CN106520830B - method for targeted editing of mitochondrial genome by using CRISPR/Cas9 - Google Patents

Abstract

The invention provides a method for targeted editing of a mitochondrial genome by using a CRISPR/Cas9 technology, which comprises the following steps: constructing a mitoCRISPR vector targeting a mitochondrial genome; inserting the specific sgRNA of mitochondria into a MitoCRISPR vector to construct a mitochondrial gene knockout or modification vector; the mitochondrial gene knockout or modification vector is introduced into human or animal cells, so that the aim of editing the mitochondrial genome of the human or animal cells is fulfilled. The method is used for modifying the Cas9 protein and sgRNA elements, enabling the elements to enter mitochondria, targeting the corresponding genes of the genome of the elements, and carrying out gene knockout and modification so as to remove mutant DNA in the mitochondria, thereby being expected to treat various mitochondrial diseases.

Description

method for targeted editing of mitochondrial genome by using CRISPR/Cas9

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a method for targeted editing of a mitochondrial genome by using a CRISPR/Cas9 technology.

Background

Mitochondria are important organelles of eukaryotic cells and produce the energy required by most cells. In addition to providing energy, mitochondria are also involved in a variety of cellular functions, including the control of cell cycle and growth, signaling, cell differentiation, cell death, and the like. Mitochondrial genomes are double-stranded circular genomes, mtDNA, mutations of which can involve a variety of tissues and organs, ultimately leading to a variety of diseases. In most cases, mutant mtDNA coexists with wild-type mtDNA, referred to as mtDNA heterogeneity. When the genome proportion of the mutant exceeds 80%, clinical symptoms of some mitochondrial diseases can be shown. Common mitochondrial diseases include mitochondrial myopathy, mitochondrial encephalopathy, mitochondrial encephalomyopathy and the like. Typical diseases such as Leber's Hereditary Optic Neuropathy (LHON) have the main symptoms of optic nerve degeneration, which is an acute or subacute onset maternal genetic disease and is more common in men. More than 700 mutations are currently found in mitochondria, and more than 200 diseases are known to be caused by mutations in mitochondrial DNA, and the major effects of these mutations are organs requiring large amounts of energy, including the heart, skeletal muscles and brain, where syndromes are often first manifested. Survey data showed that one in every 200 infants worldwide was affected by maternal mitochondrial genes, and one in every 6500 infants was affected by mitochondrial gene defects with severe disease. Mitochondrial function is shared by the nuclear and mitochondrial genomes, and therefore, the formation of mtDNA heterogeneity to cause the corresponding phenotype is a complex process. This makes treatment of mitochondrial genetic diseases exceptionally difficult.

Two approaches to eliminate mitochondrial site mutations have been developed at the molecular level, namely: restriction enzymes selectively target mutated mitochondrial DNA and edit mitochondrial genomes using ZFN/TALEN technology.

if certain mtDNA sites are mutated to restriction endonuclease sites, the mutated mtDNA can be selectively degraded using a method in which restriction endonucleases selectively target the mutated mitochondrial DNA. For example, mutation at position T8993G of the human mitochondrial-derived ATPase6 gene results in a new unique SmaI site. In 2002, TANAKA M and others added a mitochondrial localization signal to a restriction enzyme SmaI gene, and after expression in a nuclear gene expression system of cells, the mitochondrial localization signal was transported into mitochondria, and introduction of the restriction enzyme SmaI significantly reduced the amount of mutated mitochondrial DNA. Therefore, the delivery of a specific endonuclease gene to a corresponding patient at a specific mutation site is expected to reduce the proportion of mutant mtDNA. The use of this gene editing method presupposes that a new specific endonuclease site must be generated after mutation of the mitochondrial gene. However, it is difficult to find a single mutation cleavage site in a sequence of about 16.5kb in the mitochondrial genome, which also makes practical operable mtDNA mutations limited.

The Aaron Klug research group knocked out mitochondrial genomes for the first time in 2006 using ZFN (Zinc-Finger nuclear) technology. The research group successfully rescues partial activity of the ATPase6 gene by knocking out the T8993G site of the mitochondrial ATPase6 gene. The 2008 Aaron Klug research group uses this technology to knock out the T8993G site of ATPase6 gene, and further directly observes that the mitochondrial copy number of the T8993G mutant site of ATPase6 gene is remarkably reduced.

TALENs technology was first used for mitochondrial gene editing in 2013 by doctor Carlos t. Moraes, miller medical school, miami university. Their studies showed that: once mitoTALENs bind to and cleave DNA of a particular target, the mutated mtDNA is degraded. The decrease in total mtDNA stimulates cells to increase their mtDNA by replicating the unaffected mitochondrial genome. After two weeks, mtDNA levels returned to normal. Since the mutant mtDNA is deleted, the normal mtDNA is retained and amplified, and thus mitochondria in the cell mostly carry the normal mtDNA.

The CRISPR/Cas9 technology is a new gene editing technology that has been developed in recent years. During targeting, the CRISPR/Cas9 system generates Double-Strand Breaks (DSB) in target DNA complementary to sgrnas before 3' End of spacer adjacent motif (PAM) through sgRNA-Cas9 system, and then the cells Repair the DNA through Non-Homologous End Joining (NHEJ) or Homologous-mediated Double-Strand Repair (HDR) to achieve genome modification. Compared with the ZFN/TALEN technology, the CRISPR/Cas9 technology has the advantages of being easier to operate and stronger in expansibility, and is widely applied to various research objects. For cells with lower transfection efficiency, the CRISPR/Cas9 system can also introduce the corresponding vector into cells by means of lentivirus infection. TALENs technology, however, is not suitable for cell infection by lentiviral vector infection due to the concern that recombinant mutations may occur. The CRISPR/Cas9 system also well solves the problem of overlarge vectors of TALENs systems.

In 2010, professor Michael a. teitel found that a protein called polynucleotide phosphorylase (PNPASE) plays an important role in regulating RNA entry into mitochondria. Decreasing expression of PNPASE affects the level of RNA entry into the mitochondria and thus the synthesis of proteins required to maintain electron transport. Meanwhile, unprocessed mitochondrial RNA accumulates, protein translation is inhibited, and energy production is hindered, which leads to arrest of cell growth. On this basis, Michael a. teitel et al corrected human mitochondrial mutation defects for the first time by targeting RNA in 2012, which would be helpful for the treatment of mitochondrial-related diseases. Researchers first select stable repair RNA that comes out of the nucleus and is localized on the outer mitochondrial membrane, and then design an export sequence to help RNA enter the mitochondria. Once RNAs appear near the transporter at the surface of mitochondria, the RNA is guided into the mitochondria using a second delivery sequence (RP sequence). With these two sequences, broad spectrum RNAs can be targeted and guided into mitochondria. Researches prove that the method can efficiently guide the exogenous RNA into mitochondria.

the invention introduces a novel method for knocking out mitochondrial genes. On the basis of the work, the CRISPR/Cas9 technology is modified, namely Cas9 and sgRNA are modified, so that the modified CRISPR/Cas9 system has the capability of entering mitochondria, thereby targeting specific genes or sites on a mitochondrial genome and realizing the knockout and modification of specific genes, mutant genes or sites of the genes. Therefore, by applying the CRISPR/Cas9 technology for editing mitochondrial genes, which is developed by us, the method has the potential of conveniently clearing the mitochondrial mutant DNA, so that various mitochondrial diseases are expected to be treated.

disclosure of Invention

The invention aims to provide a simple and convenient method for targeted editing of specific genes or sites on a mitochondrial genome. The method accurately targets specific genes or loci on a mitochondrial genome by using the modified CRISPR/Cas9 system, avoids the complicated process of constructing a vector in other methods, greatly reduces the time for constructing the vector, and greatly improves the gene knockout or modification and modification efficiency.

the invention adopts the following technical scheme:

A method for targeted editing of a mitochondrial genome using CRISPR/Cas9, comprising the steps of:

(1) Constructing a MitoCRISPR vector;

(2) Inserting sgRNA of a specific gene into a MitoCRISPR vector to construct a mitochondrial gene editing vector; the gene editing comprises gene knockout and gene modification;

(3) Introducing the mitochondrial gene editing vector into human or animal cells such as 293T cells, and knocking out or modifying a mitochondrial genome to achieve the aim of knocking out or modifying a target gene;

The method for constructing the MitoCRISPR vector comprises the following steps of modifying a skeleton plasmid vector PX459 as follows, wherein the skeleton plasmid vector comprises basic elements of a CRISPR system, namely a Cas9 protein gene and a U6 promoter; a signal sequence for promoting the foreign RNA to enter mitochondria, namely a 3' UTR sequence, is added behind a U6 promoter; the 3' UTR sequence helps to stabilize RNA, allowing it to exit the nucleus and be localized on the outer mitochondrial membrane; then, RP sequences are added to help the RNA enter the mitochondria; then, removing the nuclear localization signal in front of the Cas9 gene, and adding a signal sequence for promoting the foreign protein to enter mitochondria, namely an MLS sequence; finally, 11 MitoCRISPR plasmid vectors which can be used for carrying out mitochondrial genome specific gene editing are obtained.

The specific method of the step (2) is as follows: selecting one MitoCRISPR plasmid in the step (1) as a framework, inserting a sgRNA sequence of a target gene or site into a BbsI site of a restriction endonuclease, and constructing a mitochondrial gene knockout or editing vector.

The specific method of the step (3) is as follows: introducing the plasmid knockout vector obtained in the step (2) into human or animal cells, extracting a cell whole genome after 3 days, and detecting copy number change of a mitochondrial genome by using real-time fluorescent quantitative PCR (polymerase chain reaction) so as to evaluate the knockout efficiency of the MitoCRISPR system on the mitochondrial genome; or the effect of gene editing can be determined by DNA sequencing.

the method for constructing the MitoCRISPR vector pMitoCRISPR-1 vector comprises the following steps: a 3 'UTR sequence of a mitochondrial localization signal MRPS12 gene is added behind a U6 promoter to enhance the stability of sgRNA transcribed and construct a plasmid of pMito-U6-BbsI-3' UTR; then, removing the nuclear localization signal before the Cas9 gene, adding a mitochondrial localization signal and a mitochondrial localization signal of the Cox8A gene to help the Cas9 protein enter mitochondria, and constructing a pMito-U6-RP-BbsI-3' UTR-CBh-MLS-Cas9 plasmid; EGFP was then added after Cas9 to facilitate observation of transfection efficiency. Meanwhile, a 3' UTR sequence of a mitochondrial localization signal MRPS12 gene is added behind a Cas9 expression frame to stabilize the whole structure. The pMitoCRISPR1 plasmid vector with the following module U6-RP-BbsI-3 'UTR-CBh-MLS-Cas 9-2A-GFP-3' UTR from the 5 '-3' end is obtained. The basic elements of the CRISPR system, namely the Cas9 gene and the guide RNA component initiated by the U6 promoter, are contained on the MitoCRISPR plasmid; the 3 'UTR sequence on the vector helps stabilize the RNA so that it can exit the nucleus and be localized on the outer membrane of mitochondria, then the input sequence-RP sequence at the end of RNA 5' helps the RNA enter the mitochondria; once the 3' UTR sequence helps RNAs appear on the surface of mitochondria, the RP sequence is used to guide the RNA into the targeted mitochondria.

The obtained MitoCRISPR plasmid vector comprises the following gene expression and regulatory elements in the order of 5 '-terminal → 3' -terminal: a U6 promoter for controlling expression of sgrnas; BbsI, restriction endonuclease sites, and sgRNA sequences which can be used for inserting target genes; a 3' UTR to enhance stability of the sgRNA on the mitochondrial outer membrane; CBh is a chicken beta-actin gene promoter element and is used for controlling the expression of Cas9 protein; cas9, a Cas9 nuclease, for sgRNA-guided gene cleavage, modification, and integration; UTR2 for stabilizing mRNA of Cas 9; 2A, is a self-cleaving peptide; GFP, green fluorescent protein gene.

The resulting MitoCRISPR plasmid vector further comprises an RP sequence for directing the sgRNA into the mitochondria, which RP sequence can be located before the sgRNA, between the sgRNA and the 3 'UTR, or after the 3' UTR.

The gene expression and regulation elements added on the skeleton plasmid vector comprise: 3' UTR sequence, RP sequence, MLS mitochondrial localization signal and 2A sequence, as listed below.

Cox8A-3’UTR：AGGGGTCCGTTCTGTCCCTCACACTGTGACCTGACCAGCCCCACCGGCCCATCCTGGTCATGTTACTGCATTTGTGGCCGGCCTCCCCTGGATCATGTCATTCAATTCCAGTCACCTCTTCTGCAATCATGACCTCTTGATGTCTCCATGGTGACCTCCTTGGGGGTCACTGACCCTGCTTGGTGGGGTCCCCCTTGTAACAATAAAATCTATTTAAACTTT。

SOD2-3’UTR：

ACCACGATCGTTATGCTGATCATACCCTAATGATCCCAGCAAGATAATGTCCTGTCTTCTAAGATGTGCATCAAGCCTGGTACATACTGAAAACCCTATAAGGTCCTGGATAATTTTTGTTTGATTATTCATTGAAGAAACATTTATTTTCCAATTGTGTGAAGTTTTTGACTGTTAATAAAAGAATCTGTCAACCATCAA。

MRPS12-3’UTR：

CAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTGGGCGCCCCTGCAGAACATGAACCTTCCGCTCCTGGCTGCCACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGAGGCAGCCACTCATGGATTCAAGTCCTGGCTCCGCCTCTTCCATCAGGACCAC。

ATP5B-3’UTR：

GGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGCACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTCAG。

ATP5B-MLS：ATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACTCACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACTATGCG。

Cox8A-MLS：ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTG。

RP：TCTCCCTGAGCTTCAGGGAG。

2A：GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA。

The above different combinations and listed elements will construct 11 MitoCRISPR plasmid vectors, namely, pMitoCRISPR1 to pMitoCRISPR11 (fig. 1). sgRNA, single-stranded guide RNA, the single-stranded guide RNA sequence is the target sequence for mitochondrial gene knockout and modification.

The method for constructing the MitoCRISPR vector pMitoCRISPR1-pMitoCRISPR11 comprises the following steps: two AgeI restriction sites were introduced at the N-terminus of Cas9 gene, and then we replaced two different MLSs at the AgeI restriction sites: cox8A-MLS and ATP 5B-MLS; four different 3' UTRs can be replaced at the SpeI restriction endonuclease site of the MitoCRISPR plasmid vector: MRPS12-3 'UTR, Cox 8A-3' UTR, SOD2-3 'UTR and ATP 5B-3' UTR. RP sequences RP-sgRNA, RP-3 ' UTR, 3 ' UTR-RP (+) and 3 ' UTR-RP (-) are added at different positions behind the U6 promoter. Obtaining 11 different MitoCRISPR vectors in total, wherein pMitoCRISPR1-pMitoCRISPR4 has a Cox8A-MLS sequence; pMitoCRISPR5-pMitoCRISPR8 has ATP5B-MLS-MLS sequence; pMitoCRISPR1 and pMitoCRISPR5 have MRPS 12-3' UTR sequences; pMitoCRISPR2 and pMitoCRISPR6 carry the Cox 8A-3' UTR sequence; pMitoCRISPR3 and pMitoCRISPR7 have SOD 2-3-3' UTR sequences; pMitoCRISPR4 and pMitoCRISPR8 contain an ATP 5B-3' UTR sequence; the RP sequence of pMitoCRISPR9 is intermediate to the sgRNA and the 3' UTR; the RP sequence of pMitoCRISPR10 is forward after the 3' UTR; the RP sequence of pMitoCRISPR11 is inverted after the 3' UTR. The partial structures of the constructed plasmids pMitoCRISPR1 to pMitoCRISPR11 are shown in FIG. 1. The whole sequence of the pMitoCRISPR1 vector is shown in SEQ ID No. 1.

The method for constructing the mitochondrial genome target gene knockout vector comprises the following steps: one of the MitoCRISPR plasmids is selected as a framework, and a sgRNA sequence of a target gene or site is inserted into a BbsI site of a restriction endonuclease to construct a mitochondrial gene knockout recombinant vector. Taking a pMitoCRISPR1 plasmid vector as an example, specifically, the pMitoCRISPR1 plasmid vector is cut by BbsI restriction endonuclease, and then the cut vector is purified by ethanol precipitation; then, the sgRNA target gene sequence containing the RP sequence is annealed and then connected with the enzyme-cut pMitoCRISPR1 plasmid vector. And transforming, selecting bacteria and identifying the connected vector to obtain the recombinant vector. For example, the plasmid of pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO-Cytb is constructed by designing one sgRNA for each of the 12sr RNA and Cytb genes of the human mitochondrial genome.

The specific method for editing mitochondrial genome in human or animal cells such as 293T cells is as follows: the pMitoCRISPR1-KO-12sr RNA and the pMitoCRISPR1-KO-Cytb plasmid are respectively transfected into 293T cells by utilizing a lipofection technology, the whole genome of the cells is extracted after 3 days, and the copy number change of the mitochondrial genome is detected by utilizing real-time fluorescence quantitative PCR (polymerase chain reaction) so as to evaluate the knockout efficiency of the mitoCRISPR system on the mitochondrial genome. The primers used for the real-time fluorescent quantitative PCR detection are as follows: h-12sr RNA-qpcr-F: 5'-CTCACCACCTCTTGCTCAG-3', H-12sr RNA-qpcr-R: 5'-GGCTACACCTTGACCTAACG-3'; beta-actin was used as an internal control.

The invention has the advantages that:

1. The established MitoCRISPR plasmid vector system has various regulation and control components, including U6-RP-BbsI-3 'UTR-CBh-MLS-Cas 9-2A-GFP-3' UTR, and can meet the requirements of the target sgRNA sequence to be inserted and the stable expression and action of Cas9 for gene cutting in mitochondria; the mitochondrion gene knockout vector containing the target sgRNA sequence established in the MitoCRISPR plasmid vector simultaneously has a sgRNA expression element and a Cas9 gene expression element, and has higher transfection efficiency than a double-plasmid transfection system with the sgRNA expression element and the Cas9 gene expression element separated from each other.

2. The MitoCRISPR plasmid vector is provided with a plurality of restriction enzyme cutting sites, and each regulating element can be easily replaced. 3. The mitoCRISPR plasmid vector selects a special restriction endonuclease site, namely a Bbs I restriction endonuclease site, and can be inserted into a target sgRNA sequence to prevent the vector from self-ligation. The synthesized oligonucleotide is annealed and then directly connected with an enzyme digestion carrier. By adopting the method for cloning, the connection efficiency of the sgRNA reaches more than 90%. 4. The EGFP gene used for selection is carried on the carrier, and transfected cells can be selected or the transfection efficiency can be observed. The GFP and the Cas9 protein are connected by a self-cleavage polypeptide T2A, so that the GFP protein and the Cas9 protein can be expressed and separated; on the one hand, the size of the vector can be controlled, and on the other hand, the activity of the Cas9 protein is not influenced. 5. The vector has an MLS Sequence, mitochonddrial Localization Sequence, on it to guide the Cas9 protein into the mitochondria. 6. The carrier system has two special elements: RP sequences and 3' UTR sequences. First the 3 'UTR sequence on the vector helps stabilize the RNA out of the nucleus, allowing it to localize in the outer mitochondrial membrane, and then an input sequence, the RP sequence, at the end of RNA 5' helps the RNA enter the mitochondria. Once the 3' UTR sequence helps RNAs appear on the surface of mitochondria, the RP sequence, i.e., the transport sequence, can be used to direct RNA into targeted mitochondria. With these two sequences, sgRNA can be targeted, guided into the mitochondria, and the mitochondrial genome edited. 7. The system optimizes different MLS sequences as well as 3' UTR sequences. We used Cox8A-MLS and ATP5B-MLS in this system; MRPS12-3 'UTR, ATP 5B-3' UTR, Cox8A-3 'UTR, and SOD 2-3' UTR were used. A whole set of MitoCRISPR plasmid vector series is constructed and used for inserting and integrating different sgRNAs, and the gene knockout or modification efficiency of a mitochondrial gene knockout or gene modification vector containing a target sgRNA sequence constructed by different MitoCRISPR plasmid vectors can be tested, so that a better vector is selected for further research or practical application. 8. The system optimizes the position of the RP sequence in the MitoCRISPR system to exclude its effect on the functional expression of proteins in the system. We test that RP sequences are respectively placed in front of sgRNA sequences, in front of 3 ' UTR sequences and behind 3 ' UTR, observe the influence of the positions of the RP sequences on the function of MitoCRISPR, and determine that the RP sequences are behind the 3 ' UTR sequences, and the best gene knockout or modification effect is achieved.

Drawings

FIG. 1 pMitoCRISP1 vector plasmid map. Figure a is a pMitoCRISPR1 vector comprising Cas9 and sgRNA expression elements, Amp resistance genes, and pBR322 and F1 origins of replication; panel b is a plot of the 11 pMitoCRISPR vectors obtained with different MLSs and 3' UTR element combinations, i.e., pMitoCRISPR1 to pMitoCRISPR11, where a: MRPS 12-3' UTR, B: ATP 5B-3' UTR, C: COX 8A-3' UTR, D: SOD 2-3' UTR, E: COX8A-MLS, F: ATP5B-MLS, U6: u6 promoter, RP: RP sequence, Bbsl: restriction enzyme cleavage site, 3' UTR: 3' non-coding region, CBH: CBH promoter, MLS: MLS sequence, Cas 9: cas9 protein gene, EGFP: green fluorescent protein gene.

Figure 2 functional verification of Cas9 expression element in MitoCRISPR vector, Non is blank control; the mitoCRISPR is an empty carrier for mitochondrial gene knockout; the plasmids of MitoCRISPR-KO-12sr RNA and MitoCRISPR-KO-Cytb are knock-out vectors of 12sr RNA and Cytb genes aiming at human mitochondria. To verify whether the MitoCRISPR plasmid was effective, we designed one sgRNA for each of the 12sr RNA and Cytb genes of the 293T cell mitochondria, and constructed plasmids of MitoCRISPR-KO-12 srna and MitoCRISPR-KO-Cytb. After the two plasmids were introduced into cells, expression of the EGFP protein was examined.

figure 3 Cas9 protein mitochondrial localization. Wherein the control is a Mitotrack dye staining control for mitochondria; NLS-Cas9 is a nuclear-localized Cas9 protein localization control; MitoCRISPR is localized to a mitochondrially localized Cas9 protein.

fig. 4 sgRNA and Cas9 expression validation. FIG. a shows that the expression of sgRNA in vivo in the plasmid is detected by RT-PCR after 293T cells are transfected with pMitoCRISPR1 and pMitoCRISPR1-KO-12sr RNA plasmids respectively; panel b shows Western Blot detection of Cas9 expression in pMitoCRISPR1-KO-RP, pMitoCRISPR1, pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO-Cytb plasmids, respectively, after transfection.

Figure 5 qPCR analyzes intracellular mitochondrial genome copy number changes for knock-out of mitochondrial 12sr RNA gene locus. Wherein Mock is a control group, EG is an experimental group; MitoCRISPR is an unprimed sgRNA control, KO-12Sr RNA and KO1-12Sr RNA are interclass controls.

Figure 6 qPCR analyzes intracellular mitochondrial genome copy number changes for the knock-out of mitochondrial Cytb gene locus. Wherein Mock is a control group, EG is an experimental group; MitoCRISPR is an ungRNA control, KO-cytb and KO1-cytb are intergroup controls.

Figure 7 effect of MLS elements of different genes in the MitoCRISPR system on mitochondrial gene knockout. Wherein Mock is a control group; MitoCRISPR is an ungRNA control, and pMitoCRISPR1-Cox8A-MLS-KO-12sr RNA and pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA are different MLS element controls.

Figure 8 effect of position of RP sequence in MitoCRISPR system on mitochondrial gene knockout. Wherein Mock is a control group; MitoCRISPR is an ungsgRNA control, pMitoCRISPR1-RP-sgRNA-KO-12sr RNA, pMitoCRISPR1-RP-3 ' UTR-KO-12sr RNA, p MitoCRISPR 1-3 ' UTR-RP (+) -sgRNA-KO-12sr RNA and pMitoCRISPR 1-3 ' UTR-RP (-) -KO-12sr RNA are experimental groups with different positions of RP sequences.

Figure 9 effect of 3' UTR elements of different genes in MitoCRISPR system on mitochondrial gene knockout. Wherein Mock is a control group; MitoCRISPR is an ungragRNA control, pMitoCRISPR2-Cox8A-3 ' UTR-KO-12sr RNA, pMitoCRISPR3-SOD2-3 ' UTR-KO-12sr RNA, pMitoCRISPR1-MRPS12-3 ' UTR-KO-12sr RNA and pMitoCRISPR4-ATP5B-3 ' UTR-KO-12sr RNA are different 3 ' UTR element experimental groups.

Detailed Description

Example 1 construction of MitoCRISPR plasmid vectors

First we add the 3' UTR signal of the mitochondrial localization signal MRPS12 gene after the U6 promoter. A plasmid for the Mito-U6-RP-BbsI-3' UTR was constructed. Then, the nuclear localization signal in front of the Cas9 gene is removed, and a mitochondrial localization signal of Cox8A, namely an MLS sequence, is added to construct a plasmid of Mito-U6-RP-BbsI-3' UTR-CBh-MLS-Cas 9. The EGFP gene was then added after Cas9 to facilitate observation of transfection efficiency. And 3' UTR signal of MRPS12 is added after Cas9 expression frame to stabilize the whole structure of expressed Cas9 mRNA. Finally, a Mito-U6-RP-BbsI-3 'UTR-CBh-MLS-Cas 9-2A-GFP-3' UTR (MitoCRISPR) plasmid vector, namely p MitoCRISPR1 (figure 1 a) is obtained.

The method specifically comprises the following steps:

(1) Introduction of elements for controlling sgRNA expression: after the U6 promoter of the PX459 vector, a mitochondrial localization signal RP sequence of RNA and a 3 'UTR signal sequence of MRPS12 playing a stabilizing role are added, and the Mito-U6-RP-gRNA-3' UTR vector is successfully constructed.

the specific method comprises the following steps: the gRNA backbone and the 3' UTR signal of MRPS12 were first synthesized. Meanwhile, enzyme cutting sites are added at two ends of the 3 'UTR signal of MRPS12 so as to replace different 3' UTR signals. gRNA-3' UTRs were as follows:

5 ' -AGGACGAAAcaccggGTCTTCgaGAAGACctgttttagagctaGAAAtagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc CAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTG GGCGCCCCTGCAGAACATGAACCTTCCGCTCCTGGCTGCCACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGA GGCAGCCACTCATGGATTCAAGTCCTGGCTCCGCCTCTTCCATCAGGACCAC ACTAGTTTTTTTagcgcgtgcgccaattctgcagacaaatggctctagaggtacccg-3 ', wherein the bold is BbsI restriction site used for inserting sgRNA and RP sequence, the restriction site of BbsI, and the italic is 3 ' UTR signal of MRPS 12.

The gRNA-3' UTR fragment was then amplified for attachment to the PX459 vector backbone. The primers used were as follows:

INFUSION-F：5’-atcttGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGA-3’，

INFUSION-R：5’-GTAAGTTATGTAACGGGTACCTCTAGAGCCATTTGTCTGCAG-3’

PCR amplification was performed using TaKaRa PCR kit, with the following conditions: the reaction system was set to 20 μ l: 1 μ L of template, 0.1 μ L of Pfu polymerase, 2 μ L of 10 XPfu buffer, 1.6 μ L of dNTP, 0.4 μ L of each of primers INFUSION-F and INFUSION-R, 15.5 μ L of ddH2O 15.5, reaction temperature gradient of 94 ℃ for 5 min; 30s at 94 ℃; 30s at 55 ℃; 72 ℃ for 30 s; 72 ℃ for 5 min; then using PX459 vector as skeleton, using BbsI and kpnI double enzyme digestion to make it be linearized. IN addition, IN order to keep the BbsI enzyme cutting site, the sequence of the sgRNA expression frame needs to be connected into the vector by an IN-fusion method. The sequences on the vector were excised using BbsI and KpnI restriction enzymes, and the synthesized sequences were then seamlessly ligated to the PX459 vector using IN-Fusion. The IN-Fusion reaction system was as follows: to each PCR tube, 2. mu.L of the linearized vector and 5. mu. L, ddH2O 3. mu.L of the sgRNA-3 'UTR fragment were added, and 10. mu.L of the vector and the sgRNA-3' UTR fragment were inserted, and the mixture was gently mixed and centrifuged. The reaction was carried out at 50 ℃ for 15 min. Then, a monoclonal strain is selected, plasmid DNA is extracted, and the obtained recombinant plasmid pMito-U6-RP-gRNA-3' UTR is identified through sequencing.

(2) The introduction of the Cas9 expression element is controlled by removing the nuclear localization signal in front of the Cas9 gene from the pMito- -U6-RP-gRNA-3 'UTR and replacing the nuclear localization signal with the mitochondrial localization signal of Cox8A, constructing the pMito- -U6-RP-BbsI-3' UTR-CBh-MLS-Flag-Cas9 vector, and synthesizing the structure of Age I-MLS-Flag-Cas 9 (part) BglII and the sequence of 5 '-accggtgccacc ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGA CAGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTG ATGGACTATAAGGACCACGACGGAGACTACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGCCGGTATCCACGGAGTCCCAGCAGCCGACAAGAAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAGCAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACAGCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGCTATCTGCAAG AGATCT -3'.

age I restriction enzyme sites are in bold, Bgl II restriction enzyme sites are in italic, and mitochondrial localization signals for Cox8A are underlined. And then cutting off a sequence on a Mito-U6-RP-gRNA-3 'UTR vector by using an enzyme of Age I and a Bgl II restriction endonuclease, cutting a structural sequence of AgeI-MLS-Flag-Cas 9-Bgl II by using the same enzyme, connecting the two, transforming, selecting a monoclonal bacterial strain, extracting plasmid DNA, and identifying the obtained recombinant plasmid pMito-U6-RP-BbsI-3' UTR-CBh-MLS-Flag-Cas9 through sequencing.

(3) Construction of screening tag EGFP: finally, EGFP is added behind the Cas9 gene sequence of the pMito-U6-RP-BbsI-3' UTR-CBh-MLS-flag-Cas9 plasmid vector, and puromycin genes are removed so as to observe the transfection efficiency. And 3' UTR signal of MRPS12 is added after Cas9 expression frame so as to stably express Cas9mRNA structure. The specific method comprises the following steps: firstly, an EcoRI-T2A-EGFP-3 ' UTR-EcoRI structure is synthesized, then a sequence on a vector is cut off by using an enzyme of EcoRI, then the sequence of EcorI-T2A-EGFP-3 ' UTR-EcorI is cut by using the same enzyme and is connected to Mito-U6-RP-gRNA-3 ' UTR-CBh-MLS-flag-Cas9, then the transformation is carried out, and bacteria are picked for single clone sequencing. Sequencing results are analyzed by Bioedit software, and the results show that a MitoCRISPR (Mito-U6-RP-gRNA-3 'UTR-CBh-MLS-Cas 9-2A-GFP-3' UTR) vector is successfully constructed.

Example 2 Gene knockout for mitochondrial 12sr RNA Gene site

The specific method for constructing the mitochondrial gene knockout vector aiming at the mitochondrial 12srRNA gene locus is as follows:

The plasmid pMitoCRISPR1 is selected as a framework to construct a mitochondrial gene knockout recombinant plasmid vector, and the plasmid pMitoCRISPR1 contains basic elements of a CRISPR system, namely a Cas9 protein gene and elements for controlling sgRNA to express in mitochondria, and comprises a U6 promoter, an RP sequence and a 3' UTR sequence. The U6 promoter is used for starting the expression of sgRNA, and the 3' UTR sequence helps to stabilize the expressed sgRNA, so that the sgRNA can come out of the cell nucleus and be positioned on the outer membrane of mitochondria; the input sequence at the end of RNA5, the RP sequence, helps the RNA enter the mitochondria. Once the 3' UTR sequence helps RNAs appear on the surface of mitochondria, a second trafficking sequence (RP sequence) can be used to direct RNA into targeted mitochondria. With these two sequences, sgRNA can be targeted, guided into the mitochondria, and the mitochondrial genome edited. The vector selects a special BbsI enzyme cutting site for inserting specific sgRNA so as to prevent the vector from self-connection. And the carrier carries the EGFP gene, so that transfected cells can be screened or the transfection efficiency can be observed.

In this example, 12sr RNA gene on mitochondrial genome was selected and knocked out, and the specific steps were as follows:

Annealing sgRNA, adding 10 XPCR buffer solution 2 μ L, Mito-KO-H-12sr RNA-F1 μ L, Mito-KO-H-12sr RNA-R1 μ L, ddH ₂ O16 μ L, total 20 μ L, treating at 95 deg.C for 5min, reducing the temperature at 2.5 deg.C/s to 85 deg.C, reducing the temperature at 0.25 deg.C/s from 85 deg.C to 25 deg.C, and then reducing the temperature at 25 deg.C for 5 min.

The sgRNA target sequence of the 12sr RNA gene is as follows: 5'-TAAGGGCTATCGTAGTTTTC-3' parts of 12sr RNA; the RP sequence is 5'-TCTCCCTGAGCTTCAGGGAG-3'.

The sgRNA primer sequences for the 12s rRNA gene inserted into the Bbs I cleavage site of the plasmid pMitoCRISPR1 are as follows: Mito-KO-H-12sr RNA-F5'-CACCGTCTCCCTGAGCTTCAGGGAGTAAGGGCTATCGTAGTTTTC-3'

Mito-KO-H-12sr RNA-R:5’-AAACGAAAACTACGATAGCCCTTACTCCCTGAAGCTCAGGGAGAC-3’。

Construction of mitochondrial 12 srna gene knockout vector: pMitoCRISPR1 plasmid DNA 17. mu.L, 10 Xfast Digest buffer 5. mu.L, Bbs I restriction enzyme 5. mu. L, ddH2O 23. mu.L, 50. mu.L total, reaction for 1 hour, 95 ℃ 5 min. Adding 2 mu L of the reaction solution, 2.5 mu L of the sgRNA annealing reaction solution, 10 XT 4 DNA ligase buffer solution and 1 mu L of T4 DNA ligase into 1.5 ml of the 1.84 mu L of the sgRNA annealing reaction solution, connecting for 10-30 min at room temperature, gently adding the 1 mu L of the DNA ligation reaction solution into a 1.5 ml of tube with 200 mu L of competent cells, uniformly mixing, carrying out ice bath for 30min, carrying out water bath at 37 ℃ for 6 min, and placing for 3min on ice; adding 800 μ L LB bacterial culture solution, water bathing at 37 deg.C for 1 hr; 50. mu.L of the supernatant was applied to an LB solid plate and plated, followed by culturing overnight at 37 ℃ in an inverted state. Selecting a resistant monoclonal colony, extracting plasmid DNA by using a Kangwei century endotoxin-free plasmid miniprep kit, and sending the plasmid DNA to Shanghai platyphylla biotechnology limited company for sequencing to determine the recombinant plasmid pMitoCRISPR1-KO-12sr RNA, namely the successful construction of the mitochondrial gene knockout plasmid with 12s rRNA gene sgRNA.

And the specific method of sgRNA mitochondrial localization experiments was as follows:

To verify whether Cas9 and sgRNA locate mitochondria, we transfected NLS-Cas9 and pMitoCRISPR1 vectors into cells respectively, and observed the localization of Cas9 protein on mitochondria with a confocal microscope two days later; cells were transfected with the pMitoCRISPR1 and pMitoCRISPR1-KO-12sr RNA plasmids, and two days later RT-PCR was performed to analyze the expression of sgRNA in mitochondria. The pMitoCRISPR1 vector lacking the RP sequence was used as a control plasmid.

Wherein the Cas9 protein steps are as follows: cells transfected for 72h were seeded on polylysine-treated slides and washed three times with ice PBS for 5min each. Fixing the slide with 4% paraformaldehyde for 15min, and washing with PBS for 3 times; 0.5% TritonX-100 (prepared by PBS) is transparent for 1 hour at room temperature, and is soaked and washed for 3 times by PBS; sealing the sealing solution at room temperature for 30 min; absorbing the confining liquid by absorbent paper, dripping enough diluted flag primary antibody on each slide, putting the slide into a wet box, and incubating overnight at 4 ℃; soaking and washing the climbing sheet with PBS for 3 times, each time for 3min, sucking the excessive liquid on the climbing sheet with absorbent paper, dripping diluted fluorescent secondary antibody, incubating in a humid box at 37 ℃ in the dark for 1h, soaking and washing the cells with PBS for 3 times, each time for 3 min; adding DAPI dropwise, incubating for 2min in dark, staining the cell with nucleus, and washing with PBS for 4 times; and (3) absorbing the liquid on the slide by using absorbent paper, sealing the slide by using sealing liquid containing an anti-fluorescence quenching agent, and observing and acquiring an image under a confocal microscope.

Wherein the mitochondrial extraction step is as follows: the cells were first removed from the dish, lysed with a hypotonic solution for 5-10min, and then rapidly ground on ice using a pestle B associated with a Dounce homogenizer, which should be moved vertically up and down to increase the contact area with the homogenate, which is usually observed around 10 homogenates. Then, crude mitochondria are obtained by using a differential centrifugation method. The crude mitochondria were added to a 12% percoll solution and the mixture was carefully placed on a gradient of 19% percoll and 40% percoll and centrifuged at 50000g for 25 min. The sample in the pale yellow boundary layer was carefully aspirated, resuspended in isolation buffer, and centrifuged at 17000g for 10min to obtain pure mitochondria. Mitochondrial RNA is extracted, reverse transcription is carried out, and then the sgRNA is detected by using RT-PCR.

The specific method for editing the 293T cell mitochondrial genome is as follows:

To verify whether the MitoCRISPR plasmid was effective, we designed a sgRNA against the 12sr RNA locus of the human mitochondrial genome, constructing the pMitoCRISPR1-KO-12sr RNA plasmid as described above. This plasmid was transfected into 293T cells and mitochondrial genome copy number changes were detected after 3 days to assess the efficiency of the MitoCRISPR system. The specific method comprises the following steps: mu.l of opti-MEM (Gibco, cat # 31985-. After 3 days of plasmid transfection, cell genome is extracted by using a whole genome extraction kit, and then the concentration of the sample is measured by using a micro spectrophotometer, and the concentration of the sample is uniformly diluted to 50 ng/mu l. After extracting cell genome, 12sr RNA and beta-actin were amplified by high throughput real-time fluorescent quantitative PCR instrument (QuantStudio 6 Flex). After the amplification is finished, the real-time fluorescence quantitative PCR instrument can automatically give out a fluorescence curve and calculate the CT value of the reaction. The CT value refers to the number of cycles that the reaction passes when the fluorescent signal collected by the real-time fluorescent quantitative PCR instrument reaches a given value, wherein C refers to Cycle, and T refers to a threshold value. We calculated the relative expression level between samples by the Δ Ct method based on CT values.

qPCR amplification conditions were as follows: preparing reaction mixed liquor in a MicroAmp Fast 8-Tube Strip pipe with the volume of 0.1 ml of a rapid reaction 8 connecting pipe, wherein the reaction system is set as 20 ul: template, 3ul, SYBR GREEN I Mix, 10ul, upstream primer F, 0.4 ul, downstream primer R, 0.4 ul, ddH2O, 6.2 uL, PCR reaction temperature gradient of 95 ℃ and 20S; 95 ℃ and 3S; 56 ℃ for 30 s; 72 ℃ for 30 s; 72 ℃ for 5 min; the amplification stages of the dissolution curve were 95 ℃,15s, 60 ℃, 60s, 95 ℃,15 s. And (4) analyzing results: after the pMitoCRISPR1-KO-12s rRNA plasmid is introduced into 293T cells, the cells can be found to express EGFP (see FIG. 2). To verify whether Cas9 entered mitochondria, two days after transfection of the pMitoCRISPR1 plasmid, we performed fluorescent staining with specific antibodies and confirmed the localization of Cas9 on mitochondria with confocal microscopy (see fig. 3). Meanwhile, cell proteins are extracted and subjected to Western Blot analysis, and the result further shows the expression of Cas9 (FIG. 4 b). To verify whether the expressed 12 srna sgRNA entered mitochondria, we extracted mitochondria, analyzed the sgRNA content in mitochondria, and indicated that sgRNA entered mitochondria (fig. 4 a).

Then we extracted 293T cell whole genome, aiming at the knock-out of 12sr RNA gene locus, and analyzed the copy number change of mitochondrial genome in cells by using mitochondrial genome 12sr RNA and nuclear genome beta-actin primer. The qPCR results show: the amplification efficiencies of the mitochondrial genome 12sr RNA and the nuclear genome beta-actin primer are almost identical, namely 99.548% and 97.271%. After transfection of the MitoCRISPR-KO-12sr RNA knock-out plasmid, the mitochondrial genome copy number in 293T cells decreased by approximately 30% (as in fig. 5). These results show that we successfully constructed the mitochondrial gene knockout plasmid pMitoCRISPR1-KO-12s rRNA vector, which successfully knocks down the mitochondrial genome after being introduced into 293T cells.

example 3 mitochondrial Gene knockout for the mitochondrial cytb Gene locus

In this example, the cytb gene on the mitochondrial genome was selected and knocked out, the specific steps are as follows: the annealing reaction was carried out as described in example 2.

the sgRNA target sequence of Cytb is: ATCCCGTTTCGTGCAAGAAT, respectively; the RP sequence is TCTCCCTGAGCTTCAGGGAG; the sgRNA primer sequences of the Cytb gene for insertion into the Bbs I cleavage site of the pMitoCRISPR1 plasmid were as follows: : Mito-KO-H-Cytb-F: CACCGTCTCCCTGAGCTTCAGGGAGATCCCGTTTCGTGCAAGAAT;

Mito-KO-H-Cytb-R:AAACATTCTTGCACGAAACGGGATCTCCCTGAAGCTCAGGGAGAC；

The mitochondrial Cytb gene knockout vector pMitoCRISPR1-KO-Cytb was constructed as described in example 2 and verified by sequencing. The plasmid vector was then transfected into 293T cells using the method described in example 2, and 3 days later, the efficiency of the plasmid vector for mitochondrial genome knock-out was examined using the method described in example 2. After the pMitoCRISPR1-KO-Cytb plasmid is introduced into 293T cells, the cells can be found to express EGFP (see FIG. 2). Meanwhile, proteins of the above cells were extracted and Western Blot analysis was performed, and the result showed expression of Cas9 (fig. 4 b). Then we extracted the whole genome of the cell, and analyzed the copy number change of the mitochondrial genome in the cell by using the mitochondrial genome 12sr RNA and the nuclear genome beta-actin primer aiming at the knockout of the Cytb gene locus. The qPCR results show: the amplification efficiencies of the mitochondrial genome 12sr RNA and the nuclear genome beta-actin primer are almost identical, namely 99.548% and 97.271%. After transfection of the MitoCRISPR-KO-Cytb knockout plasmid, the mitochondrial genome copy number in 293T cells decreased by approximately 30% (as in figure 6). These results indicate that we successfully constructed the mitochondrial gene knock-out plasmid pMitoCRISPR1-KO-Cytb vector, which successfully knocks out the mitochondrial genome after being introduced into 293T cells.

Example 4 Effect of different MLS elements on MitoCRISPR vectors on mitochondrial Gene knockout

There are thousands of proteins or RNAs in mitochondria, most of which are encoded by nuclear genes. These proteins must enter mitochondria to function, and the signal peptide sequence that directs these proteins into mitochondria is called the MLS sequence. This example uses MLS elements of two different genes and compares the effect on mitochondrial gene knock-out efficiency. The specific method comprises the following steps: firstly, introducing two Age I restriction sites at the N end of Cas9 protein; then, two different MLSs, namely Cox8A-MLS and ATP5B-MLS, are replaced on the Age I enzyme cutting site, and the MitoCRISPR vector is respectively constructed. This example constructed mitochondrial gene knockout plasmids, pMitoCRISPR1-Cox8A-MLS-KO-12sr RNA and pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA, respectively, by inserting the sgRNA target sequence of 12sr RNA on the mitochondrial genome into the above MitoCRISPR vectors with Cox8A-MLS and ATP5B-MLS sequences, respectively. After 3 days of introduction of the above plasmid into 293T cells, the whole genome of the cells was extracted, and the copy number variation of mitochondrial genome in the cells was analyzed by qPCR method described in example 2 using mitochondrial genome 12sr RNA and nuclear genome beta-actin primer, thereby verifying the knock-out efficiency of mitochondrial genome to determine the effect of Cox8A-MLS and ATP5B-MLS elements on mitochondrial gene knock-out.

the results show that: after transfection of the pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA knock-out plasmid, the mitochondrial genome copy number in 293T cells decreased by about 30% (as in FIG. 7), and after transfection of the pMitoCRISPR1-Cox8A-MLS-KO-12srRNA knock-out plasmid, the mitochondrial genome copy number in 293T cells decreased by about 22% (as in FIG. 7). These results indicate that the mitochondrial gene knockout vector with the ATP5B-MLS sequence had higher knockout efficiency than the mitochondrial gene knockout vector with the Cox8A-MLS sequence.

Example 5 Effect of position of RP sequence on MitoCRISPR vector on mitochondrial Gene knockout

There are thousands of proteins or RNAs in mitochondria, most of which are encoded by nuclear genes. Studies have shown that foreign RNA is guided into mitochondria where the RP sequence plays a critical role, and this example optimizes the position of the RP sequence in the MitoCRISPR system to exclude its effect on protein function in the system. In the experiment, RP sequences are respectively placed in front of sgRNA sequences, in front of 3 ' UTR sequences and behind 3 ' UTR, pMitoCRISPR1 and pMitoCRISPR9 to pMitoCRISPR11 plasmid vectors such as MitoCRISPR-RP-sgRNA, MitoCRISPR-RP-3 ' UTR, MitoCRISPR-3 ' UTR-RP (+) and MitoCRISPR-3 ' UTR-RP (-) are respectively constructed, so that the influence of the positions on the MitoCRISPR system can be observed. Then, mitochondrial gene knockout plasmid vectors pMitoCRISPR1-RP-sgRNA-KO-12sr RNA, pMitoCRISPR9-RP-3 ' UTR-KO-12sr RNA, pMitoCRISPR10-3 ' UTR-RP (+) -sgRNA-KO-12sr RNA and pMitoCRISPR11-3 ' UTR-RP-KO-12 sr RNA plasmids are respectively constructed for 12sr RNA genes on a mitochondrial genome and RP sequences placed at different positions. These plasmids were transfected into 293T cells to perform targeted knockout of the mitochondrial genome as described above, and 3 days after transfection, mitochondrial genome copy number changes were detected using the qPCR method described above to assess the efficiency of the MitoCRISPR system. The results show (fig. 8): after transfection of the pMitoCRISPR1-RP-sgRNA-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in the 293T cell is reduced by about 22%, after transfection of the pMitoCRISPR9-RP-3 ' UTR-KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in the 293T cell is reduced by about 22%, after transfection of the pMitoCRISPR10-3 ' UTR-RP (+) -sNA-KO-12 sr RNA knockout plasmid, the mitochondrial genome copy number in the 293T cell is reduced by about 42%, and after transfection of the pMitoCRISPR11-3 ' UTR-RP (-) -KO-12sr RNA knockout plasmid, the mitochondrial genome copy number in the 293T cell is reduced by about 5%. These results indicate that the knock-out efficiency of the RP sequence added behind the 3' UTR is highest (FIG. 8).

Example 6 Effect of different 3' UTR elements on MitoCRISPR vectors on mitochondrial Gene knockout

There are thousands of proteins or RNAs in mitochondria, most of which are encoded by nuclear genes. Studies have shown that the introduction of foreign RNA into mitochondria, in which the RP sequence and 3 'UTR elements play a crucial role, we used 3' UTR elements of four different genes in addition to the RP sequence and compared their effect on mitochondrial gene knockout efficiency. The specific method comprises the following steps: four different 3 'UTRs, namely Cox 8A-3' UTR, MRPS12-3 'UTR, SOD 2-3' UTR and ATP5B-3 'UTR, are replaced on a Spe I enzyme cutting site of a MitoCRISPR vector, and plasmid vectors of the MitoCRISPR2-Cox 8A-3' UTR, the MitoCRISPR3-SOD2-3 'UTR, the MitoCRISPR1-MRPS 12-3' UTR and the MitoCRISPR4-ATP5B-3 'UTR with the four 3' UTR sequences are constructed. Next, this example constructed pMitoCRISPR2-Cox8A-3 ' UTR-KO-12sr RNA, pMitoCRISPR3-SOD2-3 ' UTR-KO-12sr RNA, pMitoCRISPR1-MRPS12-3 ' UTR-KO-12sr RNA, and pMitoCRISPR4-ATP5B-3 ' UTR-KO-12sr RNA plasmids for the 12sr RNA gene on the mitochondrial genome by inserting the sgRNA sequence of the 12sr RNA gene into the above four vectors having different 3 ' UTR sequences. After these plasmid vectors were introduced into 293T cells, the copy number change of mitochondrial genome in the cells was analyzed by the method described above. The results show (fig. 9): after transfection of the MitoCRISPR2-Cox8A-3 'UTR-KO-12 sr RNA knockout plasmid, the copy number of mitochondrial genome in 293T cells is reduced by about 43%, after transfection of the MitoCRISPR3-SOD 2-3' UTR-KO-12sr RNA knockout plasmid, the copy number of mitochondrial genome in 293T cells is reduced by about 13%, after transfection of the MitoCRISPR1-MRPS12-3 'UTR-KO-12 sr RNA knockout plasmid, the copy number of mitochondrial genome in 293T cells is reduced by about 22%, and after transfection of the MitoCRISPR4-ATP 5-5B-3' UTR-KO-12sr RNA knockout plasmid, the copy number of mitochondrial genome in 293T cells is reduced by about 34%. The knock-out efficiency was highest for mitochondrial gene knock-out plasmids carrying the Cox 8A-3' UTR sequence (FIG. 9).

the above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.

SEQUENCE LISTING

<110> university of Fujian profession

<120> method for targeted editing of mitochondrial genome using CRISPR/Cas9

<130> 22

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 9645

<212> DNA

<213> pMitoCRISPR1

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgccagaaga agtgacggct 360

gggggcacag tgggctgggc gcccctgcag aacatgaacc ttccgctcct ggctgccaca 420

gggtcctccg atgctggcct ttgcgcctct agaggcagcc actcatggat tcaagtcctg 480

gctccgcctc ttccatcagg accacttttt ttagcgcgtg cgccaattct gcagacaaat 540

ggctctagag gtacccgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 600

cgacccccgc ccattgacgt caatagtaac gccaataggg actttccatt gacgtcaatg 660

ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag 720

tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattgtg cccagtacat 780

gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat 840

ggtcgaggtg agccccacgt tctgcttcac tctccccatc tcccccccct ccccaccccc 900

aattttgtat ttatttattt tttaattatt ttgtgcagcg atgggggcgg gggggggggg 960

ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga ggcggagagg 1020

tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg 1080

gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg cgacgctgcc 1140

ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc gccccggctc tgactgaccg 1200

cgttactccc acaggtgagc gggcgggacg gcccttctcc tccgggctgt aattagctga 1260

gcaagaggta agggtttaag ggatggttgg ttggtggggt attaatgttt aattacctgg 1320

agcacctgcc tgaaatcact ttttttcagg ttggaccggt gccaccatgt ccgtcctgac 1380

gccgctgctg ctgcggggct tgacaggctc ggcccggcgg ctcccagtgc cgcgcgccaa 1440

gatccattcg ttgatggact ataaggacca cgacggagac tacaaggatc atgatattga 1500

ttacaaagac gatgacgata agatggccgg tatccacgga gtcccagcag ccgacaagaa 1560

gtacagcatc ggcctggaca tcggcaccaa ctctgtgggc tgggccgtga tcaccgacga 1620

gtacaaggtg cccagcaaga aattcaaggt gctgggcaac accgaccggc acagcatcaa 1680

gaagaacctg atcggagccc tgctgttcga cagcggcgaa acagccgagg ccacccggct 1740

gaagagaacc gccagaagaa gatacaccag acggaagaac cggatctgct atctgcaaga 1800

gatcttcagc aacgagatgg ccaaggtgga cgacagcttc ttccacagac tggaagagtc 1860

cttcctggtg gaagaggata agaagcacga gcggcacccc atcttcggca acatcgtgga 1920

cgaggtggcc taccacgaga agtaccccac catctaccac ctgagaaaga aactggtgga 1980

cagcaccgac aaggccgacc tgcggctgat ctatctggcc ctggcccaca tgatcaagtt 2040

ccggggccac ttcctgatcg agggcgacct gaaccccgac aacagcgacg tggacaagct 2100

gttcatccag ctggtgcaga cctacaacca gctgttcgag gaaaacccca tcaacgccag 2160

cggcgtggac gccaaggcca tcctgtctgc cagactgagc aagagcagac ggctggaaaa 2220

tctgatcgcc cagctgcccg gcgagaagaa gaatggcctg ttcggaaacc tgattgccct 2280

gagcctgggc ctgaccccca acttcaagag caacttcgac ctggccgagg atgccaaact 2340

gcagctgagc aaggacacct acgacgacga cctggacaac ctgctggccc agatcggcga 2400

ccagtacgcc gacctgtttc tggccgccaa gaacctgtcc gacgccatcc tgctgagcga 2460

catcctgaga gtgaacaccg agatcaccaa ggcccccctg agcgcctcta tgatcaagag 2520

atacgacgag caccaccagg acctgaccct gctgaaagct ctcgtgcggc agcagctgcc 2580

tgagaagtac aaagagattt tcttcgacca gagcaagaac ggctacgccg gctacattga 2640

cggcggagcc agccaggaag agttctacaa gttcatcaag cccatcctgg aaaagatgga 2700

cggcaccgag gaactgctcg tgaagctgaa cagagaggac ctgctgcgga agcagcggac 2760

cttcgacaac ggcagcatcc cccaccagat ccacctggga gagctgcacg ccattctgcg 2820

gcggcaggaa gatttttacc cattcctgaa ggacaaccgg gaaaagatcg agaagatcct 2880

gaccttccgc atcccctact acgtgggccc tctggccagg ggaaacagca gattcgcctg 2940

gatgaccaga aagagcgagg aaaccatcac cccctggaac ttcgaggaag tggtggacaa 3000

gggcgcttcc gcccagagct tcatcgagcg gatgaccaac ttcgataaga acctgcccaa 3060

cgagaaggtg ctgcccaagc acagcctgct gtacgagtac ttcaccgtgt ataacgagct 3120

gaccaaagtg aaatacgtga ccgagggaat gagaaagccc gccttcctga gcggcgagca 3180

gaaaaaggcc atcgtggacc tgctgttcaa gaccaaccgg aaagtgaccg tgaagcagct 3240

gaaagaggac tacttcaaga aaatcgagtg cttcgactcc gtggaaatct ccggcgtgga 3300

agatcggttc aacgcctccc tgggcacata ccacgatctg ctgaaaatta tcaaggacaa 3360

ggacttcctg gacaatgagg aaaacgagga cattctggaa gatatcgtgc tgaccctgac 3420

actgtttgag gacagagaga tgatcgagga acggctgaaa acctatgccc acctgttcga 3480

cgacaaagtg atgaagcagc tgaagcggcg gagatacacc ggctggggca ggctgagccg 3540

gaagctgatc aacggcatcc gggacaagca gtccggcaag acaatcctgg atttcctgaa 3600

gtccgacggc ttcgccaaca gaaacttcat gcagctgatc cacgacgaca gcctgacctt 3660

taaagaggac atccagaaag cccaggtgtc cggccagggc gatagcctgc acgagcacat 3720

tgccaatctg gccggcagcc ccgccattaa gaagggcatc ctgcagacag tgaaggtggt 3780

ggacgagctc gtgaaagtga tgggccggca caagcccgag aacatcgtga tcgaaatggc 3840

cagagagaac cagaccaccc agaagggaca gaagaacagc cgcgagagaa tgaagcggat 3900

cgaagagggc atcaaagagc tgggcagcca gatcctgaaa gaacaccccg tggaaaacac 3960

ccagctgcag aacgagaagc tgtacctgta ctacctgcag aatgggcggg atatgtacgt 4020

ggaccaggaa ctggacatca accggctgtc cgactacgat gtggaccata tcgtgcctca 4080

gagctttctg aaggacgact ccatcgacaa caaggtgctg accagaagcg acaagaaccg 4140

gggcaagagc gacaacgtgc cctccgaaga ggtcgtgaag aagatgaaga actactggcg 4200

gcagctgctg aacgccaagc tgattaccca gagaaagttc gacaatctga ccaaggccga 4260

gagaggcggc ctgagcgaac tggataaggc cggcttcatc aagagacagc tggtggaaac 4320

ccggcagatc acaaagcacg tggcacagat cctggactcc cggatgaaca ctaagtacga 4380

cgagaatgac aagctgatcc gggaagtgaa agtgatcacc ctgaagtcca agctggtgtc 4440

cgatttccgg aaggatttcc agttttacaa agtgcgcgag atcaacaact accaccacgc 4500

ccacgacgcc tacctgaacg ccgtcgtggg aaccgccctg atcaaaaagt accctaagct 4560

ggaaagcgag ttcgtgtacg gcgactacaa ggtgtacgac gtgcggaaga tgatcgccaa 4620

gagcgagcag gaaatcggca aggctaccgc caagtacttc ttctacagca acatcatgaa 4680

ctttttcaag accgagatta ccctggccaa cggcgagatc cggaagcggc ctctgatcga 4740

gacaaacggc gaaaccgggg agatcgtgtg ggataagggc cgggattttg ccaccgtgcg 4800

gaaagtgctg agcatgcccc aagtgaatat cgtgaaaaag accgaggtgc agacaggcgg 4860

cttcagcaaa gagtctatcc tgcccaagag gaacagcgat aagctgatcg ccagaaagaa 4920

ggactgggac cctaagaagt acggcggctt cgacagcccc accgtggcct attctgtgct 4980

ggtggtggcc aaagtggaaa agggcaagtc caagaaactg aagagtgtga aagagctgct 5040

ggggatcacc atcatggaaa gaagcagctt cgagaagaat cccatcgact ttctggaagc 5100

caagggctac aaagaagtga aaaaggacct gatcatcaag ctgcctaagt actccctgtt 5160

cgagctggaa aacggccgga agagaatgct ggcctctgcc ggcgaactgc agaagggaaa 5220

cgaactggcc ctgccctcca aatatgtgaa cttcctgtac ctggccagcc actatgagaa 5280

gctgaagggc tcccccgagg ataatgagca gaaacagctg tttgtggaac agcacaagca 5340

ctacctggac gagatcatcg agcagatcag cgagttctcc aagagagtga tcctggccga 5400

cgctaatctg gacaaagtgc tgtccgccta caacaagcac cgggataagc ccatcagaga 5460

gcaggccgag aatatcatcc acctgtttac cctgaccaat ctgggagccc ctgccgcctt 5520

caagtacttt gacaccacca tcgaccggaa gaggtacacc agcaccaaag aggtgctgga 5580

cgccaccctg atccaccaga gcatcaccgg cctgtacgag acacggatcg acctgtctca 5640

gctgggaggc gacaaaaggc cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa 5700

ggaattcggc agtggagagg gcagaggaag tctgctaaca tgcggtgacg tcgaggagaa 5760

tcctggccca atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt 5820

cgagctggac ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga 5880

tgccacctac ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc 5940

ctggcccacc ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga 6000

ccacatgaag cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg 6060

caccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 6120

cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 6180

cctggggcac aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa 6240

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 6300

gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 6360

cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga 6420

tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct 6480

gtacaagtaa ctcgagcaga agaagtgacg gctgggggca cagtgggctg ggcgcccctg 6540

cagaacatga accttccgct cctggctgcc acagggtcct ccgatgctgg cctttgcgcc 6600

tctagaggca gccactcatg gattcaagtc ctggctccgc ctcttccatc aggaccacga 6660

attctaacta gagctcgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt 6720

gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc 6780

taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt 6840

ggggtggggc aggacagcaa gggggaggat tgggaagaga atagcaggca tgctggggag 6900

cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 6960

actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg 7020

agcgagcgag cgcgcagctg cctgcagggg cgcctgatgc ggtattttct ccttacgcat 7080

ctgtgcggta tttcacaccg catacgtcaa agcaaccata gtacgcgccc tgtagcggcg 7140

cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 7200

tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 7260

gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 7320

accccaaaaa acttgatttg ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 7380

tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 7440

gaacaacact caaccctatc tcgggctatt cttttgattt ataagggatt ttgccgattt 7500

cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 7560

tattaacgtt tacaatttta tggtgcactc tcagtacaat ctgctctgat gccgcatagt 7620

taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc 7680

cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt 7740

caccgtcatc accgaaacgc gcgagacgaa agggcctcgt gatacgccta tttttatagg 7800

ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg ggaaatgtgc 7860

gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac 7920

aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt 7980

tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag 8040

aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg 8100

aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa 8160

tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc 8220

aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag 8280

tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa 8340

ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc 8400

taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg 8460

agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa 8520

caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg caacaattaa 8580

tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg 8640

gctggtttat tgctgataaa tctggagccg gtgagcgtgg aagccgcggt atcattgcag 8700

cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg 8760

caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt 8820

ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt 8880

aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 8940

gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 9000

atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 9060

tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 9120

gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 9180

actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 9240

gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 9300

agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 9360

ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 9420

aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 9480

cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 9540

gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 9600

cctttttacg gttcctggcc ttttgctggc cttttgctca catgt 9645

<210> 2

<211> 222

<212> DNA

<213> Cox8A-3'UTR

<400> 2

aggggtccgt tctgtccctc acactgtgac ctgaccagcc ccaccggccc atcctggtca 60

tgttactgca tttgtggccg gcctcccctg gatcatgtca ttcaattcca gtcacctctt 120

ctgcaatcat gacctcttga tgtctccatg gtgacctcct tgggggtcac tgaccctgct 180

tggtggggtc ccccttgtaa caataaaatc tatttaaact tt 222

<210> 3

<211> 201

<212> DNA

<213> SOD2-3'UTR

<400> 3

accacgatcg ttatgctgat cataccctaa tgatcccagc aagataatgt cctgtcttct 60

aagatgtgca tcaagcctgg tacatactga aaaccctata aggtcctgga taatttttgt 120

ttgattattc attgaagaaa catttatttt ccaattgtgt gaagtttttg actgttaata 180

aaagaatctg tcaaccatca a 201

<210> 4

<211> 162

<212> DNA

<213> MRPS12-3'UTR

<400> 4

cagaagaagt gacggctggg ggcacagtgg gctgggcgcc cctgcagaac atgaaccttc 60

cgctcctggc tgccacaggg tcctccgatg ctggcctttg cgcctctaga ggcagccact 120

catggattca agtcctggct ccgcctcttc catcaggacc ac 162

<210> 5

<211> 146

<212> DNA

<213> ATP5B-3'UTR

<400> 5

ggggtctttg tcctctgtac tgtctctctc cttgccccta acccaaaaag cttcattttt 60

ctgtgtaggc tgcacaagag ccttgattga agatatattc tttctgaaca gtatttaagg 120

tttccaataa aatgtacacc cctcag 146

<210> 6

<211> 141

<212> DNA

<213> ATP5B-MLS

<400> 6

atgttggggt ttgtgggtcg ggtggccgct gctccggcct ccggggcctt gcggagactc 60

accccttcag cgtcgctgcc cccagctcag ctcttactgc gggccgctcc gacggcggtc 120

catcctgtca gggactatgc g 141

<210> 7

<211> 87

<212> DNA

<213> Cox8A-MLS

<400> 7

atgtccgtcc tgacgccgct gctgctgcgg ggcttgacag gctcggcccg gcggctccca 60

gtgccgcgcg ccaagatcca ttcgttg 87

<210> 8

<211> 20

<212> DNA

<213> RP

<400> 8

tctccctgag cttcagggag 20

<210> 9

<211> 63

<212> DNA

<213> 2A

<400> 9

ggcagtggag agggcagagg aagtctgcta acatgcggtg acgtcgagga gaatcctggc 60

cca 63

<210> 10

<211> 19

<212> DNA

<213> Artificial sequence

<400> 10

ctcaccacct cttgctcag 19

<210> 11

<211> 20

<212> DNA

<213> Artificial sequence

<400> 11

ggctacacct tgacctaacg 20

<210> 12

<211> 326

<212> DNA

<213> Artificial sequence

<400> 12

aggacgaaac accgggtctt cgagaagacc tgttttagag ctagaaatag caagttaaaa 60

taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgccag aagaagtgac 120

ggctgggggc acagtgggct gggcgcccct gcagaacatg aaccttccgc tcctggctgc 180

cacagggtcc tccgatgctg gcctttgcgc ctctagaggc agccactcat ggattcaagt 240

cctggctccg cctcttccat caggaccaca ctagtttttt tagcgcgtgc gccaattctg 300

cagacaaatg gctctagagg tacccg 326

<210> 13

<211> 39

<212> DNA

<213> Artificial sequence

<400> 13

atcttgtgga aaggacgaaa caccgggtct tcgagaaga 39

<210> 14

<211> 42

<212> DNA

<213> Artificial sequence

<400> 14

gtaagttatg taacgggtac ctctagagcc atttgtctgc ag 42

<210> 15

<211> 451

<212> DNA

<213> Artificial sequence

<400> 15

accggtgcca ccatgtccgt cctgacgccg ctgctgctgc ggggcttgac aggctcggcc 60

cggcggctcc cagtgccgcg cgccaagatc cattcgttga tggactataa ggaccacgac 120

ggagactaca aggatcatga tattgattac aaagacgatg acgataagat ggccggtatc 180

cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg caccaactct 240

gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt caaggtgctg 300

ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct gttcgacagc 360

ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata caccagacgg 420

aagaaccgga tctgctatct gcaagagatc t 451

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

taagggctat cgtagttttc 20

<210> 17

<211> 45

<212> DNA

<213> Artificial sequence

<400> 17

caccgtctcc ctgagcttca gggagtaagg gctatcgtag ttttc 45

<210> 18

<211> 45

<212> DNA

<213> Artificial sequence

<400> 18

aaacgaaaac tacgatagcc cttactccct gaagctcagg gagac 45

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

atcccgtttc gtgcaagaat 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

tctccctgag cttcagggag 20

<210> 21

<211> 45

<212> DNA

<213> Artificial sequence

<400> 21

caccgtctcc ctgagcttca gggagatccc gtttcgtgca agaat 45

<210> 22

<211> 45

<212> DNA

<213> Artificial sequence

<400> 22

aaacattctt gcacgaaacg ggatctccct gaagctcagg gagac 45

Claims (1)

1. the method for targeted editing of mitochondrial genome by using CRISPR/Cas9 technology is characterized by comprising the following steps: the method comprises the following steps:

(1) constructing a MitoCRISPR vector containing replaceable gene regulatory elements;

(2) Inserting sgRNA of a specific gene into a MitoCRISPR vector to construct a mitochondrial gene editing vector;

(3) Introducing the mitochondrial gene modification vector into human or animal cells, and editing mitochondrial genomes to achieve the aim of knocking out or modifying target genes;

The method for constructing the MitoCRISPR vector comprises the following steps of modifying a skeleton plasmid vector PX459 as follows; the backbone plasmid vector contains the basic elements of the CRISPR system, namely the Cas9 gene and the U6 promoter; a signal sequence for promoting the foreign RNA to enter mitochondria, namely a 3' UTR sequence, is added behind a U6 promoter; the 3' UTR sequence helps to stabilize RNA, allowing it to exit the nucleus and be localized on the outer mitochondrial membrane; then, RP sequences are added to help the RNA enter the mitochondria; then, removing the nuclear localization signal in front of the Cas9 gene, and adding a signal sequence for promoting the foreign protein to enter mitochondria, namely an MLS sequence; finally obtaining a MitoCRISPR plasmid vector for carrying out mitochondrial genome specific gene editing;

The specific method of the step (2) is as follows: selecting the MitoCRISPR plasmid vector in the step (1) as a framework, inserting a sgRNA sequence of a target gene or site into a BbsI site of a restriction endonuclease, and constructing a mitochondrial gene knockout or editing vector;

The specific method of the step (3) is as follows: introducing the plasmid vector obtained in the step (2) into human or animal cells, extracting a cell whole genome after 3 days, and detecting copy number change of a mitochondrial genome by using real-time fluorescent quantitative PCR (polymerase chain reaction) so as to evaluate the knockout efficiency of the MitoCRISPR system on the mitochondrial genome; or determining the effect of gene editing by DNA sequencing;

The real-time fluorescent quantitative PCR primers are as follows: h-12sr RNA-qpcr-F: 5'-CTCACCACCTCTTGCTCAG-3', H-12sr RNA-qpcr-R: 5'-GGCTACACCTTGACCTAACG-3'; beta-actin was used as an internal control;

the RP sequence follows the 3' UTR sequence and the method does not include a disease treatment and diagnosis method.