CN106520830B - method for targeted editing of mitochondrial genome by using CRISPR/Cas9 - Google Patents

Abstract

The invention provides a method for targeted editing of a mitochondrial genome by using a CRISPR/Cas9 technology, which comprises the following steps: constructing a mitoCRISPR vector targeting a mitochondrial genome; inserting the specific sgRNA of mitochondria into a MitoCRISPR vector to construct a mitochondrial gene knockout or modification vector; the mitochondrial gene knockout or modification vector is introduced into human or animal cells, so that the aim of editing the mitochondrial genome of the human or animal cells is fulfilled. The method is used for modifying the Cas9 protein and sgRNA elements, enabling the elements to enter mitochondria, targeting the corresponding genes of the genome of the elements, and carrying out gene knockout and modification so as to remove mutant DNA in the mitochondria, thereby being expected to treat various mitochondrial diseases.

Description

A method for targeted editing of the mitochondrial genome using CRISPR/Cas9

technical field

The invention belongs to the field of biotechnology, and in particular relates to a method for targeted editing of mitochondrial genome by using CRISPR/Cas9 technology.

Background technique

Mitochondria are important organelles of eukaryotic cells that generate most of the energy required by cells. In addition to providing energy, mitochondria are also involved in a variety of cellular functions, including cell cycle and growth control, signal transmission, cell differentiation, regulation of cell death, etc. Mitochondrial genome is a double-stranded circular genome, ie mtDNA, its mutation will affect various tissues and organs, and eventually lead to various diseases. In most cases, mutant mtDNA coexists with wild-type mtDNA, which is called mtDNA heteroplasmy. When the proportion of the mutant genome exceeds 80%, the clinical symptoms of some mitochondrial diseases can be shown. Common mitochondrial diseases include mitochondrial myopathy, mitochondrial encephalopathy, and mitochondrial encephalomyopathy. Typical diseases such as Leber hereditary optic neuropathy (LHON), the main symptom of this disease is optic nerve degeneration, is an acute or subacute onset maternally inherited disease, more common in men. At present, there are about 700 kinds of mutations found in mitochondria, and more than 200 diseases are known to be caused by mutations in mitochondrial DNA. These mutations mainly affect organs that require a lot of energy, including the heart, skeletal muscle and brain. Syndromes are usually also It is first manifested in these parts. According to survey data, one out of every 200 babies in the world will be affected by the mother's mitochondrial gene, and one out of every 6,500 babies will suffer from serious diseases due to mitochondrial gene defects. Mitochondrial function is affected by nuclear genome and mitochondrial genome, therefore, the formation of mtDNA heterogeneity to cause the corresponding phenotype is a complex process. This makes the treatment of mitochondrial genetic diseases extremely difficult.

At present, two methods to eliminate mitochondrial site mutations have been developed at the molecular level, namely: restriction endonuclease selective targeting of mutant mitochondrial DNA and the use of ZFN/TALEN technology to edit the mitochondrial genome.

If some mtDNA sites are mutated into restriction endonuclease sites, the method of restriction endonuclease selectively targeting the mutated mitochondrial DNA can be used to selectively degrade the mutated mtDNA. For example, the T8993G site mutation of the human mitochondrial ATPase6 gene will generate a new unique SmaI site. In 2002, TANAKA M et al. added a mitochondrial localization signal to the restriction endonuclease SmaI gene, which can be transported into the mitochondria after being expressed in the nuclear gene expression system of the cell, and the introduction of the endonuclease SmaI significantly reduced the mutated mitochondrial DNA. Therefore, delivering specific endonuclease genes to corresponding patients at specific mutation sites is expected to reduce the proportion of mutated mtDNA. The premise of using this gene editing method is that a new specific endonuclease site must be generated after mitochondrial gene mutation. However, it is difficult to find a single mutation restriction site in the about 16.5kb sequence of the mitochondrial genome, which also makes the practical mtDNA mutation very limited.

In 2006, Aaron Klug's research group first used ZFN (Zinc-Finger Nuclease) technology to knock out the mitochondrial genome. The research team knocked out the T8993G site of the mitochondrial ATPase6 gene and successfully rescued part of the activity of the ATPase6 gene. In 2008, Aaron Klug's research group used this technology to knock out the T8993G site of the ATPase6 gene, and further directly observed a significant decrease in the mitochondrial copy number of the T8993G mutation site of the ATPase6 gene.

In 2013, Dr. Carlos T. Moraes of the University of Miami Miller School of Medicine used TALENs technology for mitochondrial gene editing for the first time. Their study showed that once the mitoTALENs bind to and cut the target-specific DNA, the mutated mtDNA is degraded. A drop in total mtDNA stimulates cells to increase their mtDNA by duplicating the unaffected mitochondrial genome. After two weeks, mtDNA levels returned to normal. Because the mutated mtDNA is deleted, the normal mtDNA is retained and amplified, so most of the mitochondria in the cell contain normal mtDNA.

CRISPR/Cas9 technology is a new gene editing technology developed in recent years. During the targeting process, the CRISPR/Cas9 system uses the sgRNA-Cas9 system to generate double-strand breaks (Double-Strand Breaks, DSB) in the target DNA complementary to the sgRNA before the 3′ end of the Protospacer Adjacent Motif (PAM), Cells then repair DNA through Non-Homologous End Joining (NHEJ) or homology-mediated double-strand DNA repair (Homology-Directed Repair, HDR) to achieve genome modification. Compared with ZFN/TALEN technology, CRISPR/Cas9 technology has greater advantages. It is easier to operate and has stronger scalability, and is widely used in various research objects. For cells with low transfection efficiency, the CRISPR/Cas9 system can also introduce the corresponding vector into cells through lentivirus infection. The TALENs technology is not suitable for cell infection through lentiviral vector infection due to concerns about possible recombination mutations. The CRISPR/Cas9 system also solves the problem of too large TALENs system vectors.

In 2010, Professor Michael A. Teitell discovered that a protein called polynucleotide phosphorylase (PNPASE) plays an important role in regulating the entry of RNA into mitochondria. Reducing the expression of PNPASE affects the level of RNA entering the mitochondria, thereby affecting the synthesis of proteins required to maintain the electron transport chain. At the same time, unprocessed mitochondrial RNA builds up, protein translation is inhibited, energy production is hampered, and cell growth stalls. On this basis, in 2012, Michael A. Teitell et al. corrected the mutation defect of human mitochondria by targeting RNA for the first time, which will help the treatment of mitochondria-related diseases. The researchers first selected stable repair RNAs to exit the nucleus and localize on the outer mitochondrial membrane, and then designed an export sequence to help the RNA enter the mitochondria. Once the RNAs are present near the transporter on the mitochondrial surface, a second delivery sequence (RP sequence) is used to guide the RNA into the mitochondria. With these two sequences, a broad spectrum of RNAs can be targeted and directed into the mitochondria. Studies have shown that this method can efficiently guide foreign RNA into mitochondria.

The present invention introduces a brand-new method for knocking out mitochondrial genes. On the basis of the above work, we modified the CRISPR/Cas9 technology, that is, modified Cas9 and sgRNA, so that the modified CRISPR/Cas9 system has the ability to enter the mitochondria, so as to target specific genes or sites on the mitochondrial genome, Realize the knockout and modification of specific mitochondrial genes, their mutated genes or sites. Therefore, applying the CRISPR/Cas9 technology developed by us to edit mitochondrial genes, it is possible to more conveniently remove mutant DNA in mitochondria, which is expected to treat a variety of mitochondrial diseases.

Contents of the invention

The purpose of the present invention is to provide a simple and convenient method for targeted editing of specific genes or sites on the mitochondrial genome. This method uses the modified CRISPR/Cas9 system to precisely target specific genes or sites on the mitochondrial genome, avoiding the cumbersome process of constructing vectors in other methods, greatly reducing the time for constructing vectors, and greatly improving the efficiency of gene knockout or modification. .

The present invention adopts following technical scheme:

A method for targeted editing of the mitochondrial genome using CRISPR/Cas9, comprising the following steps:

(1) Construction of MitoCRISPR vector;

(2) Insert the sgRNA of the specific gene into the MitoCRISPR vector to construct the mitochondrial gene editing vector; gene editing includes gene knockout and gene modification;

(3) Introduce the above-mentioned mitochondrial gene editing vector into human or animal cells such as 293T cells, and knock out or modify the mitochondrial genome to achieve the purpose of knocking out or modifying the target gene;

The method for constructing the MitoCRISPR vector is to make the following transformations on the backbone plasmid vector PX459. The backbone plasmid vector contains the basic elements of the CRISPR system, namely the Cas9 protein gene and the U6 promoter; after the U6 promoter, add to promote the entry of exogenous RNA into the mitochondria The signal sequence, that is, the 3'UTR sequence; the 3'UTR sequence helps stabilize the RNA so that it can come out of the nucleus and locate on the outer mitochondrial membrane; then, add the RP sequence to help the RNA enter the mitochondria; then, remove the Cas9 gene The previous nuclear localization signal was added, and the signal sequence that promotes the entry of foreign proteins into the mitochondria, that is, the MLS sequence, was added; finally, 11 MitoCRISPR plasmid vectors that can be used for specific gene editing of the mitochondrial genome were obtained.

The specific method of step (2) is: select one of the MitoCRISPR plasmids in step (1) as the backbone, and insert the sgRNA sequence of the target gene or site into the restriction endonuclease BbsI site to construct a mitochondrial gene knockout or editing vector.

The specific method of step (3) is: introduce the plasmid knockout vector obtained in step (2) into human or animal cells, extract the whole genome of the cells after 3 days, and use real-time fluorescent quantitative PCR to detect changes in the copy number of the mitochondrial genome to evaluate the ability of the MitoCRISPR system to target mitochondria. Genome knockout efficiency; or DNA sequencing to determine the effect of gene editing.

Among them, the method of constructing the MitoCRISPR vector pMitoCRISPR-1 vector is: add the 3'UTR sequence of the mitochondrial localization signal MRPS12 gene after the U6 promoter to enhance the stability of the transcribed sgRNA, and construct pMito-U6-BbsI-3'UTR The plasmid; then, remove the nuclear localization signal before the Cas9 gene, add the mitochondrial localization signal, the mitochondrial localization signal of the Cox8A gene, to help the Cas9 protein enter the mitochondria, and construct pMito-U6-RP-BbsI-3'UTR-CBh- MLS-Cas9 plasmid; then add EGFP after Cas9 to observe the transfection efficiency. At the same time, the 3'UTR sequence of the mitochondrial positioning signal MRPS12 gene was added after the Cas9 expression frame to stabilize the entire structure. The pMitoCRISPR1 plasmid vector with the following components U6-RP-BbsI-3'UTR-CBh-MLS-Cas9-2A-GFP-3'UTR from the 5'-3' end was obtained. The MitoCRISPR plasmid contains the basic elements of the CRISPR system, namely the Cas9 gene and the guide RNA component driven by the U6 promoter; the 3'UTR sequence on the vector helps stabilize the RNA so that it can come out of the nucleus and be located on the outer mitochondrial membrane, and then The input sequence at the 5' end of the RNA, the RP sequence, helps the RNA enter the mitochondria; once the 3'UTR sequence helps the RNAs appear on the surface of the mitochondria, the RP sequence is used to guide the RNA into the targeted mitochondria.

The obtained MitoCRISPR plasmid vector contains the following gene expression and regulatory elements in the order of 5' end → 3' end: U6 promoter, used to control the expression of sgRNA; BbsI, a restriction endonuclease site, which can be used to insert the target gene sgRNA sequence; 3'UTR, used to enhance the stability of sgRNA on the mitochondrial outer membrane; CBh, chicken β-actin gene promoter element, used to control the expression of Cas9 protein; Cas9, Cas9 nuclease, used for sgRNA-guided gene cleavage, modification and integration; UTR2, used to stabilize the mRNA of Cas9; 2A, self-cleaving peptide; GFP, green fluorescent protein gene.

The obtained MitoCRISPR plasmid vector also contains a RP sequence for guiding the sgRNA into the mitochondria, and the RP sequence can be located before the sgRNA, between the sgRNA and the 3'UTR, or after the 3'UTR.

The gene expression and regulatory elements added to the backbone plasmid vector include: 3'UTR sequence, RP sequence, MLS mitochondrial localization signal and 2A sequence, as listed below.

Cox8A-3' UTR: AGGGGTCCGTTCTGTCCCTCACACTGTGACCTGACCAGCCCCCACCGGCCCATCCTGGTCATGTTACTGCATTTGTGGCCGCCTCCCCTGGATCATGTCATTCAATTCCAGTCACCTCTTCTGCAATCATGACCTCTTGATGTCCTCCATGGTGACCTCCCTTGGGGGTCACTGACCCTGCTTGGTGGGGTCCCCCTTGTAACAATAAACT

SOD2-3'UTR:

ACCACGATCGTTATGCTGATCATACCCCTAATGATCCCAGCAAGATAATGTCCTGTCTTCTAAGATGTGCATCAAGCCTGGTACATACTGAAAACCCTATAAGGTCCTGGATAATTTTTGTTTGATTATTCATTGAAGAAACATTTATTTTCCAATTGTGTGAAGTTTTTGACTGTTAATAAAGAATCTGTCAACCATCAA.

MRPS12-3'UTR:

CAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTGGGCGCCCCTGCAGAACATGAACCTTCCGCTCCTGGCTGCCACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGAGGCAGCCACTCATGGATTCAAGTCCTGGCTCCGCCTCTTCCATCAGGACCAC.

ATP5B-3'UTR:

GGGGTCTTTGTCCTCTGTACTGTCTCTCCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTCAG.

ATP5B-MLS: ATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCG.

Cox8A-MLS: ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTG.

RP: TCTCCCTGAGCTTCAGGGAG.

2A: GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA.

The above different combinations and the listed elements will construct 11 MitoCRISPR plasmid vectors, namely pMitoCRISPR1 to pMitoCRISPR11 (Figure 1). sgRNA is a single-stranded guide RNA, and the single-stranded guide RNA sequence is a target sequence for mitochondrial gene knockout and modification.

The method for constructing the MitoCRISPR vector pMitoCRISPR1-pMitoCRISPR11 is as follows: two AgeI restriction enzyme sites are introduced at the N-terminus of the Cas9 gene, and then we replace two different MLSs on the AgeI enzyme site: Cox8A-MLS and ATP5B-MLS; four different 3'UTRs can be substituted on the SpeI restriction endonuclease site of the MitoCRISPR plasmid vector: MRPS12-3'UTR, Cox8A-3'UTR, SOD2-3'UTR and ATP5B-3 'UTR. RP sequences were added at different positions behind the U6 promoter: RP -sgRNA, RP -3'UTR, 3'UTR-RP(+) and 3'UTR-RP(-). A total of 11 different MitoCRISPR vectors were obtained, including pMitoCRISPR1-pMitoCRISPR4 with Cox8A-MLS sequence; pMitoCRISPR5-pMitoCRISPR8 with ATP5B-MLS-MLS sequence; pMitoCRISPR1 and pMitoCRISPR5 with MRPS12-3'UTR sequence; pMitoCRISPR2 and pMitoCRISPR6 with Cox8A -3'UTR sequence; pMitoCRISPR3 and pMitoCRISPR7 have SOD2-3-3'UTR sequence; pMitoCRISPR4 and pMitoCRISPR8 have ATP5B-3'UTR sequence; pMitoCRISPR9's RP sequence is between sgRNA and 3'UTR; pMitoCRISPR10's RP sequence is positive The RP sequence of pMitoCRISPR11 is reversed behind the 3'UTR. The partial structure of the constructed plasmids pMitoCRISPR1 to pMitoCRISPR11 is shown in Figure 1. The full sequence of the pMitoCRISPR1 vector is shown in SEQ ID No.1.

The method of constructing the target gene knockout vector of mitochondrial genome is as follows: select one of the above-mentioned MitoCRISPR plasmids as the backbone, insert the sgRNA sequence of the target gene or site into the restriction endonuclease BbsI site, and construct the mitochondrial gene knockout recombinant vector. Take the pMitoCRISPR1 plasmid vector as an example, specifically, the pMitoCRISPR1 plasmid vector is digested with BbsI restriction endonuclease, and then the digested vector is purified by ethanol precipitation; then the sgRNA target gene sequence containing the RP sequence is annealed and combined with the digested pMitoCRISPR1 Plasmid vectors were ligated. After the ligated vector was transformed, the bacteria were picked, and the recombinant vector was identified. For example, the present invention designs one sgRNA for the 12sr RNA and Cytb genes of the human mitochondrial genome, and constructs the plasmids of pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO-Cytb.

The specific method of editing the mitochondrial genome in human or animal cells such as 293T cells is as follows: use liposome transfection technology to transfect the above pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO-Cytb plasmids into 293T cells respectively, and extract the whole genome of the cells after 3 days , using real-time fluorescent quantitative PCR to detect the copy number changes of the mitochondrial genome to evaluate the knockout efficiency of the MitoCRISPR system against the mitochondrial genome. The primers used for the above real-time fluorescent quantitative PCR detection are as follows: H-12sr RNA-qpcr-F: 5'-CTCACCACCTCTTGCTCAG-3', H-12sr RNA-qpcr-R: 5'-GGCTACACCTTGACCTAACG-3'; β-actin was used as Internal reference control.

The advantages of the present invention are:

1. The established MitoCRISPR plasmid vector system has various regulatory components, including U6-RP-BbsI-3'UTR-CBh-MLS-Cas9-2A-GFP-3'UTR, which can meet the needs of the inserted target sgRNA sequence and use The stable expression and function of Cas9 for gene cutting in mitochondria; the mitochondrial gene knockout vector containing the target sgRNA sequence established in the MitoCRISPR plasmid vector has both sgRNA expression elements and Cas9 gene expression elements, compared with the double plasmid separated from the two The transfection system has high transfection efficiency.

2. The MitoCRISPR plasmid vector has multiple restriction endonuclease cutting sites, and each regulatory element can be easily replaced. 3. The MitoCRISPR plasmid vector has selected a special restriction endonuclease site, namely the Bbs I restriction site, which can be inserted into the target sgRNA sequence to prevent the vector from self-ligating. The synthesized oligonucleotides are annealed and ligated directly to the enzyme-cut vector. Using this method for cloning, the connection efficiency of sgRNA is as high as 90%. 4. The vector carries the EGFP gene for screening, which can screen the transfected cells or observe the transfection efficiency. Moreover, GFP and Cas9 protein are connected by self-cleaving polypeptide T2A, which can separate the expression of GFP protein and Cas9 protein; on the one hand, it can control the size of the carrier, and on the other hand, it does not affect the activity of Cas9 protein. 5. The vector has the MLS sequence, namely Mitochondrial Localization Sequence, to guide the Cas9 protein into the mitochondria. 6. The carrier system has two special elements: RP sequence and 3'UTR sequence. First, the 3'UTR sequence on the carrier helps stabilize the RNA so that it can come out of the nucleus and locate on the mitochondrial outer membrane, and then an input sequence at the 5' end of the RNA-RP sequence helps the RNA enter the mitochondria. Once the 3'UTR sequence helps the RNAs to appear on the mitochondrial surface, the RP sequence, the trafficking sequence, can guide the RNA into the targeted mitochondria. With these two sequences, the sgRNA can be targeted, guided into the mitochondria, and edited the mitochondrial genome. 7. The system optimizes different MLS sequences and 3'UTR sequences. We used Cox8A-MLS and ATP5B-MLS in this system; used MRPS12-3'UTR, ATP5B-3'UTR, Cox8A-3'UTR, and SOD2-3'UTR. Constructed a complete set of MitoCRISPR plasmid vector series for inserting and integrating different sgRNAs, and can test the gene knockout or modification efficiency of mitochondrial gene knockout or gene modification vectors constructed by different MitoCRISPR plasmid vectors containing target sgRNA sequences, so as to select The better carrier is used for further research or practical application. 8. The system optimizes the position of the RP sequence in the MitoCRISPR system to exclude its influence on the functional expression of the protein in the system. We tested that the RP sequence was placed before the sgRNA sequence, before the 3'UTR sequence and behind the 3'UTR sequence, and observed the effect of the position of the RP sequence on the function of MitoCRISPR, and determined that the RP sequence was behind the 3'UTR sequence, and its gene knockout It works best when removing or retouching.

Description of drawings

Fig. 1 Plasmid map of pMitoCRISP1 vector. Figure a is the pMitoCRISPR1 vector, including Cas9 and sgRNA expression elements, Amp resistance gene, pBR322 and F1 origin of replication; Figure b is the 11 pMitoCRISPR vectors obtained by combining different MLS and 3'UTR elements, namely pMitoCRISPR1 to pMitoCRISPR11, where A: MRPS12-3'UTR, B: ATP5B-3'UTR, C: COX8A-3'UTR, D: SOD2-3'UTR, E: COX8A-MLS, F: ATP5B-MLS, U6: U6 promoter, RP: RP sequence, Bbsl: restriction enzyme cutting site, 3'UTR: 3' non-coding region, CBH: CBH promoter, MLS: MLS sequence, Cas9: Cas9 protein gene, EGFP: green fluorescent protein Gene.

Figure 2 Functional verification of Cas9 expression elements in MitoCRISPR vector, Non is blank control; MitoCRISPR is an empty vector for mitochondrial gene knockout; MitoCRISPR-KO-12sr RNA and MitoCRISPR-KO-Cytb plasmids are 12sr RNA and Cytb gene targeting human mitochondria knockout vector. In order to verify whether the MitoCRISPR plasmid is effective, we designed a sgRNA for the mitochondrial 12srRNA and Cytb genes of 293T cells, and constructed the MitoCRISPR-KO-12srRNA and MitoCRISPR-KO-Cytb plasmids. After the above two plasmids were respectively introduced into the cells, the expression of EGFP protein was detected.

Figure 3 Mitochondrial localization of Cas9 protein. The control is the control of mitochondrial staining by Mitotrack dye; NLS-Cas9 is the nuclear localization Cas9 protein localization control; MitoCRISPR is the mitochondrial localization Cas9 protein localization.

Figure 4 sgRNA and Cas9 expression verification. Figure a shows that after 293T cells were transfected with pMitoCRISPR1 and pMitoCRISPR1-KO-12sr RNA plasmids, RT-PCR detected the expression of sgRNA in mitochondria; After the pMitoCRISPR1-KO-Cytb plasmid, Western Blot was used to detect the expression of Cas9 in the cells.

Fig. 5 For the knockout of the mitochondrial 12sr RNA locus, qPCR analysis of the copy number changes of the mitochondrial genome in cells. Among them, Mock is the control group, EG is the experimental group; MitoCRISPR is the control without sgRNA, and KO-12Sr RNA and KO1-12Sr RNA are the controls between groups.

Figure 6 For the knockout of the mitochondrial Cytb gene locus, qPCR analysis of the copy number changes of the mitochondrial genome in the cells. Among them, Mock is the control group, EG is the experimental group; MitoCRISPR is the control without sgRNA, and KO-cytb and KO1-cytb are the control between groups.

Figure 7 Effects of MLS elements of different genes on mitochondrial gene knockout in the MitoCRISPR system. Among them, Mock is the control group; MitoCRISPR is the control without sgRNA, and pMitoCRISPR1-Cox8A-MLS-KO-12sr RNA and pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA are the controls of different MLS elements.

Figure 8 The effect of the position of RP sequence in the MitoCRISPR system on mitochondrial gene knockout. Where Mock is the control group; MitoCRISPR is the control without sgRNA, pMitoCRISPR1-RP-sgRNA-KO-12srRNA, pMitoCRISPR1-RP-3'UTR-KO-12srRNA, pMitoCRISPR1-3'UTR-RP(+)-sgRNA -KO-12sr RNA and pMitoCRISPR1 -3'UTR- RP(-)-KO-12sr RNA are experimental groups at different positions of the RP sequence.

Figure 9 Effects of 3'UTR elements of different genes on mitochondrial gene knockout in the MitoCRISPR system. Mock is the control group; MitoCRISPR is the control without sgRNA, pMitoCRISPR2-Cox8A-3'UTR-KO-12sr RNA, pMitoCRISPR3-SOD2-3'UTR-KO-12sr RNA, pMitoCRISPR1-MRPS12-3'UTR-KO-12sr RNA and pMitoCRISPR4-ATP5B-3'UTR-KO-12sr RNA are experimental groups of different 3'UTR elements.

Detailed ways

Example 1 Construction of MitoCRISPR plasmid vector

First, we added the 3'UTR signal of the mitochondrial localization signal MRPS12 gene after the U6 promoter. The plasmid of Mito-U6-RP-BbsI-3'UTR was constructed. Then remove the nuclear localization signal before the Cas9 gene, add the mitochondrial localization signal of Cox8A, that is, the MLS sequence, and construct the plasmid of Mito-U6-RP-BbsI-3'UTR-CBh-MLS-Cas9. Then add the EGFP gene after Cas9 to observe the transfection efficiency. At the same time, the 3'UTR signal of MRPS12 was added after the Cas9 expression frame to stabilize the entire structure of the expressed Cas9 mRNA. The Mito-U6-RP-BbsI-3’UTR-CBh-MLS-Cas9-2A-GFP-3’UTR (MitoCRISPR) plasmid vector, pMitoCRISPR1, was finally obtained (Fig. 1a).

Specifically:

(1) The introduction of elements used to control the expression of sgRNA: After the U6 promoter of the PX459 vector, the mitochondrial localization signal RP sequence of RNA and the 3'UTR signal sequence of MRPS12, which play a stabilizing role, were added to successfully construct Mito-U6- RP-gRNA-3'UTR vector.

The specific method is as follows: first synthesize the gRNA backbone and the 3'UTR signal of MRPS12. At the same time, enzyme cutting sites were added to both ends of the 3'UTR signal of MRPS12 to replace different 3'UTR signals. gRNA-3'UTR is as follows:

5'-AGGACGAAAcaccggGTCTTCgaGAAGACctgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc CAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTG GGCGCCCCTGCAGAACATGAACCTTCCGCTCCTGGCTGCCACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGA GGCAGCCACTCATGGATTCAAGTCCTGGCTCCGCCTCTTCCATCAGGACCAC ACTAGTTTTTTTagcgcgtgcgccaattctgcagacaaatggctctagaggtacccg-3'。 Bold is the restriction site of BbsI, which is used for the insertion of sgRNA and RP sequences, and the restriction site of BbsI; italic is the 3'UTR signal of MRPS12.

The gRNA-3'UTR fragment was then amplified for ligation into the PX459 vector backbone. The primers used are as follows:

INFUSION-F: 5'-atcttGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGA-3',

INFUSION-R: 5'-GTAAGTTATGTAACGGGTACCTCTAGAGCCATTTGTCTGCAG-3'

Use TaKaRa’s PCR reaction kit for PCR amplification, the conditions are as follows: the reaction system is set to 20 μl: template 1 μl, Pfu polymerase 0.1 μl, 10×Pfu buffer 2 μl, dNTP 1.6 μl, primers INFUSION-F and INFUSION-R 0.4 μl each, ddH2O 15.5 μL, the reaction temperature gradient was 94°C, 5 min; 94°C, 30 s; 55°C, 30 s; 72°C, 30 s; 72°C, 5 min; BbsI and kpnI double digestion to linearize it. In addition, in order to retain the BbsI restriction site, the sequence of the sgRNA expression cassette needs to be ligated into the vector by IN-fusion. Use BbsI and KpnI restriction endonucleases to excise the sequence on the vector, and then use the IN-Fusion method to seamlessly connect the synthetic sequence to the PX459 vector. The IN-Fusion reaction system is as follows: add 2 μL of linearized vector, 5 μL of inserted sgRNA-3’UTR fragment, and 3 μL of ddH2O to the PCR tube, totaling 10 μL, mix gently and then centrifuge. React at 50°C for 15 minutes. Then transform, pick the monoclonal strain, extract the plasmid DNA, and identify the obtained recombinant plasmid pMito-U6-RP-gRNA-3'UTR by sequencing.

(2) Used to control the introduction of Cas9 expression elements: Next, remove the nuclear localization signal before the Cas9 gene in the above pMito--U6-RP-gRNA-3'UTR, and replace it with the mitochondrial localization signal of Cox8A. The pMito--U6-RP-BbsI-3'UTR-CBh-MLS-flag-Cas9 vector was constructed. The specific method is to first synthesize the structure of Age I-MLS-Flag-Cas9 (part) BglII.合成的序列如下：5'-accggtgccacc ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGA CAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTG ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGCCGGTATCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAG AGATCT -3'。

Bold is the site of Age I restriction endonuclease, italic is the site of Bgl II restriction endonuclease, underline is the mitochondrial localization signal of Cox8A. Then use the enzyme of Age I and the restriction endonuclease of Bgl II to cut off the sequence on the Mito-U6-RP-gRNA-3'UTR vector, and then use the same enzyme to cut the DNA of AgeI-MLS-Flag-Cas9-Bgl II Structural sequence, connecting the two, and then transforming, picking a single clonal bacterial strain, extracting plasmid DNA, and identifying the obtained recombinant plasmid pMito-U6-RP-BbsI-3'UTR-CBh-MLS-flag-Cas9 by sequencing.

(3) Construction of the screening tag EGFP: Finally, add EGFP after the Cas9 gene sequence of the pMito-U6-RP-BbsI-3'UTR-CBh-MLS-flag-Cas9 plasmid vector, and remove the puromycin gene so that To observe the transfection efficiency. At the same time, the 3'UTR signal of MRPS12 was added after the Cas9 expression frame to stabilize the expressed Cas9 mRNA structure. The specific method is: first synthesize the structure of EcoRI-T2A-EGFP-3'UTR-EcoRI, then use EcoRI enzyme to cut off the sequence on the vector, and then use the same enzyme to cut EcoRI-T2A-EGFP-3'UTR-EcoRI The sequence was connected to Mito-U6-RP-gRNA-3'UTR-CBh-MLS-flag-Cas9. Then transformed, and the bacterial single clone was picked and sequenced. The sequencing results were analyzed with Bioedit software, and the results showed that the MitoCRISPR (Mito-U6-RP-gRNA-3'UTR-CBh-MLS-Cas9-2A-GFP-3'UTR) vector was successfully constructed.

Example 2 Gene Knockout for the Mitochondrial 12sr RNA Gene Locus

The specific method for constructing a mitochondrial gene knockout vector targeting the mitochondrial 12srRNA gene locus is as follows:

Select the pMitoCRISPR1 plasmid as the backbone to construct the mitochondrial gene knockout recombinant plasmid vector. The pMitoCRISPR1 plasmid contains the basic elements of the CRISPR system, namely the Cas9 protein gene and the elements that control the expression of sgRNA in mitochondria, including the U6 promoter, RP sequence and 3'UTR sequence . The U6 promoter is used to promote the expression of sgRNA. The 3'UTR sequence helps stabilize the expressed sgRNA so that it can come out of the nucleus and locate on the mitochondrial outer membrane; the input sequence at the 5' end of the RNA-RP sequence helps the RNA enter the mitochondria. Once the 3'UTR sequence helps RNAs appear on the mitochondrial surface, a second trafficking sequence (RP sequence) can be used to guide the RNA into the targeted mitochondria. With these two sequences, the sgRNA can be targeted, guided into the mitochondria, and edited the mitochondrial genome. The vector selects a special BbsI restriction site for inserting specific sgRNA to prevent self-ligation of the vector. And the carrier has EGFP gene, which can screen the transfected cells or observe the transfection efficiency.

In this example, the 12sr RNA gene on the mitochondrial genome is selected and knocked out. The specific steps are as follows:

sgRNA annealing: Add 2 μL of 10×PCR buffer, 1 μL of Mito-KO-H-12sr RNA-F, 1 μL of Mito-KO-H-12sr RNA-R, 16 μL of ddH ₂ O, a total of 20 μL, and the treatment condition is 95°C for 5 min , 2.5°C/s down to 85°C; 0.25°C/s from 85°C to 25°C, then 25°C for 5 min.

The sgRNA target sequence of the 12sr RNA gene is as follows: 12sr RNA: 5'-TAAGGGCTATCGTAGTTTTC-3'; RP sequence: 5'-TCTCCCTGAGCTTCAGGGAG-3'.

The sgRNA primer sequence for the 12s rRNA gene inserted into the Bbs I restriction site of pMitoCRISPR1 plasmid is as follows: Mito-KO-H-12sr RNA-F: 5'-CACCGTCTCCCCTGAGCTTCAGGGAGTAAGGGCTATCGTAGTTTTC-3'

Mito-KO-H-12sr RNA-R: 5'-AAACGAAAACTACGATAGCCCTTACTCCCTGAAGCTCAGGGAGAC-3'.

Construction of mitochondrial 12srRNA gene knockout vector: 17 μL of pMitoCRISPR1 plasmid DNA, 5 μL of 10× FastDigest buffer, 5 μL of Bbs I restriction endonuclease, 23 μL of ddH2O, a total of 50 μL, reacted for 1 hour, 95°C for 5 minutes. In 1.5 mLEP, add 2 μL of the reaction solution, 1.84 μL of the above sgRNA annealing reaction solution 2.5 μL, 10×T4 DNA ligase buffer, T4 DNA ligase 1 μL, and connect at room temperature for 10-30 min. Gently add 1 μL of the above DNA ligation reaction solution to the 1.5 mLEP tube, mix well, then ice-bath for 30 min, 37 °C water bath for 6 min, and place on ice for 3 min; add 800 μL LB bacterial culture solution, 37 °C water bath, 1 h ; Take 50 μL of the supernatant, mix it on the LB solid plate, and culture it upside down at 37°C overnight. Select the resistant monoclonal colony, extract the plasmid DNA with Kangwei Century Endotoxin-Free Plasmid Mini-prep Kit, and send it to Shanghai Boshang Biotechnology Co., Ltd. for sequencing to confirm that the recombinant plasmid pMitoCRISPR1-KO-12sr RNA contains The mitochondrial gene knockout plasmid of 12s rRNA gene sgRNA was successfully constructed.

The specific method of the sgRNA mitochondrial localization experiment is as follows:

In order to verify whether Cas9 and sgRNA are localized to mitochondria, we transfected cells with NLS-Cas9 and pMitoCRISPR1 vectors respectively, and observed the localization of Cas9 protein on mitochondria with a confocal microscope two days later; transfected cells with pMitoCRISPR1 and pMitoCRISPR1-KO-12sr RNA plasmids , Two days later, RT-PCR was used to analyze the expression of sgRNA in mitochondria. Among them, the pMitoCRISPR1 vector lacking the RP sequence was used as a control plasmid.

The Cas9 protein steps are as follows: cells transfected for 72 hours were inoculated on polylysine-treated glass slides, and washed three times with ice-cold PBS for 5 minutes each time. Fix slides with 4% paraformaldehyde for 15 minutes, soak in PBS for 3 times; permeabilize with 0.5% TritonX-100 (prepared in PBS) for 1 hour at room temperature, soak in PBS for 3 times; seal with blocking solution for 30 minutes at room temperature; absorb with absorbent paper Blocking solution, add a sufficient amount of diluted flag primary antibody to each slide and put it in a wet box, incubate overnight at 4°C; soak slides in PBS 3 times, 3 minutes each time, absorb excess liquid on the slides with absorbent paper Add the diluted fluorescent secondary antibody dropwise, incubate at 37°C in the dark for 1 h in a wet box, soak the cells 3 times in PBS, 3 min each time; add DAPI and incubate in the dark for 2 min, stain the cells, wash 4 times with PBS; Blot the liquid on the slide with absorbent paper, seal the slide with a mounting solution containing anti-fluorescence quenching agent, and then observe and collect images under a confocal microscope.

The steps for extracting mitochondria are as follows: First, digest the cells from the culture dish, lyse the cells with a hypotonic solution for 5-10 minutes, and then quickly grind the cells on ice with the pestle B provided by the Dounce homogenizer. It should move up and down vertically to increase the contact area with the homogenate, and usually observe the homogenate effect after about 10 times of homogenization. Then, the crudely extracted mitochondria were obtained by differential centrifugation. The crudely extracted mitochondria were added to 12% percoll solution, the mixture was carefully placed on a gradient of 19% percoll and 40% percoll, and centrifuged at 50000g for 25 minutes. Carefully draw the sample located in the light yellow interface layer, resuspend in the separation buffer, and centrifuge at 17000g for 10 minutes to obtain pure mitochondria. Mitochondrial RNA was extracted, and after reverse transcription, sgRNA was detected by RT-PCR.

The specific method for editing the mitochondrial genome of 293T cells is as follows:

In order to verify whether the MitoCRISPR plasmid is effective, we designed an sgRNA targeting the 12sr RNA gene locus of the human mitochondrial genome, and constructed the pMitoCRISPR1-KO-12sr RNA plasmid as described above. The plasmid was transfected into 293T cells, and the mitochondrial genome copy number changes were detected 3 days later to evaluate the efficiency of the MitoCRISPR system. The specific method is as follows: Mix well with 70 μl opti-MEM (Gibco, catalog number: 31985-070) + 3 μl PEI (polysciences, catalog number: 670587) (1 μg/μl) reagent, then add 1 μl DNA (1 μg/μl), and incubate at room temperature After 5 min, the mixed solution was added to the cells, and the cells were incubated overnight at 37°C. Three days after the cells were transfected with the plasmid, the genome of the cells was extracted using a genome-wide extraction kit, and then the concentration of the sample was measured with a micro-spectrophotometer, and the concentration of the sample was uniformly diluted to 50 ng/μl. After extracting the cell genome, 12sr RNA and β-actin were amplified with a high-throughput real-time fluorescent quantitative PCR instrument (QuantStudio 6 Flex). After the amplification is completed, the real-time fluorescent quantitative PCR instrument can automatically give the fluorescence curve and calculate the CT value of the reaction. The CT value refers to the number of cycles of the reaction when the fluorescent signal collected by the real-time fluorescent quantitative PCR instrument reaches a given value, where C refers to Cycle, and T refers to the threshold. We used the △△Ct method to calculate the relative expression of each sample according to the CT value.

The qPCR amplification conditions are as follows: prepare the reaction mixture in MicroAmp® Fast 8-Tube Strip, 0.1 ml fast reaction 8-tube, and set the reaction system to 20ul: template, 3ul, SYBR GREEN I Mix, 10ul, upstream primer F, 0.4 ul, downstream primer R, 0.4 ul, ddH2O, 6.2 μL, the PCR reaction temperature gradient is 95°C, 20S; 95°C, 3S; 56°C, 30s; 72°C, 30s; 72°C, 5min; the melting curve amplification stage is 95°C, 15s, 60°C, 60s, 95°C, 15s. Result analysis: After the above pMitoCRISPR1-KO-12s rRNA plasmid was introduced into 293T cells, it was found that the cells expressed EGFP (as shown in Figure 2). In order to verify whether Cas9 has entered the mitochondria, two days after the transfection of the pMitoCRISPR1 plasmid, we performed fluorescent staining with specific antibodies, and confirmed the localization of Cas9 on the mitochondria with a confocal microscope (as shown in Figure 3). At the same time, the cell protein was extracted and analyzed by Western Blot, and the results further showed the expression of Cas9 (Figure 4b). In order to verify whether the expressed 12srRNA sgRNA has entered the mitochondria, we extracted the mitochondria and analyzed the content of sgRNA in the mitochondria, and the results showed that the sgRNA had entered the mitochondria (Figure 4a).

Next, we extracted the whole genome of 293T cells, aimed at the knockout of the 12sr RNA gene locus, and analyzed the copy number changes of the mitochondrial genome in the cells using primers of 12sr RNA in the mitochondrial genome and β-actin in the nuclear genome. The qPCR results showed that the amplification efficiencies of the mitochondrial genome 12sr RNA and nuclear genome β-actin primers were almost identical, 99.548% and 97.271%, respectively. After transfection of the MitoCRISPR-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 30% (Figure 5). These results indicated that we successfully constructed the mitochondrial gene knockout plasmid pMitoCRISPR1-KO-12s rRNA vector, which successfully knocked out the mitochondrial genome after the plasmid vector was introduced into 293T cells.

Example 3 Mitochondrial gene knockout targeting the mitochondrial cytb gene locus

In this example, the cytb gene on the mitochondrial genome is selected and knocked out, and the specific steps are as follows: the annealing reaction is performed using the method described in Example 2.

The sgRNA target sequence of Cytb is: ATCCCGTTTCGTGCAAGAAT; the RP sequence is: TCTCCCTGAGCTTCAGGGAG; the Cytb gene sgRNA primer sequence for insertion into the Bbs I restriction site of pMitoCRISPR1 plasmid is as follows: Mito-KO-H-Cytb-F: CACCGTCTCCCCTGAGCTTCAGGGAGATCCCGTTTCGTGCAAGAAT;

Mito-KO-H-Cytb-R:AAACATTCTTGCACGAAACGGGATCTCCCTGAAGCTCAGGGAGAC;

The mitochondrial Cytb gene knockout vector pMitoCRISPR1-KO-Cytb was constructed using the method described in Example 2, and verified by sequencing. Next, the plasmid vector was transfected into 293T cells by the method described in Example 2, and after 3 days, the efficiency of the plasmid vector for mitochondrial genome knockout was detected by the method described in Example 2. After the above pMitoCRISPR1-KO-Cytb plasmid was introduced into 293T cells, it was found that the cells expressed EGFP (Figure 2). At the same time, the protein of the above cells was extracted and analyzed by Western Blot, the results showed the expression of Cas9 (Figure 4b). Next, we extracted the whole genome of the above cells, aimed at knocking out the Cytb gene locus, and analyzed the copy number changes of the mitochondrial genome in the cells by using the 12sr RNA of the mitochondrial genome and the β-actin primers of the nuclear genome. The qPCR results showed that the amplification efficiencies of the mitochondrial genome 12sr RNA and nuclear genome β-actin primers were almost identical, 99.548% and 97.271%, respectively. After transfection of the MitoCRISPR-KO-Cytb knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 30% (Figure 6). These results indicated that we successfully constructed the mitochondrial gene knockout plasmid pMitoCRISPR1-KO-Cytb vector, which successfully knocked out the mitochondrial genome after the plasmid vector was introduced into 293T cells.

Example 4 Effects of Different MLS Elements on MitoCRISPR Vectors on Mitochondrial Gene Knockout

There are thousands of proteins or RNAs in mitochondria, most of which are encoded by nuclear genes. These proteins must enter the mitochondria to function, and the signal peptide sequence that guides these proteins into the mitochondria is called the MLS sequence. In this example, MLS elements of two different genes were used, and the effects of the two on the efficiency of mitochondrial gene knockout were compared. The specific method is as follows: first, two Age I restriction enzyme sites were introduced into the N-terminal of the Cas9 protein; then, two different MLSs were replaced on the Age I site: Cox8A-MLS and ATP5B-MLS, respectively constructed MitoCRISPR vector. In this example, the sgRNA target sequence of 12sr RNA on the mitochondrial genome was inserted into the above-mentioned MitoCRISPR vectors with Cox8A-MLS and ATP5B-MLS sequences respectively, and the mitochondrial gene knockout plasmids, pMitoCRISPR1-Cox8A-MLS-KO-12sr were respectively constructed RNA and pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA. Three days after the above plasmid was introduced into 293T cells, the whole genome of the cells was extracted, and the qPCR method described in Example 2 was used to analyze the copy number changes of the mitochondrial genome in the cells using the 12sr RNA of the mitochondrial genome and the β-actin primers of the nuclear genome, and then verified Knockdown efficiency of the mitochondrial genome to determine the effect of Cox8A-MLS and ATP5B-MLS elements on mitochondrial gene knockdown.

The results showed that after transfection of pMitoCRISPR5-ATP5B-MLS-KO-12srRNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 30% (as shown in Figure 7), transfection of pMitoCRISPR1-Cox8A-MLS-KO-12srRNA After knocking out the plasmid, the mitochondrial genome copy number in 293T cells decreased by about 22% (Figure 7). These results indicated that the mitochondrial gene knockout vector with the ATP5B-MLS sequence was more efficient than the mitochondrial gene knockout vector with the Cox8A-MLS sequence.

Example 5 Effect of the position of the RP sequence on the MitoCRISPR vector on mitochondrial gene knockout

There are thousands of proteins or RNAs in mitochondria, most of which are encoded by nuclear genes. Studies have shown that the RP sequence plays a crucial role in guiding the exogenous RNA into the mitochondria. This example optimizes the position of the RP sequence in the MitoCRISPR system to exclude its influence on the protein function in the system. In the experiment, we put the RP sequence before the sgRNA sequence, before the 3'UTR sequence and after the 3'UTR sequence, respectively constructing MitoCRISPR-RP-sgRNA, MitoCRISPR-RP-3'UTR, MitoCRISPR-3'UTR-RP (+) and MitoCRISPR-3'UTR-RP(-) and other pMitoCRISPR1 and pMitoCRISPR9 to pMitoCRISPR11 plasmid vectors, in order to observe the impact of their positions on the MitoCRISP system. Next, for the 12sr RNA gene on the mitochondrial genome, the mitochondrial gene knockout plasmid vectors pMitoCRISPR1-RP-sgRNA-KO-12sr RNA, pMitoCRISPR9-RP were respectively constructed with the 12sr RNA gene sgRNA sequence and the RP sequence placed at the above different positions -3'UTR-KO-12sr RNA, pMitoCRISPR10 -3'UTR-RP(+)-sgRNA-KO-12sr RNA and pMitoCRISPR11-3'UTR-RP(-)-KO-12sr RNA plasmids. These plasmids were transfected into 293T cells to knock out the mitochondrial genome as described above. Three days after transfection, the mitochondrial genome copy number changes were detected by the above-mentioned qPCR method to evaluate the efficiency of the MitoCRISPR system. The results showed (Figure 8): after transfection of pMitoCRISPR1-RP-sgRNA-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 22%, and the transfection of pMitoCRISPR9-RP-3'UTR-KO- After the 12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 22%. The genome copy number decreased by about 42%. After transfection of pMitoCRISPR11-3'UTR-RP(-)-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 5%. These results indicated that the knockout efficiency of the RP sequence added after the 3'UTR was the highest (Fig. 8).

Example 6 Effects of Different 3'UTR Elements on MitoCRISPR Vectors on Mitochondrial Gene Knockout

There are thousands of proteins or RNAs in mitochondria, most of which are encoded by nuclear genes. Studies have shown that RP sequences and 3'UTR elements play a crucial role in guiding foreign RNA into mitochondria. In this example, we used 3'UTR elements of four different genes in addition to RP sequences. And compared their effects on mitochondrial gene knockout efficiency. The specific method is as follows: We replaced four different 3'UTRs at the Spe I restriction site of the MitoCRISPR vector: Cox8A-3'UTR, MRPS12-3'UTR, SOD2-3'UTR and ATP5B-3'UTR, and constructed MitoCRISPR2-Cox8A-3'UTR, MitoCRISPR3-SOD2-3'UTR, MitoCRISPR1-MRPS12-3'UTR and MitoCRISPR4-ATP5B-3'UTR plasmid vectors with the above four 3'UTR sequences were obtained. Next, in this example, for the 12sr RNA gene on the mitochondrial genome, the sgRNA sequence of the 12sr RNA gene was inserted into the above four vectors with different 3'UTR sequences to construct pMitoCRISPR2-Cox8A-3'UTR-KO-12srRNA, pMitoCRISPR3-SOD2-3'UTR-KO-12sr RNA, pMitoCRISPR1-MRPS12-3'UTR-KO-12sr RNA and pMitoCRISPR4-ATP5B-3'UTR-KO-12sr RNA plasmids. After these plasmid vectors were introduced into 293T cells, the copy number changes of the mitochondrial genome in the cells were analyzed by the method described above. The results showed (Figure 9): after transfection of MitoCRISPR2-Cox8A-3'UTR-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 43%, and the transfection of MitoCRISPR3-SOD2-3'UTR- After the KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 13%. After transfection of MitoCRISPR4-ATP5B-3'UTR-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by about 34%. The knockout efficiency of the mitochondrial gene knockout plasmid with the Cox8A-3'UTR sequence was the highest (Figure 9).

The above descriptions are only preferred embodiments of the present invention, and all equivalent changes and modifications made according to the scope of the patent application of the present invention shall fall within the scope of the present invention.

SEQUENCE LISTING

<110> Fujian Normal University

<120> Method for Targeted Editing of Mitochondrial Genome Using CRISPR/Cas9

<130> 22

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 9645

<212>DNA

<213> pMitoCRISPR1

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgccagaaga agtgacggct 360

gggggcacag tgggctgggc gcccctgcag aacatgaacc ttccgctcct ggctgccaca 420

gggtcctccg atgctggcct ttgcgcctct agaggcagcc actcatggat tcaagtcctg 480

gctccgcctc ttccatcagg accacttttt ttagcgcgtg cgccaattct gcagacaaat 540

ggctctagag gtacccgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 600

cgacccccgc ccattgacgt caatagtaac gccaataggg actttccatt gacgtcaatg 660

ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag 720

tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattgtg cccagtacat 780

gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat 840

ggtcgaggtg agccccacgt tctgcttcac tctccccatc tcccccccct ccccaccccc 900

aattttgtat ttatttattt tttaattatt ttgtgcagcg atgggggcgg gggggggggg 960

ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga ggcggagagg 1020

tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg 1080

gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg cgacgctgcc 1140

ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc gccccggctc tgactgaccg 1200

cgttactccc acaggtgagc gggcgggacg gcccttctcc tccgggctgt aattagctga 1260

gcaagaggta agggtttaag ggatggttgg ttggtggggt attaatgttt aattacctgg 1320

agcacctgcc tgaaatcact ttttttcagg ttggaccggt gccaccatgt ccgtcctgac 1380

gccgctgctg ctgcggggct tgacaggctc ggcccggcgg ctcccagtgc cgcgcgccaa 1440

gatccattcg ttgatggact ataaggacca cgacggagac tacaaggatc atgatattga 1500

ttacaaagac gatgacgata agatggccgg tatccacgga gtcccagcag ccgacaagaa 1560

gtacagcatc ggcctggaca tcggcaccaa ctctgtgggc tgggccgtga tcaccgacga 1620

gtacaaggtg cccagcaaga aattcaaggt gctgggcaac accgaccggc acagcatcaa 1680

gaagaacctg atcggagccc tgctgttcga cagcggcgaa acagccgagg ccaccccggct 1740

gaagagaacc gccagaagaa gatacaccag acggaagaac cggatctgct atctgcaaga 1800

gatcttcagc aacgagatgg ccaaggtgga cgacagcttc ttccacagac tggaagagtc 1860

cttcctggtg gaagaggata agaagcacga gcggcacccc atcttcggca acatcgtgga 1920

cgaggtggcc taccacgaga agtaccccac catctaccac ctgagaaaga aactggtgga 1980

cagcaccgac aaggccgacc tgcggctgat ctatctggcc ctggcccaca tgatcaagtt 2040

ccggggccac ttcctgatcg agggcgacct gaaccccgac aacagcgacg tggacaagct 2100

gttcatccag ctggtgcaga cctacaacca gctgttcgag gaaaacccca tcaacgccag 2160

cggcgtggac gccaaggcca tcctgtctgc cagactgagc aagagcagac ggctggaaaa 2220

tctgatcgcc cagctgcccg gcgagaagaa gaatggcctg ttcggaaacc tgattgccct 2280

gagcctgggc ctgaccccca acttcaagag caacttcgac ctggccgagg atgccaaact 2340

gcagctgagc aaggacacct acgacgacga cctggacaac ctgctggccc agatcggcga 2400

ccagtacgcc gacctgtttc tggccgccaa gaacctgtcc gacgccatcc tgctgagcga 2460

catcctgaga gtgaacaccg agatcaccaa ggcccccctg agcgcctcta tgatcaagag 2520

atacgacgag caccaccagg acctgaccct gctgaaagct ctcgtgcggc agcagctgcc 2580

tgagaagtac aaagagattt tcttcgacca gagcaagaac ggctacgccg gctacattga 2640

cggcggagcc agccaggaag agttctacaa gttcatcaag cccatcctgg aaaagatgga 2700

cggcaccgag gaactgctcg tgaagctgaa cagagaggac ctgctgcgga agcagcggac 2760

cttcgacaac ggcagcatcc cccaccagat ccacctggga gagctgcacg ccattctgcg 2820

gcggcaggaa gatttttacc cattcctgaa ggacaaccgg gaaaagatcg agaagatcct 2880

gaccttccgc atcccctact acgtgggccc tctggccagg ggaaacagca gattcgcctg 2940

gatgaccaga aagagcgagg aaaccatcac cccctggaac ttcgaggaag tggtggacaa 3000

gggcgcttcc gccccagagct tcatcgagcg gatgaccaac ttcgataaga acctgcccaa 3060

cgagaaggtg ctgcccaagc acagcctgct gtacgagtac ttcaccgtgt ataacgagct 3120

gaccaaagtg aaatacgtga ccgagggaat gagaaagccc gccttcctga gcggcgagca 3180

gaaaaaggcc atcgtggacc tgctgttcaa gaccaaccgg aaagtgaccg tgaagcagct 3240

gaaagaggac tacttcaaga aaatcgagtg cttcgactcc gtggaaatct ccggcgtgga 3300

agatcggttc aacgcctccc tgggcacata ccacgatctg ctgaaaatta tcaaggacaa 3360

ggacttcctg gacaatgagg aaaacgagga cattctggaa gatatcgtgc tgaccctgac 3420

actgtttgag gacagagaga tgatcgagga acggctgaaa acctatgccc acctgttcga 3480

cgacaaagtg atgaagcagc tgaagcggcg gagatacacc ggctggggca ggctgagccg 3540

gaagctgatc aacggcatcc gggacaagca gtccggcaag acaatcctgg atttcctgaa 3600

gtccgacggc ttcgccaaca gaaacttcat gcagctgatc cacgacgaca gcctgacctt 3660

taaagaggac atccagaaag cccaggtgtc cggccagggc gtagcctgc acgagcacat 3720

tgccaatctg gccggcagcc ccgccattaa gaagggcatc ctgcagacag tgaaggtggt 3780

ggacgagctc gtgaaagtga tgggccggca caagcccgag aacatcgtga tcgaaatggc 3840

cagagagaac cagaccaccc agaagggaca gaagaacagc cgcgagagaa tgaagcggat 3900

cgaagagggc atcaaagagc tgggcagcca gatcctgaaa gaacaccccg tggaaaacac 3960

ccagctgcag aacgagaagc tgtacctgta ctacctgcag aatgggcggg atatgtacgt 4020

ggaccaggaa ctggacatca accggctgtc cgactacgat gtggaccata tcgtgcctca 4080

gagctttctg aaggacgact ccatcgacaa caaggtgctg accagaagcg acaagaaccg 4140

gggcaagagc gacaacgtgc cctccgaaga ggtcgtgaag aagatgaaga actactggcg 4200

gcagctgctg aacgccaagc tgattaccca gagaaagttc gacaatctga ccaaggccga 4260

gagaggcggc ctgagcgaac tggataaggc cggcttcatc aagagacagc tggtggaaac 4320

ccggcagatc acaaagcacg tggcacagat cctggactcc cggatgaaca ctaagtacga 4380

cgagaatgac aagctgatcc gggaagtgaa agtgatcacc ctgaagtcca agctggtgtc 4440

cgatttccgg aaggatttcc agttttacaa agtgcgcgag atcaacaact accaccacgc 4500

ccacgacgcc tacctgaacg ccgtcgtggg aaccgccctg atcaaaaagt accctaagct 4560

ggaaagcgag ttcgtgtacg gcgactacaa ggtgtacgac gtgcggaaga tgatcgccaa 4620

gagcgagcag gaaatcggca aggctaccgc caagtacttc ttctacagca acatcatgaa 4680

ctttttcaag accgagatta ccctggccaa cggcgagatc cggaagcggc ctctgatcga 4740

gacaaacggc gaaaccgggg agatcgtgtg ggataagggc cgggattttg ccaccgtgcg 4800

gaaagtgctg agcatgcccc aagtgaatat cgtgaaaaag accgaggtgc agacaggcgg 4860

cttcagcaaa gagtctatcc tgcccaagag gaacagcgat aagctgatcg ccagaaagaa 4920

ggactgggac cctaagaagt acggcggctt cgacagcccc accgtggcct attctgtgct 4980

ggtggtggcc aaagtggaaa agggcaagtc caagaaactg aagagtgtga aagagctgct 5040

ggggatcacc atcatggaaa gaagcagctt cgagaagaat cccatcgact ttctggaagc 5100

caagggctac aaagaagtga aaaaggacct gatcatcaag ctgcctaagt actccctgtt 5160

cgagctggaa aacggccgga agagaatgct ggcctctgcc ggcgaactgc agaagggaaa 5220

cgaactggcc ctgccctcca aatatgtgaa cttcctgtac ctggccagcc actatgagaa 5280

gctgaagggc tcccccgagg ataatgagca gaaacagctg tttgtggaac agcacaagca 5340

ctacctggac gagatcatcg agcagatcag cgagttctcc aagagagtga tcctggccga 5400

cgctaatctg gacaaagtgc tgtccgccta caacaagcac cgggataagc ccatcagaga 5460

gcaggccgag aatatcatcc acctgtttac cctgaccaat ctgggagccc ctgccgcctt 5520

caagtacttt gacaccacca tcgaccggaa gaggtacacc agcaccaaag aggtgctgga 5580

cgccaccctg atccaccaga gcatcaccgg cctgtacgag acacggatcg acctgtctca 5640

gctgggaggc gacaaaaggc cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa 5700

ggaattcggc agtggagagg gcagaggaag tctgctaaca tgcggtgacg tcgaggagaa 5760

tcctggccca atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt 5820

cgagctggac ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga 5880

tgccacctac ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc 5940

ctggcccacc ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga 6000

ccacatgaag cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg 6060

caccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 6120

cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 6180

cctggggcac aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa 6240

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 6300

gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 6360

cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga 6420

tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct 6480

gtacaagtaa ctcgagcaga agaagtgacg gctgggggca cagtggggctg ggcgcccctg 6540

cagaacatga accttccgct cctggctgcc acagggtcct ccgatgctgg cctttgcgcc 6600

tctagaggca gccactcatg gattcaagtc ctggctccgc ctcttccatc aggaccga 6660

attctaacta gagctcgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt 6720

gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc 6780

taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt 6840

ggggtggggc aggacagcaa gggggaggat tgggaagaga atagcaggca tgctggggag 6900

cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 6960

actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg 7020

agcgagcgag cgcgcagctg cctgcagggg cgcctgatgc ggtattttct ccttacgcat 7080

ctgtgcggta tttcacaccg catacgtcaa agcaaccata gtacgcgccc tgtagcggcg 7140

cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 7200

tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 7260

gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 7320

accccaaaaa acttgatttg ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 7380

tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 7440

gaacaacact caaccctatc tcgggctatt cttttgattt ataagggatt ttgccgattt 7500

cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 7560

tattaacgtt tacaatttta tggtgcactc tcagtacaat ctgctctgat gccgcatagt 7620

taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc 7680

cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt 7740

caccgtcatc accgaaacgc gcgagacgaa agggcctcgt gatacgccta tttttatagg 7800

ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg ggaaatgtgc 7860

gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac 7920

aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt 7980

tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag 8040

aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg 8100

aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa 8160

tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc 8220

aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag 8280

tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa 8340

ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc 8400

taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg 8460

agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa 8520

caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg caacaattaa 8580

tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg 8640

gctggtttat tgctgataaa tctggagccg gtgagcgtgg aagccgcggt atcattgcag 8700

cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg 8760

caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt 8820

ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt 8880

aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 8940

gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 9000

atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 9060

tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 9120

gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 9180

actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 9240

gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 9300

agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 9360

ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 9420

aggcggacag gtatccggta agcggcaggg tcggaacagg aggagcgcacg agggagcttc 9480

cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 9540

gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 9600

cctttttacg gttcctggcc ttttgctggc cttttgctca catgt 9645

<210> 2

<211> 222

<212>DNA

<213> Cox8A-3'UTR

<400> 2

aggggtccgt tctgtccctc acactgtgac ctgaccagcc ccaccggccc atcctggtca 60

tgttactgca tttgtggccg gcctcccctg gatcatgtca ttcaattcca gtcacctctt 120

ctgcaatcat gacctcttga tgtctccatg gtgacctcct tgggggtcac tgaccctgct 180

tggtggggtc ccccttgtaa caataaaatc tattaaact tt 222

<210> 3

<211> 201

<212>DNA

<213> SOD2-3'UTR

<400> 3

accacgatcg ttatgctgat cataccctaa tgatcccagc aagataatgt cctgtcttct 60

aagatgtgca tcaagcctgg tacatactga aaaccctata aggtcctgga taatttttgt 120

ttgattattc attgaagaaa catttatttt ccaattgtgt gaagtttttg actgttaata 180

aaagaatctg tcaaccatca a 201

<210> 4

<211> 162

<212>DNA

<213> MRPS12-3'UTR

<400> 4

cagaagaagt gacggctggg ggcacagtgg gctgggcgcc cctgcagaac atgaaccttc 60

cgctcctggc tgccacaggg tcctccgatg ctggcctttg cgcctctaga ggcagccact 120

catggattca agtcctggct ccgcctcttc catcaggacc ac 162

<210> 5

<211> 146

<212>DNA

<213>ATP5B-3'UTR

<400> 5

ggggtctttg tcctctgtac tgtctctctc cttgccccta acccaaaaag cttcattttt 60

ctgtgtaggc tgcacaagag ccttgattga agatatattc tttctgaaca gtatttaagg 120

tttccaataa aatgtacacc cctcag 146

<210> 6

<211> 141

<212>DNA

<213>ATP5B-MLS

<400> 6

atgttggggt ttgtgggtcgggtggccgct gctccggcct ccggggcctt gcggagactc 60

accccttcag cgtcgctgcc cccagctcag ctcttactgc gggccgctcc gacggcggtc 120

catcctgtca gggactatgc g 141

<210> 7

<211> 87

<212>DNA

<213> Cox8A-MLS

<400> 7

atgtccgtcc tgacgccgct gctgctgcgg ggcttgacag gctcggcccg gcggctccca 60

gtgccgcgcg ccaagatcca ttcgttg 87

<210> 8

<211> 20

<212>DNA

<213>RP

<400> 8

tctccctgag cttcagggag 20

<210> 9

<211> 63

<212>DNA

<213> 2A

<400> 9

ggcagtggag agggcagagg aagtctgcta acatgcggtg acgtcgagga gaatcctggc 60

cca 63

<210> 10

<211> 19

<212>DNA

<213> Artificial sequence

<400> 10

ctcaccacct cttgctcag 19

<210> 11

<211> 20

<212>DNA

<213> Artificial sequence

<400> 11

ggctacacct tgacctaacg 20

<210> 12

<211> 326

<212>DNA

<213> Artificial sequence

<400> 12

aggacgaaac accgggtctt cgagaagacc tgttttagag ctagaaatag caagttaaaa 60

taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgccag aagaagtgac 120

ggctgggggc acagtggggct gggcgcccct gcagaacatg aaccttccgc tcctggctgc 180

cacagggtcc tccgatgctg gcctttgcgc ctctagaggc agccactcat ggattcaagt 240

cctggctccg cctcttccat caggaccaca ctagtttttt tagcgcgtgc gccaattctg 300

cagacaaatg gctctagagg tacccg 326

<210> 13

<211> 39

<212>DNA

<213> Artificial sequence

<400> 13

atcttgtgga aaggacgaaa caccgggtct tcgagaaga 39

<210> 14

<211> 42

<212>DNA

<213> Artificial sequence

<400> 14

gtaagttatg taacgggtac ctctagagcc atttgtctgc ag 42

<210> 15

<211> 451

<212>DNA

<213> Artificial sequence

<400> 15

accggtgcca ccatgtccgt cctgacgccg ctgctgctgc ggggcttgac aggctcggcc 60

cggcggctcc cagtgccgcg cgccaagatc cattcgttga tggactataa ggaccacgac 120

ggagactaca aggatcatga tattgattac aaagacgatg acgataagat ggccggtatc 180

cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg caccaactct 240

gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt caaggtgctg 300

ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct gttcgacagc 360

ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata caccagacgg 420

aagaaccgga tctgctatct gcaagagatc t 451

<210> 16

<211> 20

<212>DNA

<213> Artificial sequence

<400> 16

taagggctat cgtagttttc 20

<210> 17

<211> 45

<212>DNA

<213> Artificial sequence

<400> 17

caccgtctcc ctgagcttca gggagtaagg gctatcgtag ttttc 45

<210> 18

<211> 45

<212>DNA

<213> Artificial sequence

<400> 18

aaacgaaaac tacgatagcc cttactccct gaagctcagg gagac 45

<210> 19

<211> 20

<212>DNA

<213> Artificial sequence

<400> 19

atcccgtttc gtgcaagaat 20

<210> 20

<211> 20

<212>DNA

<213> Artificial sequence

<400> 20

tctccctgag cttcagggag 20

<210> 21

<211> 45

<212>DNA

<213> Artificial sequence

<400> 21

caccgtctcc ctgagcttca gggagatccc gtttcgtgca agaat 45

<210> 22

<211> 45

<212>DNA

<213> Artificial sequence

<400> 22

aaacattctt gcacgaaacg ggatctccct gaagctcagg gagac 45

Claims (1)

1. Utilize CRISPR/Cas9 technology to carry out the method for targeted editing of mitochondrial genome, it is characterized in that: comprise the steps: (1) Construct a MitoCRISPR vector containing replaceable gene regulatory elements; (2) Insert the sgRNA of the specific gene into the MitoCRISPR vector to construct the mitochondrial gene editing vector; (3) Introduce the above-mentioned mitochondrial gene modification vector into human or animal cells, and perform mitochondrial genome editing to achieve the purpose of knocking out or modifying the target gene; The method for constructing the MitoCRISPR vector is to make the following transformations on the backbone plasmid vector PX459; the backbone plasmid vector contains the basic elements of the CRISPR system, namely the Cas9 gene and the U6 promoter; after the U6 promoter, add The signal sequence, that is, the 3'UTR sequence; the 3'UTR sequence helps to stabilize the RNA so that it can come out of the nucleus and locate on the mitochondrial outer membrane; then, add the RP sequence to help the RNA enter the mitochondria; then, remove the front of the Cas9 gene The nuclear localization signal of the nuclear localization signal, adding the signal sequence that promotes the entry of foreign proteins into the mitochondria, that is, the MLS sequence; finally obtained the MitoCRISPR plasmid vector for specific gene editing of the mitochondrial genome; The specific method of step (2) is: select the MitoCRISPR plasmid vector in step (1) as the backbone, insert the sgRNA sequence of the target gene or site into the restriction endonuclease BbsI site, and construct a mitochondrial gene knockout or editing vector; The specific method of step (3) is: introduce the plasmid vector obtained in step (2) into human or animal cells, extract the whole genome of the cells after 3 days, and use real-time fluorescent quantitative PCR to detect the changes in the copy number of the mitochondrial genome to evaluate the ability of the MitoCRISPR system to target the mitochondrial genome. Knockout efficiency; or DNA sequencing to determine the effect of gene editing; Real-time fluorescent quantitative PCR primers are as follows: H-12sr RNA-qpcr-F: 5'-CTCACCACCTCTTGCTCAG-3', H-12sr RNA-qpcr-R: 5'-GGCTACACCTTGACCTAACG-3'; β-actin is used as an internal control; The RP sequence is behind the 3'UTR sequence, and the method does not include a disease treatment and diagnosis method.