2640

gaccgatcca gcctccgcgg ccccgaacta gtccagtgtg gtggaattct gcagatatca 2700

acaagtttgt acaaaaaagc aggctccgcg gccgccccct tcaccatgga ctataaggac 2760

cacgacggag actacaagga tcatgatatt gattacaaag acgatgacga taagatggcc 2820

ccaaagaaga agcggaaggt cggtatccac ggagtcccag cagccgacaa gaagtacagc 2880

atcggcctgg acatcggcac caactctgtg ggctgggccg tgatcaccga cgagtacaag 2940

gtgcccagca agaaattcaa ggtgctgggc aacaccgacc ggcacagcat caagaagaac 3000

ctgatcggag ccctgctgtt cgacagcggc gaaacagccg aggccacccg gctgaagaga 3060

accgccagaa gaagatacac cagacggaag aaccggatct gctatctgca agagatcttc 3120

agcaacgaga tggccaaggt ggacgacagc ttcttccaca gactggaaga gtccttcctg 3180

gtggaagagg ataagaagca cgagcggcac cccatcttcg gcaacatcgt ggacgaggtg 3240

gcctaccacg agaagtaccc caccatctac cacctgagaa agaaactggt ggacagcacc 3300

gacaaggccg acctgcggct gatctatctg gccctggccc acatgatcaa gttccggggc 3360

cacttcctga tcgagggcga cctgaacccc gacaacagcg acgtggacaa gctgttcatc 3420

cagctggtgc agacctacaa ccagctgttc gaggaaaacc ccatcaacgc cagcggcgtg 3480

gacgccaagg ccatcctgtc tgccagactg agcaagagca gacggctgga aaatctgatc 3540

gcccagctgc ccggcgagaa gaagaatggc ctgttcggaa acctgattgc cctgagcctg 3600

ggcctgaccc ccaacttcaa gagcaacttc gacctggccg aggatgccaa actgcagctg 3660

agcaaggaca cctacgacga cgacctggac aacctgctgg cccagatcgg cgaccagtac 3720

gccgacctgt ttctggccgc caagaacctg tccgacgcca tcctgctgag cgacatcctg 3780

agagtgaaca ccgagatcac caaggccccc ctgagcgcct ctatgatcaa gagatacgac 3840

gagcaccacc aggacctgac cctgctgaaa gctctcgtgc ggcagcagct gcctgagaag 3900

tacaaagaga ttttcttcga ccagagcaag aacggctacg ccggctacat tgacggcgga 3960

gccagccagg aagagttcta caagttcatc aagcccatcc tggaaaagat ggacggcacc 4020

gaggaactgc tcgtgaagct gaacagagag gacctgctgc ggaagcagcg gaccttcgac 4080

aacggcagca tcccccacca gatccacctg ggagagctgc acgccattct gcggcggcag 4140

gaagattttt acccattcct gaaggacaac cgggaaaaga tcgagaagat cctgaccttc 4200

cgcatcccct actacgtggg ccctctggcc aggggaaaca gcagattcgc ctggatgacc 4260

agaaagagcg aggaaaccat caccccctgg aacttcgagg aagtggtgga caagggcgct 4320

tccgcccaga gcttcatcga gcggatgacc aacttcgata agaacctgcc caacgagaag 4380

gtgctgccca agcacagcct gctgtacgag tacttcaccg tgtataacga gctgaccaaa 4440

gtgaaatacg tgaccgaggg aatgagaaag cccgccttcc tgagcggcga gcagaaaaag 4500

gccatcgtgg acctgctgtt caagaccaac cggaaagtga ccgtgaagca gctgaaagag 4560

gactacttca agaaaatcga gtgcttcgac tccgtggaaa tctccggcgt ggaagatcgg 4620

ttcaacgcct ccctgggcac ataccacgat ctgctgaaaa ttatcaagga caaggacttc 4680

ctggacaatg aggaaaacga ggacattctg gaagatatcg tgctgaccct gacactgttt 4740

gaggacagag agatgatcga ggaacggctg aaaacctatg cccacctgtt cgacgacaaa 4800

gtgatgaagc agctgaagcg gcggagatac accggctggg gcaggctgag ccggaagctg 4860

atcaacggca tccgggacaa gcagtccggc aagacaatcc tggatttcct gaagtccgac 4920

ggcttcgcca acagaaactt catgcagctg atccacgacg acagcctgac ctttaaagag 4980

gacatccaga aagcccaggt gtccggccag ggcgatagcc tgcacgagca cattgccaat 5040

ctggccggca gccccgccat taagaagggc atcctgcaga cagtgaaggt ggtggacgag 5100

ctcgtgaaag tgatgggccg gcacaagccc gagaacatcg tgatcgaaat ggccagagag 5160

aaccagacca cccagaaggg acagaagaac agccgcgaga gaatgaagcg gatcgaagag 5220

ggcatcaaag agctgggcag ccagatcctg aaagaacacc ccgtggaaaa cacccagctg 5280

cagaacgaga agctgtacct gtactacctg cagaatgggc gggatatgta cgtggaccag 5340

gaactggaca tcaaccggct gtccgactac gatgtggacc atatcgtgcc tcagagcttt 5400

ctgaaggacg actccatcga caacaaggtg ctgaccagaa gcgacaagaa ccggggcaag 5460

agcgacaacg tgccctccga agaggtcgtg aagaagatga agaactactg gcggcagctg 5520

ctgaacgcca agctgattac ccagagaaag ttcgacaatc tgaccaaggc cgagagaggc 5580

ggcctgagcg aactggataa ggccggcttc atcaagagac agctggtgga aacccggcag 5640

atcacaaagc acgtggcaca gatcctggac tcccggatga acactaagta cgacgagaat 5700

gacaagctga tccgggaagt gaaagtgatc accctgaagt ccaagctggt gtccgatttc 5760

cggaaggatt tccagtttta caaagtgcgc gagatcaaca actaccacca cgcccacgac 5820

gcctacctga acgccgtcgt gggaaccgcc ctgatcaaaa agtaccctaa gctggaaagc 5880

gagttcgtgt acggcgacta caaggtgtac gacgtgcgga agatgatcgc caagagcgag 5940

caggaaatcg gcaaggctac cgccaagtac ttcttctaca gcaacatcat gaactttttc 6000

aagaccgaga ttaccctggc caacggcgag atccggaagc ggcctctgat cgagacaaac 6060

ggcgaaaccg gggagatcgt gtgggataag ggccgggatt ttgccaccgt gcggaaagtg 6120

ctgagcatgc cccaagtgaa tatcgtgaaa aagaccgagg tgcagacagg cggcttcagc 6180

aaagagtcta tcctgcccaa gaggaacagc gataagctga tcgccagaaa gaaggactgg 6240

gaccctaaga agtacggcgg cttcgacagc cccaccgtgg cctattctgt gctggtggtg 6300

gccaaagtgg aaaagggcaa gtccaagaaa ctgaagagtg tgaaagagct gctggggatc 6360

accatcatgg aaagaagcag cttcgagaag aatcccatcg actttctgga agccaagggc 6420

tacaaagaag tgaaaaagga cctgatcatc aagctgccta agtactccct gttcgagctg 6480

gaaaacggcc ggaagagaat gctggcctct gccggcgaac tgcagaaggg aaacgaactg 6540

gccctgccct ccaaatatgt gaacttcctg tacctggcca gccactatga gaagctgaag 6600

ggctcccccg aggataatga gcagaaacag ctgtttgtgg aacagcacaa gcactacctg 6660

gacgagatca tcgagcagat cagcgagttc tccaagagag tgatcctggc cgacgctaat 6720

ctggacaaag tgctgtccgc ctacaacaag caccgggata agcccatcag agagcaggcc 6780

gagaatatca tccacctgtt taccctgacc aatctgggag cccctgccgc cttcaagtac 6840

tttgacacca ccatcgaccg gaagaggtac accagcacca aagaggtgct ggacgccacc 6900

ctgatccacc agagcatcac cggcctgtac gagacacgga tcgacctgtc tcagctggga 6960

ggcgacaaaa ggccggcggc cacgaaaaag gccggccagg caaaaaagaa aaagtaagaa 7020

ttcctagagc tcgctgatca gaagggtggg cgcgccgacc cagctttctt gtacaaagtg 7080

gttgatatcc agcacagtgg cggccgctcg atcgagaaag aaaccgctgc tgctaaattc 7140

gaacgccagc acatggacag cggagccggc gcaggagccg gcgctgacgc gcctgactac 7200

aaagacgatg acgacaaggg agattacaag gatgacgatg acaaaggcgc gtcgatggac 7260

gagaagacca ccggctggcg gggcggccac gtggtggagg gcctggccgg cgagctggag 7320

cagctgcggg ccaggctgga gcaccaccct cagggccagc gggagcccta gttcgaagga 7380

tcccccatac gacgtcccag actacgctta gtaatgatta attaaactag aaattctacc 7440

gggtagggga ggcgcttttc ccaaggcagt ctggagtaac ccacccaaga tctggcctcc 7500

gcgccgggtt ttggcgcctc ccgcgggcgc ccccctcctc acggcgagcg ctgccacgtc 7560

agacgaaggg cgcagcgagc gtcctgatcc ttccgcccgg acgctcagga cagcggcccg 7620

ctgctcataa gactcggcct tagaacccca gtatcagcag aaggacattt taggacggga 7680

cttgggtgac tctagggcac tggttttctt tccagagagc ggaacaggcg aggaaaagta 7740

gtcccttctc ggcgattctg cggagggatc tccgtggggc ggtgaacgcc gatgattata 7800

taaggacgcg ccgggtgtgg cacagctagt tccgtcgcag ccgggatttg ggtcgcggtt 7860

cttgtttgtg gatcgctgtg atcgtcactt ggtgagtagc gggctgctgg gctggccggg 7920

gctttcgtgg ccgccgggcc gctcggtggg acggaagcgt gtggagagac cgccaagggc 7980

tgtagtctgg gtccgcgagc aaggttgccc tgaactgggg gttgggggga gcgcagcaaa 8040

atggcggctg ttcccgagtc ttgaatggaa gacgcttgtg aggcgggctg tgaggtcgtt 8100

gaaacaaggt ggggggcatg gtgggcggca agaacccaag gtcttgaggc cttcgctaat 8160

gcgggaaagc tcttattcgg gtgagatggg ctggggcacc atctggggac cctgacgtga 8220

agtttgtcac tgactggaga actcggtttg tcgtctgttg cgggggcggc agttatggcg 8280

gtgccgttgg gcagtgcacc cgtacctttg ggagcgcgcg ccctcgtcgt gtcgtgacgt 8340

cacccgttct gttggcttat aatgcagggt ggggccacct gccggtaggt gtgcggtagg 8400

cttttctccg tcgcaggacg cagggttcgg gcctagggta ggctctcctg aatcgacagg 8460

cgccggacct ctggtgaggg gagggataag tgaggcgtca gtttctttgg tcggttttat 8520

gtacctatct tcttaagtag ctgaagctcc ggttttgaac tatgcgctcg gggttggcga 8580

gtgtgttttg tgaagttttt taggcacctt ttgaaatgta atcatttggg tcaatatgta 8640

attttcagtg ttagactagt aaattgtccg ctaaattctg gccgtttttg gcttttttgt 8700

tagacgaagc ttggtaccga gctcggatct ccaccccgta ccggtcctgc agtcgaattc 8760

accatgtcta gactggacaa gagcaaagtc ataaacggag ctctggaatt actcaatggt 8820

gtcggtatcg aaggcctgac gacaaggaaa ctcgctcaaa agctgggagt tgagcagcct 8880

accctgtact ggcacgtgaa gaacaagcgg gccctgctcg atgccctgcc aatcgagatg 8940

ctggacaggc atcataccca cttctgcccc ctggaaggcg agtcatggca agactttctg 9000

cggaacaacg ccaagtcata ccgctgtgct ctcctctcac atcgcgacgg ggctaaagtg 9060

catctcggca cccgcccaac agagaaacag tacgaaaccc tggaaaatca gctcgcgttc 9120

ctgtgtcagc aaggcttctc cctggagaac gcactgtacg ctctgtccgc cgtgggccac 9180

tttacactgg gctgcgtatt ggaggaacag gagcatcaag tagcaaaaga ggaaagagag 9240

acacctacca ccgattctat gcccccactt ctgagacaag caattgagct gttcgaccgg 9300

cagggagccg aacctgcctt ccttttcggc ctggaactaa tcatatgtgg cctggagaaa 9360

cagctaaagt gcgaaagcgg cgggccgacc gacgcccttg acgattttga cttagacatg 9420

ctcccagccg atgcccttga cgactttgac cttgatatgc tgcctgctga cgctcttgac 9480

gattttgacc ttgacatgct ccccgggtaa ctaagtaagg atccgcggcc gcactagagg 9540

aattccgccc ctctccctcc ccccccccta acgttactgg ccgaagccgc ttggaataag 9600

gccggtgtgt gtttgtctat atgttatttt ccaccatatt gccgtctttt ggcaatgtga 9660

gggcccggaa acctggccct gtcttcttga cgagcattcc taggggtctt tcccctctcg 9720

ccaaaggaat gcaaggtctg ttgaatgtcg tgaaggaagc agttcctctg gaagcttctt 9780

gaagacaaac aacgtctgta gcgacccttt gcaggcagcg gaacccccca cctggcgaca 9840

ggtgcctctg cggccaaaag ccacgtgtat aagatacacc tgcaaaggcg gcacaacccc 9900

agtgccacgt tgtgagttgg atagttgtgg aaagagtcaa atggctctcc tcaagcgtag 9960

tcaacaaggg gctgaaggat gcccagaagg taccccattg tatgggaatc tgatctgggg 10020

cctcggtgca catgctttac atgtgtttag tcgaggttaa aaaaacgtct aggccccccg 10080

aaccacgggg acgtggtttt cctttgaaaa acacgatgat aagcttaccg gtccaccatg 10140

attgaacaag atggattgca cgcaggttct ccggccgctt gggtggagag gctattcggc 10200

tatgactggg cacaacagac aatcggctgc tctgatgccg ccgtgttccg gctgtcagcg 10260

caggggcgcc cggttctttt tgtcaagacc gacctgtccg gtgccctgaa tgaactgcaa 10320

gacgaggcag cgcggctatc gtggctggcc acgacgggcg ttccttgcgc agctgtgctc 10380

gacgttgtca ctgaagcggg aagggactgg ctgctattgg gcgaagtgcc ggggcaggat 10440

ctcctgtcat ctcaccttgc tcctgccgag aaagtatcca tcatggctga tgcaatgcgg 10500

cggctgcata cgcttgatcc ggctacctgc ccattcgacc accaagcgaa acatcgcatc 10560

gagcgagcac gtactcggat ggaagccggt cttgtcgatc aggatgatct ggacgaagag 10620

catcaggggc tcgcgccagc cgaactgttc gccaggctca aggcgagcat gcccgacggc 10680

gaggatctcg tcgtgaccca tggcgatgcc tgcttgccga atatcatggt ggaaaatggc 10740

cgcttttctg gattcatcga ctgtggccgg ctgggtgtgg cggaccgcta tcaggacata 10800

gcgttggcta cccgtgatat tgctgaagag cttggcggcg aatgggctga ccgcttcctc 10860

gtgctttacg gtatcgccgc tcccgattcg cagcgcatcg ccttctatcg ccttcttgac 10920

gagttcttct gatgtacaag taaagcggcc gcgactctag atcataatca gccataccac 10980

atttgtagag gttttacttg ctttaaaaaa cctcccacac ctccccctga acctgaaaca 11040

taaaatgaat gcaattgttg ttgtttagtc cctcccaatt cgatatcaag cttatcgatc 11100

gatagatcct aatcaacctc tggattacaa aatttgtgaa agattgactg gtattcttaa 11160

ctatgttgct ccttttacgc tatgtggata cgctgcttta atgcctttgt atcatgctat 11220

tgcttcccgt atggctttca ttttctcctc cttgtataaa tcctggttgc tgtctcttta 11280

tgaggagttg tggcccgttg tcaggcaacg tggcgtggtg tgcactgtgt ttgctgacgc 11340

aacccccact ggttggggca ttgccaccac ctgtcagctc ctttccggga ctttcgcttt 11400

ccccctccct attgccacgg cggaactcat cgccgcctgc cttgcccgct gctggacagg 11460

ggctcggctg ttgggcactg acaattccgt ggtgttgtcg gggaaatcat cgtcctttcc 11520

ttggctgctc gcctgtgttg ccacctggat tctgcgcggg acgtccttct gctacgtccc 11580

ttcggccctc aatccagcgg accttccttc ccgcggcctg ctgccggctc tgcggcctct 11640

tccgcgtctt cgccttcgcc ctcagacgag tcggatctcc ctttgggccg cctccccgcc 11700

tgagatcctt taagaccaat gacttacaag gcagctgtag atcttagcca ctttttaaaa 11760

gaaaaggggg gactggaagg gctaattcac tcccaacgaa gacaagatct gctttttgct 11820

tgtactgggt ctctctggtt agaccagatc tgagcctggg agctctctgg ctaactaggg 11880

aacccactgc ttaagcctca ataaagcttg ccttgagtgc ttcaagtagt gtgtgcccgt 11940

ctgttgtgtg actctggtaa ctagagatcc ctcagaccct tttagtcagt gtggaaaatc 12000

tctagcagta gtagttcatg tcatcttatt attcagtatt tataacttgc aaagaaatga 12060

atatcagaga gtgagaggcc cgggttaatt aaggaaaggg ctagatcatt cttgaagacg 12120

aaagggcctc gtgatacgcc tatttttata ggttaatgtc atgataataa tggtttctta 12180

gacgtcaggt ggcacttttc ggggaaatgt gcgcggaacc cctatttgtt tatttttcta 12240

aatacattca aatatgtatc cgctcatgag acaataaccc tgataaatgc ttcaataata 12300

ttgaaaaagg aagagtatga gtattcaaca tttccgtgtc gcccttattc ccttttttgc 12360

ggcattttgc cttcctgttt ttgctcaccc agaaacgctg gtgaaagtaa aagatgctga 12420

agatcagttg ggtgcacgag tgggttacat cgaactggat ctcaacagcg gtaagatcct 12480

tgagagtttt cgccccgaag aacgttttcc aatgatgagc acttttaaag ttctgctatg 12540

tggcgcggta ttatcccgtg ttgacgccgg gcaagagcaa ctcggtcgcc gcatacacta 12600

ttctcagaat gacttggttg agtactcacc agtcacagaa aagcatctta cggatggcat 12660

gacagtaaga gaattatgca gtgctgccat aaccatgagt gataacactg cggccaactt 12720

acttctgaca acgatcggag gaccgaagga gctaaccgct tttttgcaca acatggggga 12780

tcatgtaact cgccttgatc gttgggaacc ggagctgaat gaagccatac caaacgacga 12840

gcgtgacacc acgatgcctg tagcaatggc aacaacgttg cgcaaactat taactggcga 12900

actacttact ctagcttccc ggcaacaatt aatagactgg atggaggcgg ataaagttgc 12960

aggaccactt ctgcgctcgg cccttccggc tggctggttt attgctgata aatctggagc 13020

cggtgagcgt gggtctcgcg gtatcattgc agcactgggg ccagatggta agccctcccg 13080

tatcgtagtt atctacacga cggggagtca ggcaactatg gatgaacgaa atagacagat 13140

cgctgagata ggtgcctcac tgattaagca ttggtaactg tcagaccaag tttactcata 13200

tatactttag attgatttaa aacttcattt ttaatttaaa aggatctagg tgaagatcct 13260

ttttgataat ctcatgacca aaatccctta acgtgagttt tcgttccact gagcgtcaga 13320

ccccgtagaa aagatcaaag gatcttcttg agatcctttt tttctgcgcg taatctgctg 13380

cttgcaaaca aaaaaaccac cgctaccagc ggtggtttgt ttgccggatc aagagctacc 13440

aactcttttt ccgaaggtaa ctggcttcag cagagcgcag ataccaaata ctgttcttct 13500

agtgtagccg tagttaggcc accacttcaa gaactctgta gcaccgccta catacctcgc 13560

tctgctaatc ctgttaccag tggctgctgc cagtggcgat aagtcgtgtc ttaccgggtt 13620

ggactcaaga cgatagttac cggataaggc gcagcggtcg ggctgaacgg ggggttcgtg 13680

cacacagccc agcttggagc gaacgaccta caccgaactg agatacctac agcgtgagct 13740

atgagaaagc gccacgcttc ccgaagggag aaaggcggac aggtatccgg taagcggcag 13800

ggtcggaaca ggagagcgca cgagggagct tccaggggga aacgcctggt atctttatag 13860

tcctgtcggg tttcgccacc tctgacttga gcgtcgattt ttgtgatgct cgtcaggggg 13920

gcggagccta tggaaaaacg ccagcaacgc ggccttttta cggttcctgg ccttttgctg 13980

gccttttgct cacatgttct ttcctgcgtt atcccctgat tctgtggata accgtattac 14040

cgcctttgag tgagctgata ccgctcgccg cagccgaacg accgagcgca gcgagtcagt 14100

gagcgaggaa gcggaagagc gcccaatacg caaaccgcct ctccccgcgc gttggccgat 14160

tcattaatgc agcaagctca tggctgacta atttttttta tttatgcaga ggccgaggcc 14220

gcctcggcct ctgagctatt ccagaagtag tgaggaggct tttttggagg cctaggcttt 14280

tgcaaaaagc tccccgtggc acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa 14340

cgcaattaat gtgagttagc tcactcatta ggcaccccag gctttacact ttatgcttcc 14400

ggctcgtatg ttgtgtggaa ttgtgagcgg ataacaattt cacacaggaa acagctatga 14460

catgattacg aatttcacaa ataaagcatt tttttcactg cattctagtt gtggtttgtc 14520

caaactcatc aatgtatctt atcatgtctg gatcaactgg ataactcaag ctaaccaaaa 14580

tcatcccaaa cttcccaccc cataccctat taccactgcc aattacctgt ggtttcattt 14640

actctaaacc tgtgattcct ctgaattatt ttcattttaa agaaattgta tttgttaaat 14700

atgtactaca aacttagtag t 14721

Claims (10)

1. A gRNA for knocking out YTHDF1 gene is characterized in that the coding sequence of the gRNA is shown in SEQ ID NO: 1, or a fragment thereof.

2. A primer for synthesizing gRNA is characterized in that the nucleotide sequence of the primer is shown in SEQ ID NO: 2 to 3.

3. Use of a gRNA of claim 1 and/or a primer of claim 2 in the construction of a YTHDF1 gene knock-out cell.

4. A method for constructing YTHDF1 gene knockout type cells is characterized by comprising the following steps: subjecting the primer of claim 2 to an annealing reaction; connecting the obtained annealing product to a lentiviral vector to obtain a recombinant knockout vector; transferring the recombinant knockout vector into a receptor cell; inducing gene knockout by doxycycline to obtain the YTHDF1 gene knockout cell;

the recipient cell is a cell that incorporates a vector expressing Cas 9;

the construction method of the Cas9 expression vector comprises the following steps: cloning the Cas9 sequence on the PX330 vector to a pENTR-D-TOPO vector to obtain a pENTR-Cas9-TOPO vector; the Cas9 sequence was cloned by LR reaction using the pENTR-Cas9-TOPO vector to a nucleotide sequence as shown in SEQ ID NO: 4, namely a vector for expressing the Cas 9.

5. The method according to claim 4, wherein the lentiviral vector is lenti-sgRNA-PURO.

6. The method of claim 4, wherein the transfer is by packaging the recombinant knock-out vector as a lentivirus and infecting the recipient cells with the lentivirus.

7. YTHDF1 gene knockout cell prepared by the method of any one of claims 4 to 6.

8. The use of a YTHDF1 gene knockout cell of claim 7 for constructing an autophagy model.

9. The use of claim 8, wherein said YTHDF1 gene knock-out cell is induced by a drug to autophagy.

10. The use according to claim 9, wherein the drug is rapamycin.

Images