CN106520830A - A method of performing targeted editing on a mitochondrial genome by utilizing CRISPR/Cas9 - Google Patents

Abstract

A method of performing targeted editing on a mitochondrial genome by utilizing CRISPR/Cas9 is provided. The method includes steps of constituting a MitoCRISPR vector of the mitochondrial genome; inserting a mitochondrion specific sgRNA into the MitoCRISPR vector to constitute a mitochondrion gene knockout or modified vector; and transferring the mitochondrion gene knockout or modified vector into a human or animal cell, thus achieving the objective of editing the mitochondrial genome of the human or animal cell. Cas9 protein and the sgRNA elements are transformed by the method so that the Cas9 protein and sgRNA elements enter a mitochondrion and target on a corresponding gene of the genome to perform gene knockout and modification to hope to clear mutant DNA in the genome, and therefore a plurality of mitochondrial diseases are expected to be treated.

Description

The method that targeting editor is carried out to mitochondrial genome using CRISPR/Cas9

Technical field

The invention belongs to biological technical field, and in particular to a kind of to utilize CRISPR/Cas9 technologies to mitochondrial genome The method for carrying out targeting editor.

Background technology

Mitochondrion is the important organelle of eukaryotic cell, can produce the energy needed for most cells.Except providing energy Amount, mitochondrion have also assisted in various kinds of cell function, including the control of cell cycle and growth, signal transmission, cell differentiation, The regulating and controlling effect of cell death etc..Mitochondrial genome is double-stranded circular genome, i.e. mtDNA, and its mutation can involve various groups Knit and organ, ultimately result in various diseases.In most cases, saltant type mtDNA is present jointly with wild type mtDNA, is claimed It is heterogeneous for mtDNA.When the genome ratio of saltant type can show the clinical symptoms of some mitochondrial diseases more than 80%. Common mitochondriopathy includes mitochondrial myopathy, mitochondrial encephalopathy and mitochondrial encephalomyopathy etc..Than more typical disease such as Leber Hereditary optic neuropathy (LHON), the cardinal symptom of this disease is optic nerve degeneration, is a kind of acute or sub- urgency Property outbreak maternal inheritance disease, it is more common in male.About 700 various mutations are found in mitochondrion at present, it is known to More than 200 kinds of disease is caused by Mitochondrial DNA Mutation, the organ for mainly needing big energy affected by these mutation, including Heart, skeletal muscle and brain, syndrome are generally also shown on these positions first.Survey data shows that the whole world is per 200 babies In youngster, just have a people be affected by mother's mitochondrial gene, per 6500 babies in just have a meeting because mitochondrial gene lack Fall into and suffer from serious disease.Mitochondrial function is subject to Matrix attachment region and mitochondrial genome collective effect, therefore, mtDNA is heterogeneous Formation to causing corresponding phenotype to be a complicated process.This causes the treatment of mitochondrial inheritance disease to become abnormal tired It is difficult.

Have been developed that the method for two kinds of elimination mitochondrion site mutations at present on a molecular scale, i.e.,：Restriction enzyme Mitochondrial DNA and utilize ZFN/TALEN technical editor's mitochondrial genomies that enzyme selectivity targeting is mutated.

If some mtDNA site mutations are into restriction endonuclease sites, restriction enzyme enzyme selectivity can be used The method of the mitochondrial DNA of targeting mutation, optionally degraded are mutated mtDNA.Such as people source mitochondrial ATPase gene T8993G site mutations can produce new unique SmaI sites.2002, TANAKA M etc. were in Restriction enzyme Sma I base Add mitochondria positioning signal because in, can be transported after expressing in the karyogene expression system of cell into mitochondrion, import interior Enzyme cutting SmaI substantially reduces the mitochondrial DNA of mutation.Therefore, specific incision enzyme gene is conveyed in specific mutational site It is expected to reduce the ratio of mutation mtDNA to respective patient.After being mitochondrial gene mutation using the premise of the gene editing method New specific restriction enzyme site must be produced.But it is difficult to find out single in the sequence of mitochondrial genome about 16.5kb Mutation restriction enzyme site, this also makes actual exercisable mtDNA mutation very limited.

Aaron Klug seminar is first using ZFN (Zinc-Finger Nuclease) technology to mitochondrion base within 2006 Because group is knocked out.Seminar is knocked out for mitochondrial ATPase gene T8993G sites, successfully saves ATPase6 bases Cause it is amount of activated.Aaron Klug seminar in 2008 is struck to ATPase6 gene T8993G sites using this technology Remove, the mitochondrion copy number for being further directly observed ATPase6 gene T8993G mutational sites is significantly reduced.

2013, TALENs technologies were used for by Carlos T. doctors Moraes of Miami University's Miller medical college first Mitochondrial gene editor.Their research shows：Once mitoTALENs is combined and is cut with the DNA of specific target spot, mutation MtDNA is just degraded.The decline of total mtDNA can stimulate cell by replicating unaffected mitochondrial genome to increase which mtDNA.After two weeks, mtDNA levels recover normal.As the mtDNA being mutated is disallowable, normal mtDNA is able to retain simultaneously Amplification, therefore, cell Mitochondria is most of to carry normal mtDNA.

CRISPR/Cas9 technologies are a kind of new gene editing technologies developed in recent years.During target practice, CRISPR/Cas9 systems make a region sequence adjacent to motif by sgRNA-Cas9 systems（Protospacer Adjacent Motif,PAM）Double-strand break (Double-Strand Breaks, DSB) is produced with sgRNA complementary target dna before 3 ' ends, it Cell passes through the double-strand of non-homologous end joining (Non- Homologous End Joining, NHEJ) or homologous mediation afterwards DNA is repaired（Homology-Directed Repair, HDR）DNA is repaired, to realize the transformation to genome.Compare In ZFN/TALEN technologies, CRISPR/Cas9 technologies have bigger advantage, and it is physically easier to perform, it may have higher extension Property, it is widely used in various object of study.The cell relatively low for transfection efficiency, CRISPR/Cas9 systems can also pass through The mode that slow viruss are infected is by corresponding vectors into cells.And there are the misgivings of recombination mutation for possibility in TALENs technologies, And be not suitable for infecting by slow virus carrier and carry out cell infection.CRISPR/Cas9 systems also solve TALENs well The excessive problem of systemic vectors.

2010, Michael A. professors Teitell had found a kind of referred to as polynucleotide phosphorylase（PNPASE）Egg It is white to play a significant role when RNA is adjusted into mitochondrion.The expression for reducing PNPASE can affect RNA to enter mitochondrial water It is flat, so as to affect the synthesis for maintaining electron transmission to connect desirable proteins.Meanwhile, crude mitochondrial RNA (mt RNA) can be accumulated, egg White translation can be suppressed, and the generation of energy is hindered, and this will cause the stagnation of cell growth.On this basis, 2012, The first passage targeting such as Michael A. Teitell positioning RNA correct for human mitochondrial mutation defect, and this will be helpful to line The treatment of plastochondria relevant disease.Research worker selects stable repair rna first, is allowed to from nucleus out, and positioning is online On plastochondria adventitia, one section of output sequence is then designed, help RNA to enter mitochondrion.Once RNAs occurs in mitochondrial surface Near conveyer, then just use second segment movement sequence（RP sequences）Guiding RNA enters mitochondrion.There are this two sections of sequences, just Energy targeting wide spectrum RNAs, guides which to enter mitochondrion.Research has shown that this method can efficiently guide exogenous RNA to enter line grain Body.

Invention describes a kind of completely new approach knocked out to mitochondrial gene.On above working foundation, we CRISPR/Cas9 technologies are transformed, that is, transform Cas9 and sgRNA, make improved CRISPR/Cas9 systems possess into Enter mitochondrial ability, so as to practice shooting to the specific gene on mitochondrial genome or site, realize specific to mitochondrion Gene, the knockout of its mutant gene or site and modification.Therefore, edlin is entered to mitochondrial gene using what we were developed CRISPR/Cas9 technologies, it is possible to more easily remove mutant DNA in mitochondrion, so as to be expected to treat various mitochondriopathies.

The content of the invention

It is an object of the invention to provide one kind simply and easily specific gene or site carry out target on mitochondrial genome To the method for editor.The method using transformation CRISPR/Cas9 systems accurately on target practice mitochondrial genome specific gene or Site, it is to avoid the loaded down with trivial details flow process of carrier construction in additive method, substantially reduces the time of carrier construction, drastically increases base Efficiency because knocking out or modifying transformation.

The present invention is adopted the following technical scheme that：

The method that targeting editor is carried out to mitochondrial genome using CRISPR/Cas9, comprises the steps：

（1）Build MitoCRISPR carriers；

（2）The sgRNA of specific gene is inserted into into structure mitochondrial gene editor's carrier on MitoCRISPR carriers；Gene editing Include gene knockout and genetic modification transformation；

（3）By above-mentioned mitochondrial gene editor vector introduction human or animal cell such as 293T cells, carry out mitochondrial genome and strike Except or modification, reach knock out or modify target gene purpose；

The method of the structure MitoCRISPR carriers is that following transformation is done on skeleton plasmid carrier PX459, and skeleton plasmid is carried Primary element of the body comprising CRISPR systems, i.e. Cas9 protein gene and U6 promoteres；The addition after U6 promoteres promotes external source RNA enters mitochondrial signal sequence, i.e. 3 ' UTR sequences；3 ' UTR sequences help stable RNA, make it to go out from nucleus Come, be positioned on mitochondrial outer membrane；Then, RP sequences are added, to help RNA to enter mitochondrion；Then, before removing Cas9 genes Nuclear localization signal, addition promote foreign protein enter mitochondrial signal sequence, i.e. MLS sequences；Having finally given 11 can For carrying out the MitoCRISPR plasmid vectors of mitochondrial genome specific gene editor.

Step（2）Concrete grammar is：Selecting step（1）One of which MitoCRISPR plasmid is skeleton, restricted interior The sgRNA sequences in target gene or site are inserted on enzyme cutting BbsI sites, mitochondrial gene is built and is knocked out or edit carrier.

Step（3）Concrete grammar is：By step（2）The plasmid knockout carrier of acquisition imports human or animal's cell, carries after 3 days Cell full-length genome is taken, using real-time fluorescence quantitative PCR detection mitochondrial genome copy number change, to assess MitoCRISPR Knockout efficiency of the system for mitochondrial genome；Or Jing DNA sequencings determine the effect of gene editing.

Wherein, building MitoCRISPR carrier pMitoCRISPR-1 carrier methods is：Mitochondrion is added after U6 promoteres 3 ' UTR sequences of framing signal MRPS12 gene, to strengthen the stability for transcribing out sgRNA, construct pMito-U6- BbsI- The plasmid of 3 ' UTR；Then, remove the nuclear localization signal before Cas9 genes, add mitochondria positioning signal, the line of Cox8A genes Plastochondria framing signal, to help Cas9 albumen to enter mitochondrion, constructs pMito-U6-RP-BbsI-3 ' UTR-CBh-MLS- Cas9 plasmids；Then EGFP is added after Cas9, in order to observe transfection efficiency.Simultaneously plus mitochondrion after Cas9 expression cassettes 3 ' UTR sequences of framing signal MRPS12 gene, to stablize total.Obtain from 5 ' -3 ' ends with following component U6- The pMitoCRISPR1 plasmid vectors of RP-BbsI-3 ' UTR-CBh-MLS-Cas9-2A-GFP-3 ' UTR.MitoCRISPR plasmids The guiding RNA components that the upper primary element comprising CRISPR systems, i.e. Cas9 genes and U6 promoteres start；On carrier 3 ' UTR sequence helps stable RNA, makes it from nucleus out, to be positioned on mitochondrial outer membrane, the input that then RNA5 ' holds Sequence-RP sequences, help RNA to enter mitochondrion；Once 3 ' UTR sequences help RNAs to occur in mitochondrial surface, then just use RP sequences guiding RNA enters targetted mitochondria.

The MitoCRISPR plasmid vectors for being obtained are by 5 ' end → 3 ' ends order, first comprising following gene expression and regulation Part：U6 promoteres, for controlling the expression of sgRNA；BbsI, restriction endonuclease sites can be used to insert target gene SgRNA sequences；3 ' UTR, for strengthening stability of the sgRNA on mitochondrial outer membrane；CBh, is chicken β-actin gene promoters Subcomponent, for controlling the expression of Cas9 albumen；Cas9, is Cas9 nucleases, for the gene cutting of sgRNA guiding, modification With integration；UTR2, for stablizing the mRNA of Cas9；2A, is self cleavage peptide；GFP, green fluorescence protein gene.

The MitoCRISPR plasmid vectors for being obtained also include RP sequences, for guiding sgRNA to enter mitochondrion, RP sequences Before may be located at sgRNA, between the UTR of sgRNA and 3 ' or after 3 ' UTR.

The gene expression and regulation element added on skeleton plasmid carrier includes：3 ' UTR sequences, RP sequences, MLS lines Plastochondria framing signal and 2A sequences, it is listed below.

Cox8A-3’UTR：AGGGGTCCGTTCTGTCCCTCACACTGTGACCTGACCAGCCCCACCGGCCCATCCTGG TCATGTTACTGCATTTGTGGCCGGCCTCCCCTGGATCATGTCATTCAATTCCAGTCACCTCTTCTGCAATCATGACC TCTTGATGTCTCCATGGTGACCTCCTTGGGGGTCACTGACCCTGCTTGGTGGGGTCCCCCTTGTAACAATAAAATCT ATTTAAACTTT。

SOD2-3’UTR：

ACCACGATCGTTATGCTGATCATACCCTAATGATCCCAGCAAGATAATGTCCTGTCTTCTAAGATGTGCATCA AGCCTGGTACATACTGAAAACCCTATAAGGTCCTGGATAATTTTTGTTTGATTATTCATTGAAGAAACATTTATTTT CCAATTGTGTGAAGTTTTTGACTGTTAATAAAAGAATCTGTCAACCATCAA。

MRPS12-3’UTR：

CAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTGGGCGCCCCTGCAGAACATGAACCTTCCGCTCCTGGCTGC CACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGAGGCAGCCACTCATGGATTCAAGTCCTGGCTCCGCCTCTTC CATCAGGACCAC。

ATP5B-3’UTR：

GGGGTCTTTGTCCTCTGTACTGTCTCTCTCCTTGCCCCTAACCCAAAAAGCTTCATTTTTCTGTGTAGGCTGC ACAAGAGCCTTGATTGAAGATATATTCTTTCTGAACAGTATTTAAGGTTTCCAATAAAATGTACACCCCTCAG。

ATP5B-MLS：ATGTTGGGGTTTGTGGGTCGGGTGGCCGCTGCTCCGGCCTCCGGGGCCTTGCGGAGACT CACCCCTTCAGCGTCGCTGCCCCCAGCTCAGCTCTTACTGCGGGCCGCTCCGACGGCGGTCCATCCTGTCAGGGACT ATGCG。

Cox8A-MLS：ATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGACAGGCTCGGCCCGGCGGCTCCC AGTGCCGCGCGCCAAGATCCATTCGTTG。

RP：TCTCCCTGAGCTTCAGGGAG.

2A：GGCAGTGGAGAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCA.

Above various combination will build to obtain 11 MitoCRISPR plasmid vectors with listed element, i.e. pMitoCRISPR1 is arrived pMitoCRISPR11（Fig. 1）.SgRNA, i.e., single-stranded guiding RNA, single-stranded guiding RNA sequence be for mitochondrial gene knock out and The target sequence of modification.

Described structure MitoCRISPR carrier pMitoCRISPR1-pMitoCRISPR11 methods are：In Cas9 gene N End introduces the restriction enzyme site of two AgeI, and then, we replace two kinds of different MLS on AgeI restriction enzyme sites： Cox8A-MLS and ATP5B-MLS；Four kinds can be replaced on the SpeI restriction endonuclease sites of MitoCRISPR plasmid vectors 3 ' different UTR：MRPS12-3 ' UTR, Cox8A-3 ' UTR, SOD2-3 ' UTR and ATP5B-3 ' UTR.Behind U6 promoteres Diverse location addition RP sequences:RP-sgRNA, RP -3 ' UTR, 3 ' UTR-RP (+) and 3 ' UTR-RP (-).11 are obtained altogether Different MitoCRISPR carriers are planted, wherein pMitoCRISPR1-pMitoCRISPR4 carries Cox8A-MLS sequences； PMitoCRISPR5-pMitoCRISPR8 carries ATP5B-MLS-MLS sequences；PMitoCRISPR1 and pMitoCRISPR5 are carried MRPS12-3 ' UTR sequences；PMitoCRISPR2 and pMitoCRISPR6 carries Cox8A-3 ' UTR sequences；PMitoCRISPR3 and PMitoCRISPR7 carries SOD2-3-3 ' UTR sequences；PMitoCRISPR4 and pMitoCRISPR8 carries ATP5B-3 ' UTR sequences Row；The RP sequences of pMitoCRISPR9 are in the middle of the UTR of sgRNA and 3 '；The RP sequences of pMitoCRISPR10 are forward direction in 3 ' UTR Below；The RP sequences of pMitoCRISPR11 are for reverse behind 3 ' UTR.Constructed pMitoCRISPR1 is arrived PMitoCRISPR11 plasmid fraction structures show in FIG.PMitoCRISPR1 carriers complete sequence is as shown in SEQ ID No.1.

Building mitochondrial genome genes of interest knockout carrier method is：Choose above-mentioned one of which MitoCRISPR matter Grain is skeleton, and the sgRNA sequences in target gene or site are inserted on restricted enzyme BbsI sites, builds mitochondrial gene Knock out recombinant vector.By taking pMitoCRISPR1 plasmid vectors as an example, specially pMitoCRISPR1 plasmid vectors Jing BbsI are limited Property endonuclease digestion, is then purified into enzyme action carrier with ethanol precipitation；Then by the sgRNA target gene sequences containing RP sequences It is attached with the pMitoCRISPR1 plasmid vectors of enzyme action after annealing.Carrier after connection is inverted, chooses bacterium, and identification is obtained Recombinant vector.As the present invention respectively designs a sgRNA for the 12sr RNA and Cytb gene of human mitochondria gene group, construct The plasmid of pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO-Cytb.

Mitochondrial genome concrete grammar is edited in human or animal's cell such as 293T cells is：Using liposome transfection skill Above-mentioned pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO-Cytb plasmids are transfected 293T cells by art respectively, and 3 Cell full-length genome is extracted after it, using real-time fluorescence quantitative PCR detection mitochondrial genome copy number change, to assess Knockout efficiency of the MitoCRISPR systems for mitochondrial genome.Above-mentioned real-time fluorescence quantitative PCR detection primer used is such as Under：H-12sr RNA-qpcr-F:5 '-CTCACCACCTCTTGCTCAG-3 ', H-12sr RNA-qpcr-R: 5’- GGCTACACCTTGACCTAACG-3’；β-actin are compareed as internal reference.

It is an advantage of the current invention that：

1st, the MitoCRISPR plasmid vector systems set up have various regulatory components, including U6- RP-BbsI-3 ' UTR- 3 ' UTR of CBh- MLS-Cas9-2A-GFP-, can meet the target sgRNA sequence of needs insertion and for gene cutting Cas9 is in Intramitochondrial stable expression and effect；The sequences of sgRNA containing target set up in MitoCRISPR plasmid vectors Mitochondrial gene knockout carrier, while possess sgRNA Expression elements and Cas9 gene expression elements, than the two detached double-mass model Transfection system transfection efficiency is high.

2nd, multiple restriction enzyme cleavage sites are possessed on MitoCRISPR plasmid vectors, each controlling element can be light Pine is replaced.3rd, MitoCRISPR plasmid vectors have chosen special restriction endonuclease sites i.e. Bbs I restriction enzyme sites, can To insert target sgRNA sequence, to prevent carrier from connecting certainly.Directly it is connected with enzyme action carrier after the oligonucleotide annealing of synthesis.Adopt Cloned with the method, the joint efficiency up to more than 90% of sgRNA.4th, carrier upper band has the EGFP gene for screening, can be with Cell to transfecting is screened or is observed transfection efficiency.And connect by self cleavage peptide T 2A between GFP and Cas9 albumen, GFP albumen can be made to separate with Cas9 protein expressions；On the one hand carrier size can be controlled, on the other hand Cas9 albumen is not affected Activity.5th, MLS sequences, i.e. Mitochondrial Localization Sequence are possessed on the carrier, to guide Cas9 eggs Mitochondrion is entered in vain.6th, possessing on the carrier system has two special elements：RP sequences and 3 ' UTR sequences.First on carrier 3 ' UTR sequences help stable RNA, make it from nucleus out, to be positioned on mitochondrial outer membrane, then RNA5 ' ends One section of list entries-RP sequence, help RNA enter mitochondrion.Once 3 ' UTR sequences help RNAs to occur in mitochondrion table Face, then just use RP sequences, i.e. trafficking sequence just guide RNA to enter targetted mitochondria.There are this two sections of sequences, just can target To sgRNA, guide which to enter mitochondrion, edit mitochondrial genome.7th, the different MLS sequences and 3 ' of the system optimization UTR sequence.We have used Cox8A-MLS and ATP5B-MLS within the system；MRPS12-3 ' UTR, ATP5B-3 ' are used UTR, Cox8A-3 ' UTR, and SOD2-3 ' UTR.The MitoCRISPR plasmid vectors series of the whole series is constructed, it is whole for inserting Different sgRNA are closed, the mitochondrion base of the sequences of sgRNA containing target constructed by different MitoCRISPR plasmid vectors can be tested Because knock out or genetic modification carrier gene knockout or modification efficiency, so as to select preferably carrier be used for further research or Practical application.8th, system optimization position of the RP sequences in MitoCRISPR systems, excluding which to albumen work(in system The impact that can be expressed.We test RP sequences be individually placed to sgRNA sequences before, before 3 ' UTR sequences and behind 3 ' UTR, Observe impact of the RP sequences position to MitoCRISPR functions, it is determined that RP sequences behind 3 ' UTR sequences, its gene The effect for knocking out or modifying is best.

Description of the drawings

Fig. 1 pMitoCRISP1 vector plasmid collection of illustrative plates.Figure a is pMitoCRISPR1 carriers, comprising Cas9 and sgRNA expression unit Part, Amp resistant genes and pBR322 and F1 replication orgins；Figure b combines obtain 11 by the difference UTR of MLS and 3 ' elements Individual pMitoCRISPR carriers, i.e. pMitoCRISPR1 to pMitoCRISPR11 figures, wherein A：MRPS12-3 ' UTR, B：ATP5B- 3 ' UTR, C：COX8A-3 ' UTR, D：SOD2-3 ' UTR, E:COX8A-MLS, F：ATP5B-MLS, U6：U6 promoteres, RP：RP sequences Row, Bbsl：Restriction enzyme digestion sites, 3 ' UTR：3 ' end noncoding region, CBH：CBH promoteres, MLS：MLS sequences, Cas9：Cas9 protein gene, EGFP：Green fluorescence protein gene.

Cas9 Expression element functional verifications in Fig. 2 MitoCRISPR carriers, Non is blank；MitoCRISPR is line The empty carrier that mitochondrial genes are knocked out；The plasmid of MitoCRISPR-KO-12sr RNA and MitoCRISPR-KO-Cytb is for people The knockout carrier of mitochondrial 12sr RNA and Cytb genes.In order to whether effectively verify MitoCRISPR plasmids, we are directed to The 12sr RNA and Cytb gene of 293T cell mitochondrials respectively designs a sgRNA, constructs MitoCRISPR-KO-12sr The plasmid of RNA and MitoCRISPR-KO-Cytb.The table of EGFP albumen is detected after above-mentioned two plasmid is directed respectively into cell Up to situation.

Fig. 3 Cas9 albumen mitochondria positionings.The control that wherein control is dyeed to mitochondrion for Mitotrack dyestuffs；NLS- Cas9 albumen positioning controls of the Cas9 for nuclear location；MitoCRISPR is that the Cas9 albumen to mitochondria positioning is positioned.

Fig. 4 sgRNA and Cas9 expression checking.Figure a represent 293T cells transfect respectively pMitoCRISPR1 and After pMitoCRISPR1-KO-12sr RNA plasmids, RT-PCR detects that sgRNA is expressed in mitochondrion；Figure b is represented PMitoCRISPR1-KO-RP, pMitoCRISPR1, pMitoCRISPR1-KO-12sr RNA and pMitoCRISPR1-KO- After Cytb plasmids, Western Blot detection expressions of the Cas9 in the cell.

Knockouts of the Fig. 5 for mitochondrion 12sr rna genes site, qPCR analyze the copy of intracellular mitochondrial genome Number change.Wherein Mock is matched group, and EG is experimental group；MitoCRISPR for not plus sgRNA control, KO-12Sr RNA and KO1-12Sr RNA are to compare between group.

Knockouts of the Fig. 6 for mitochondrial cytochrome b gene site, the copy number of qPCR analysis intracellular mitochondrial genomes become Change.Wherein Mock is matched group, and EG is experimental group；Not add sgRNA to compare, KO-cytb and KO1-cytb is MitoCRISPR Compare between group.

The impact that heterogeneic MLS elements are knocked out to mitochondrial gene in Fig. 7 MitoCRISPR systems.Wherein Mock For matched group；MitoCRISPR for not plus sgRNA control, pMitoCRISPR1-Cox8A-MLS-KO-12sr RNA and PMitoCRISPR5-ATP5B-MLS-KO-12sr RNA are different MLS elements controls.

The impact that the position of RP sequences is knocked out to mitochondrial gene in Fig. 8 MitoCRISPR systems.Wherein Mock is control Group；MitoCRISPR is not plus sgRNA is compareed, pMitoCRISPR1-RP-sgRNA-KO-12sr RNA, pMitoCRISPR1- RP-3 ' UTR-KO-12sr RNA, p MitoCRISPR1-3 ' UTR- RP (+)-sgRNA-KO-12sr RNA and Experimental grouies of pMitoCRISPR1-3 ' UTR- RP (-)-KO-12sr RNA for RP sequence diverse locations.

The impact that heterogeneic 3 ' UTR elements are knocked out to mitochondrial gene in Fig. 9 MitoCRISPR systems.Wherein Mock is matched group；MitoCRISPR is not plus sgRNA is compareed, pMitoCRISPR2-Cox8A-3 ' UTR-KO-12sr RNA, PMitoCRISPR3-SOD2-3 ' UTR-KO-12sr RNA, pMitoCRISPR1-MRPS12-3 ' UTR-KO-12sr RNA and PMitoCRISPR4-ATP5B-3 ' UTR-KO-12sr RNA are 3 ' different UTR element experimental grouies.

Specific embodiment

The structure of 1 MitoCRISPR plasmid vectors of embodiment

We add 3 ' UTR signals of mitochondria positioning signal MRPS12 genes after U6 promoteres first.Build Mito-U6- The plasmid of RP-BbsI-3 ' UTR.Then remove the nuclear localization signal before Cas9 genes, add the mitochondria positioning signal of Cox8A, I.e. MLS sequences, build the plasmid of Mito-U6-RP-BbsI-3 ' UTR-CBh-MLS-Cas9.Then plus EGFP after Cas9 Gene, in order to observe transfection efficiency.Add 3 ' the UTR signals of MRPS12 simultaneously after Cas9 expression cassettes, with stably expressed Cas9 mRNA totals.Mito-U6-RP-BbsI-3 ' UTR-CBh-MLS-Cas9-2A-GFP-3 ' are finally given UTR（MitoCRISPR）Plasmid vector, i.e. p MitoCRISPR1（Fig. 1 a）.

Specially：

（1）For controlling the importing of the element of sgRNA expression：Mitochondrion plus RNA after the U6 promoteres of PX459 carriers is fixed 3 ' the UTR signal sequences of the MRPS12 of position signal RP sequences and a Stabilization, successfully construct Mito-U6-RP-gRNA-3 ' UTR carriers.

Concrete grammar is：Synthesize 3 ' the UTR signals of gRNA skeletons and MRPS12 first.3 ' the UTR in MRPS12 believe simultaneously Number two ends add restriction enzyme site, to change 3 ' different UTR signals.GRNA-3 ' UTR are as follows：

5’-AGGACGAAAcaccggGTCTTCgaGAAGACctgttttagagctaGAAAtagcaagttaaaataaggctagt ccgttatcaacttgaaaaagtggcaccgagtcggtgcCAGAAGAAGTGACGGCTGGGGGCACAGTGGGCTGGGCGCC CCTGCAGAACATGAACCTTCCGCTCCTGGCTGCCACAGGGTCCTCCGATGCTGGCCTTTGCGCCTCTAGAGGCAGCC ACTCATGGATTCAAGTCCTGGCTCCGCCTCTTCCATCAGGACCACACTAGTTTTTTTagcgcgtgcgccaattctgc agacaaatggctctagaggtacccg-3’.Wherein runic is BbsI restriction enzyme sites, for the insertion of sgRNA and RP sequences, The restriction enzyme site of BbsI；3 ' UTR signals of the italic for MRPS12.

Then gRNA-3 ' UTR fragments are expanded, to be connected on PX459 carrier frameworks.The primer is as follows：

INFUSION-F：5 '-atcttGTGGAAAGGACGAAACACCGGGTCTTCGAGAAGA-3 ',

INFUSION-R：5’-GTAAGTTATGTAACGGGTACCTCTAGAGCCATTTGTCTGCAG-3’

Enter performing PCR amplification with the PCR reaction kits of TaKaRa, condition is as follows：Reaction system is set to 20 μ l：1 μ of template L, 0.1 μ l of Pfu polymerase, 10 × Pfu buffer, 2 μ l, 1.6 μ l of dNTP, primer I NFUSION-F and INFUSION-R are each 15.5 μ L of 0.4 μ l, ddH2O, reaction temperature gradient are 94 DEG C, 5 min；94 DEG C, 30 s；55 DEG C, 30 s；72 DEG C, 30 s；72 DEG C, 5 min；Then with PX459 carriers as skeleton, linearisation is allowed to BbsI and kpnI double digestions.Additionally, to retain BbsI enzymes Enzyme site, the sequence of sgRNA expression cassettes need to be connected into carrier with the method for IN-fusion.Using BbsI and KpnI restriction enzymes Enzyme cuts off the sequence on carrier, then the sequence seamless of synthesis is connected on PX459 carriers with the method for IN-Fusion. IN-Fusion reaction systems are as follows：Linearizing 2 μ L of carrier, 5 μ of insertion sgRNA-3 ' UTR fragments are added to PCR pipe respectively 3 μ L of L, ddH2O, totally 10 μ L, are centrifuged after gently mixing.50 DEG C of reaction 15min.Then convert, picking monoclonal bacterial strain, extraction Plasmid DNA, the recombiant plasmid pMito-U6-RP-gRNA-3 ' UTR obtained by sequencing identification.

（2）For controlling the importing of Cas9 Expression elements：Then, remove in above-mentioned pMito--U6-RP-gRNA-3 ' UTR Nuclear localization signal before Cas9 genes, is substituted for the mitochondria positioning signal of Cox8A.Build pMito--U6-RP-BbsI-3 ' UTR-CBh-MLS-flag-Cas9 carriers.Concrete grammar is to synthesize Age I- MLS-Flag- Cas9 first（part）Bgl The structure of II.The sequence of synthesis is as follows：5’-accggtgccaccATGTCCGTCCTGACGCCGCTGCTGCTGCGGGGCTTGAC AGGCTCGGCCCGGCGGCTCCCAGTGCCGCGCGCCAAGATCCATTCGTTGATGGACTATAAGGACCACGACGGAGACT ACAAGGATCATGATATTGATTACAAAGACGATGACGATAAGATGGCCGGTATCCACGGAGTCCCAGCAGCCGACAAG AAGTACAGCATCGGCCTGGACATCGGCACCAACTCTGTGGGCTGGGCCGTGATCACCGACGAGTACAAGGTGCCCAG CAAGAAATTCAAGGTGCTGGGCAACACCGACCGGCACAGCATCAAGAAGAACCTGATCGGAGCCCTGCTGTTCGACA GCGGCGAAACAGCCGAGGCCACCCGGCTGAAGAGAACCGCCAGAAGAAGATACACCAGACGGAAGAACCGGATCTGC TATCTGCAAGAGATCT-3’。

Runic is Age I restriction endonuclease sites, and italic color is Bgl II restriction endonuclease sites, and underscore is The mitochondria positioning signal of Cox8A.Enzyme and Bgl II restricted enzyme followed by Age I is Mito-U6-RP-gRNA- Sequence on 3 ' UTR carriers is cut away, then with the structure sequence of same cleavage AgeI- MLS-Flag- Cas9- Bgl II Row, the two are connected, are then converted, picking monoclonal bacterial strain, extraction plasmid DNA, the restructuring matter obtained by sequencing identification Grain pMito-U6-RP-BbsI-3 ' UTR-CBh-MLS-flag-Cas9.

（3）The structure of screening label E GFP：Finally, in pMito-U6-RP-BbsI-3 ' UTR-CBh-MLS-flag-Cas9 EGFP is added after the Cas9 gene orders of plasmid vector, puromycin gene is removed, in order to observe transfection efficiency.Exist simultaneously 3 ' the UTR signals of MRPS12 are added after Cas9 expression cassettes, with the Cas9mRNA structures of stable expression.Concrete grammar is：Close first Into the structure of EcoRI-T2A-EGFP-3 ' UTR EcoRI, the sequence on carrier is cut away followed by the enzyme of EcoRI, Ran Houyong The sequence of same 3 ' UTR EcorI of cleavage EcorI-T2A-EGFP-, is connected to Mito-U6-RP-gRNA-3 ' UTR- CBh-MLS-flag-Cas9. then convert, the sequencing of picking bacterial colony.Sequencing result is carried out with Bioedit softwares point Analysis, as a result shows successfully to construct MitoCRISPR (Mito-U6-RP-gRNA-3 ' UTR-CBh- MLS-Cas9-2A-GFP- 3 ' UTR) carrier.

Gene knockout of the embodiment 2 for mitochondrion 12sr rna genes site

Build as follows for the mitochondrial gene knockout carrier concrete grammar of mitochondrion 12srRNA gene locis：

It is that framework construction mitochondrial gene knocks out recombinant plasmid vector, pMitoCRISPR1 plasmids to choose pMitoCRISPR1 plasmids The element that the upper primary element comprising CRISPR systems, i.e. Cas9 protein gene and control sgRNA are expressed in mitochondrion, including U6 promoteres, RP sequences and 3 ' UTR sequences.U6 promoteres are used for the expression for starting sgRNA, and 3 ' UTR sequences help stable expression SgRNA, make it from nucleus out, to be positioned on mitochondrial outer membrane；List entries-RP the sequences that RNA5 ' holds, side RNA is helped to enter mitochondrion.Once 3 ' UTR sequences help RNAs to occur in mitochondrial surface, then just use second segment trafficking sequence （RP sequences）RNA can be just guided to enter targetted mitochondria.There are this two sections of sequences, just energy targeting sgRNA, guides which to enter line Plastochondria, edits mitochondrial genome.The carrier have chosen a special BbsI restriction enzyme site and can be used to insert special SgRNA, to prevent carrier from connecting certainly.And EGFP gene is carried on the carrier, the cell of transfection can be screened or be seen Examine transfection efficiency.

This example chooses 12sr rna genes on mitochondrial genome, which is knocked out, is comprised the following steps that：

SgRNA anneals：Add 10 × PCR buffer, 2 μ L, Mito-KO-H-12sr RNA-F 1 μ L, Mito-KO-H-12sr RNA-R 1μL、ddH₂16 μ L of O, totally 20 μ L, treatment conditions are 95 DEG C of 5 min, and 2.5 DEG C/s is down to 85 DEG C；0.25 DEG C/s from 85 DEG C are down to 25 DEG C, then 25 DEG C of 5 min.

The sgRNA target sequences of 12sr rna genes are as follows：12sr RNA: 5’-TAAGGGCTATCGTAGTTTTC-3’； RP sequences are: 5’-TCTCCCTGAGCTTCAGGGAG-3’.

For being inserted into the sgRNA primer sequences of the 12s rRNA genes of pMitoCRISPR1 plasmid Bbs I restriction enzyme sites It is as follows：Mito-KO-H-12sr RNA-F: 5’-CACCGTCTCCCTGAGCTTCAGGGAGTAAGGGCTATCGTAGTTTTC- 3’

Mito-KO-H-12sr RNA-R: 5’-AAACGAAAACTACGATAGCCCTTACTCCCTGAAGCTCAGGGAGAC- 3’。

The structure of mitochondrion 12srRNA gene knockout carriers：17 μ L of pMitoCRISPR1 plasmid DNA, 10 × Fast 5 μ L of Digest buffer, 5 μ L of Bbs I restricted enzyme, ddH2O 23 μ L, totally 50 μ L, react 1 hour, 95 DEG C 5 min.In 1.5 mLEP, the 2 μ L reactant liquors, the above-mentioned 2.5 μ L of sgRNA annealing reactions liquid of 1.84 μ L, 10 × T4 DNA is added to connect Enzyme buffer liquid, 1 μ L of T4 DNA ligases are met, room temperature connects 10-30 min. in 1.5 mL with 200 μ L competent cells In EP pipes, above-mentioned 1 μ L DNA coupled reaction liquid is leniently added, mixed, 30 min of rear ice bath, 37 DEG C of 6 min of water-bath are put on ice Put 3 min；Add 800 μ L LB inoculums, 37 DEG C of water-baths, 1h；50 μ L of supernatant are taken, is mixed on LB solid plates and is applied Plate, 37 DEG C of inversion overnight incubations.The monoclonal bacterium colony of tool resistance is selected, is carried with the little extraction reagent kit of Kang Wei century endotoxin-free plasmids Plasmid DNA is taken, Hai Boshang Bioisystech Co., Ltd is served and is sequenced, to determine recombiant plasmid pMitoCRISPR1-KO- 12sr RNA, i.e., the mitochondrial gene with 12s rRNA gene sgRNA knock out successfully constructing for plasmid.

It is as follows with the concrete grammar of sgRNA mitochondria positionings experiment：

In order to verify whether Cas9 and sgRNA positions mitochondrion, NLS-Cas9, pMitoCRISPR1 carriers are transfected by respectively Cell, the two days later positioning with confocal microscopy Cas9 albumen on mitochondrion；By pMitoCRISPR1 and PMitoCRISPR1-KO-12sr RNA plasmid-transfected cells, RT-PCR analyses sgRNA is in mitochondrial expression two days later. Wherein, control plasmid is done with the pMitoCRISPR1 carriers for lacking RP sequences.

Wherein Cas9 albumen step is as follows：The cell of transfection 72h is inoculated on the slide that poly-D-lysine was processed, ice PBS washes three times, every time 5 minutes.Creep plate is fixed 15 minutes with 4% paraformaldehyde, PBS embathes 3 times；0.5% TritonX-100 (PBS preparations) room temperature is penetrating 1 hour, and PBS embathes 3 times；Confining liquid room temperature closes 30min；Absorbent paper sops up confining liquid, each glass The flag mono- for having diluted of piece Deca q.s is anti-and is put into wet box, 4 DEG C of overnight incubations；PBS embathes creep plate 3 times, each 3min, Absorbent paper is blotted the fluorescence two that Deca has diluted after surplus liquid on creep plate and is resisted, and in wet box, 37 DEG C of lucifuges are incubated 1h, and PBS embathes carefully Born of the same parents 3 times, each 3min；Deca DAPI lucifuge is incubated 2min, and dye core is carried out to cell, and PBS washes 4 times；Creep plate is blotted with absorbent paper On liquid, with containing anti-fluorescence quenching mounting fluid-tight piece, then under Laser Scanning Confocal Microscope observation collection image.

Mitochondrion step is extracted wherein as follows：First cell is digested from culture dish, it is thin with hypisotonic solution cracking Born of the same parents 5-10min, then quickly grinds cell with the supporting pestle B of Dounce homogenizers on ice, and during grinding, pestle B should be upper and lower Vertical movement is generally being homogenized 10 times or so observation homogenization effects to increase the contact area with homogenate.Followed by differential The mitochondrion slightly carried by the method for centrifugation.The mitochondrion for slightly carrying is added in 12% percoll solution, mixed liquor is carefully put On 19% percoll and 40% percoll gradients, 50000g is centrifuged 25 minutes.It is careful to draw positioned at light yellow boundary layer Sample, is resuspended in dissociating buffer, and 17000g centrifugations obtain pure mitochondrion in 10 minutes.Extract mitochondrial RNA (mt RNA), reverse transcription Afterwards, sgRNA is detected using RT-PCR.

The concrete grammar of editor's 293T cell mitochondrial genomes is as follows：

In order to whether effectively verify MitoCRISPR plasmids, we are set for the 12sr rna genes site of human mitochondria gene group One sgRNA of meter, constructs pMitoCRISPR1-KO-12sr RNA plasmids as described above.By the plasmid transfection 293T cell, 3 The change of mitochondrial genome copy number is detected after it, to assess the efficiency of MitoCRISPR systems.Concrete grammar is as follows：With 70 μ l opti-MEM（Gibco, article No.：31985-070）+ 3 μ l PEI (polysciences, article No.s：670587) (1μg/μl）Examination Agent is fully mixed, and is subsequently adding 1 μ l DNA (1 μ g/ μ l), is incubated at room temperature 5 min, mixed liquor is added dropwise in cell, and 37 DEG C incubate Hatching cell is overnight.After cell transfecting plasmid 3 days, cellular genome is extracted using full-length genome extracts kit, afterwards Using the concentration of micro-spectrophotometer measuring samples, sample concentration unification is diluted to into 50 ng/ μ l.Extract cellular genome Afterwards, 12sr RNA and β-actin are expanded with high flux real-time fluorescence quantitative PCR instrument (6 Flex of QuantStudio). After amplification terminates, real-time fluorescence quantitative PCR instrument can provide fluorescence curve automatically, calculate the CT values of the reaction.CT values refer to reality When the fluorescence signal collected of the quantitative real time PCR Instrument period that reaction is passed through when reaching set-point, wherein C refers to Cycle, T refers to threshold value.We calculate the relative expression quantity between each sample according to CT values with △ △ Ct methods.

QPCR amplification conditions are as follows：In MicroAmp Fast 8-Tube Strip, 0.1 ml fast reactions 8 Reaction mixture is prepared in pipe, reaction system is set to 20ul：Template, 3ul, SYBR GREEN I Mix, 10ul, forward primer F, 0.4 ul, downstream primer R, 0.4 ul, ddH2O, 6.2 μ L, PCR reaction temperatures gradient are 95 DEG C, 20S；95 DEG C, 3S；56 DEG C, 30s；72 DEG C, 30s；72 DEG C, 5min；The solubility curve amplification stage is 95 DEG C, 15s, 60 DEG C, 60s, 95 DEG C, 15s.As a result divide Analysis：Above-mentioned pMitoCRISPR1-KO-12s rRNA plasmids are imported after 293T cells, it can be found that cell has EGFP to express（Such as Fig. 2）.In order to verify whether Cas9 enters mitochondrion, two days after pMitoCRISPR1 plasmid transfections, we pass through specific antibody Fluorescence staining is carried out, and positioning of the Cas9 on mitochondrion is determined with Laser Scanning Confocal Microscope（Such as Fig. 3）.It is extracted cell egg simultaneously In vain, Western Blot analyses are carried out, the expression of Cas9 has as a result been further demonstrated that（Fig. 4 b）.For the 12s that proof list reaches Whether rRNA sgRNA enter mitochondrion, and we are extracted mitochondrion, analyze the content of sgRNA inside mitochondrion, as a result table Bright sgRNA enters mitochondrion（Fig. 4 a）.

Then we extract 293T cell full-length genomes, for the knockout in 12sr rna genes site, using mitochondrion base Because of group 12sr RNA and Matrix attachment region β-actin primers, the copy number change of intracellular mitochondrial genome is analyzed.qPCR As a result show：The amplification efficiency of mitochondrial genome 12sr RNA and Matrix attachment region β-actin primers is almost unanimously respectively 99.548% and 97.271%.After transfection MitoCRISPR-KO-12sr RNA knock out plasmid, 293T intracellular mitochondrial gene Group copy number have dropped about 30%（Such as Fig. 5）.These results show that we successfully construct mitochondrial gene and knock out plasmid PMitoCRISPR1-KO-12s rRNA carriers, after this plasmid vector imports 293T cells, have successfully knocked out mitochondrion base Because of group.

Embodiment 3 is knocked out for the mitochondrial gene of mitochondrion cytb gene locis

This example chooses cytb genes on mitochondrial genome, which is knocked out, is comprised the following steps that：With side described in example 2 Method carries out annealing reaction.

The sgRNA target sequences of Cytb are：ATCCCGTTTCGTGCAAGAAT；RP sequences are: TCTCCCTGAGCTTCAGGGAG；Cytb gene sgRNA for being inserted into pMitoCRISPR1 plasmid Bbs I restriction enzyme sites draw Thing sequence is as follows：：Mito-KO-H-Cytb-F: CACCGTCTCCCTGAGCTTCAGGGAGATCCCGTTTCGTGCAAGAAT；

Mito-KO-H-Cytb-R:AAACATTCTTGCACGAAACGGGATCTCCCTGAAGCTCAGGGAGAC；

Mitochondrial cytochrome b gene knockout carrier pMitoCRISPR1-KO-Cytb is built with 2 methods described of example, and by sequencing Verified.Then by method transfection 293T cell of the plasmid vector described in example 2, after 3 days, with the side described in example 2 Method detects the efficiency that the plasmid vector is knocked out to mitochondrial genome.Above-mentioned pMitoCRISPR1-KO-Cytb plasmids are imported After 293T cells, it can be found that cell has EGFP to express（Such as Fig. 2）.Meanwhile, the albumen of above-mentioned cell is extracted, Western is carried out Blot is analyzed, and as a result indicates the expression of Cas9（Fig. 4 b）.Then we extract above-mentioned cell full-length genome, for Cytb genes The knockout in site, using mitochondrial genome 12sr RNA and Matrix attachment region β-actin primers, analyzes intracellular mitochondrial The copy number change of genome.QPCR results show：Mitochondrial genome 12sr RNA and Matrix attachment region β-actin primers Amplification efficiency is almost unanimously respectively 99.548% and 97.271%.After transfection MitoCRISPR-KO-Cytb knocks out plasmid, 293T Intracellular mitochondrial genome copy number have dropped about 30%（Such as Fig. 6）.These results show that we successfully construct line Mitochondrial genes knock out plasmid pMitoCRISPR1-KO-Cytb carriers, after this plasmid vector imports 293T cells, successfully strike Except mitochondrial genome.

The impact that difference MLS elements are knocked out to mitochondrial gene on 4 MitoCRISPR carriers of embodiment

There is Thousands of protein or RNA in mitochondrion, wherein being mostly by nuclear gene encoding.These albumen are required Work into mitochondrion, and guide these protein to be referred to as MLS sequences into mitochondrial signal peptide sequence.The present embodiment Two kinds of heterogeneic MLS elements are used, and has compared the two impact that efficiency is knocked out to mitochondrial gene.Concrete grammar is such as Under：Two Age I restriction enzyme sites are introduced in Cas9 albumen n ends first；Then, replace on Age I restriction enzyme sites Two kinds of different MLS:Cox8A-MLS and ATP5B-MLS, constructs MitoCRISPR carriers respectively.This example is by mitochondrion base Because the sgRNA target sequences of the 12sr RNA in group are inserted into the above-mentioned Cox8A-MLS and ATP5B-MLS sequences that are respectively provided with On MitoCRISPR carriers, mitochondrial gene is constructed respectively and knocks out plasmid, pMitoCRISPR1-Cox8A-MLS-KO-12sr RNA and pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA.After above-mentioned plasmid is imported 293T cells 3 days, cell is extracted Full-length genome, with the qPCR methods described in example 2, using mitochondrial genome 12sr RNA and Matrix attachment region β-actin Primer, analyzes the copy number change of intracellular mitochondrial genome, and then the knockout efficiency of checking mitochondrial genome, with true Determine the impact that Cox8A-MLS and ATP5B-MLS elements are knocked out to mitochondrial gene.

As a result show：After transfection pMitoCRISPR5-ATP5B-MLS-KO-12sr RNA knock out plasmid, 293T is intracellular Mitochondrial genome copy number have dropped about 30%（Such as Fig. 7）, transfect pMitoCRISPR1-Cox8A-MLS-KO-12sr After RNA knocks out plasmid, 293T intracellular mitochondrial genome copy number have dropped about 22%（Such as Fig. 7）.These results show Mitochondrial gene knockout carrier with ATP5B-MLS sequences is knocked out than the mitochondrial gene with Cox8A-MLS sequences and is carried The knockout efficiency high of body.

The impact that the position of RP sequences is knocked out to mitochondrial gene on 5 MitoCRISPR carriers of embodiment

There is Thousands of protein or RNA in mitochondrion, wherein being mostly by nuclear gene encoding.Research shows will be outer Source RNA leads into mitochondrion, and RP sequences have played vital effect wherein, and the present embodiment optimizes RP sequences and exists Position in MitoCRISPR systems, to exclude its impact to protein function in system.In test, RP sequences are distinguished by we Before being placed on sgRNA sequences, before 3 ' UTR sequences and behind 3 ' UTR, MitoCRISPR-RP-sgRNA is constructed respectively, MitoCRISPR- RP-3 ' UTR, MitoCRISPR -3 ' UTR- RP (+) and MitoCRISPR -3 ' UTR- RP (-) etc. PMitoCRISPR1 and pMitoCRISPR9 to pMitoCRISPR11 plasmid vectors, to observe its position to MitoCRISP Impact in system.Then for the 12sr rna genes on mitochondrial genome, constructed with 12sr rna genes respectively The mitochondrial gene of sgRNA sequences and the RP sequences placed in above-mentioned diverse location knocks out plasmid vector pMitoCRISPR1-RP- sgRNA-KO-12sr RNA, pMitoCRISPR9-RP-3’UTR-KO-12sr RNA, pMitoCRISPR10 -3’UTR- RP (+)-sgRNA-KO-12sr RNA and pMitoCRISPR11-3 ' UTR-RP (-)-KO-12sr RNA plasmids.By these plasmids Transfection 293T cells carry out targeting knock out as above to mitochondrial genome, after transfecting 3 days, are detected with above-mentioned qPCR methods Mitochondrial genome copy number changes, to assess the efficiency of MitoCRISPR systems.As a result show（Fig. 8）：Transfection After pMitoCRISPR1-RP-sgRNA-KO-12sr RNA knock out plasmid, under 293T intracellular mitochondrial genome copy number About 22%, after transfection pMitoCRISPR9-RP-3 ' UTR-KO-12sr RNA knock out plasmid is dropped, 293T intracellular line grain Body genome copy numbers have dropped about 22%, transfect pMitoCRISPR10-3 ' UTR- RP (+)-sgRNA-KO-12sr RNA After knocking out plasmid, 293T intracellular mitochondrial genome copy number have dropped about 42%, transfect pMitoCRISPR11-3 ' After UTR- RP (-)-KO-12sr RNA knock out plasmid, 293T intracellular mitochondrial genome copy number have dropped about 5%. It is highest that these results show that RP sequences are added in 3 ' UTR knockout efficiency below（Fig. 8）.

The impact that different 3 ' UTR elements are knocked out to mitochondrial gene on 6 MitoCRISPR carriers of embodiment

There is Thousands of protein or RNA in mitochondrion, wherein being mostly by nuclear gene encoding.Research shows will be outer Source RNA leads into mitochondrion, and RP sequences and 3 ' UTR elements have played vital effect wherein, in the present embodiment we In addition to RP sequences, four kinds of heterogeneic 3 ' UTR elements have been used, and them has been compared to mitochondrial gene knockout efficiency Impact.Concrete grammar is as follows：We replace four kinds of 3 ' different UTR on the Spe I restriction enzyme sites of MitoCRISPR carriers: Cox8A-3 ' UTR, MRPS12-3 ' UTR, SOD2-3 ' UTR and ATP5B-3 ' UTR, constructs with above-mentioned four kind of 3 ' UTR sequence MitoCRISPR2-Cox8A-3 ' UTR, MitoCRISPR3-SOD2-3 ' UTR, MitoCRISPR1-MRPS12-3 ' UTR and MitoCRISPR4-ATP5B-3 ' UTR plasmid vectors.Then this example is directed to the 12sr rna genes on mitochondrial genome, On the above-mentioned four kinds carriers with different 3 ' UTR sequences, the sgRNA sequences of 12sr rna genes are inserted, is constructed pMitoCRISPR2-Cox8A-3’UTR-KO-12sr RNA, pMitoCRISPR3-SOD2-3’UTR-KO-12sr RNA, PMitoCRISPR1-MRPS12-3 ' UTR-KO-12sr RNA and pMitoCRISPR4-ATP5B-3 ' UTR-KO-12sr RNA matter Grain.These plasmid vectors are imported after 293T cells, the copy number for analyzing intracellular mitochondrial genome in aforementioned manners becomes Change.As a result show（Fig. 9）：After transfection MitoCRISPR2-Cox8A-3 ' UTR-KO-12sr RNA knock out plasmid, 293T is intracellular Mitochondrial genome copy number have dropped about 43%, transfection MitoCRISPR3-SOD2-3 ' UTR-KO-12sr RNA are knocked out After plasmid, 293T intracellular mitochondrial genome copy number have dropped about 13%, transfect MitoCRISPR1-MRPS12-3 ' After UTR-KO-12sr RNA knock out plasmid, 293T intracellular mitochondrial genome copy number have dropped about 22%, transfection After MitoCRISPR4-ATP5B-3 ' UTR-KO-12sr RNA knock out plasmid, 293T intracellular mitochondrial genome copy number Have dropped about 34%.It is highest that mitochondrial gene with Cox8A-3 ' UTR sequences knocks out the knockout efficiency of plasmid（Fig. 9）.

The foregoing is only presently preferred embodiments of the present invention, all impartial changes done according to scope of the present invention patent with Modification, should all belong to the covering scope of the present invention.

SEQUENCE LISTING

<110>Fujian Normal University

<120>The method that targeting editor is carried out to mitochondrial genome using CRISPR/Cas9

<130> 22

<160> 22

<170> PatentIn version 3.3

<210> 1

<211> 9645

<212> DNA

<213> pMitoCRISPR1

<400> 1

gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60

ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120

aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180

atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240

cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300

gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgccagaaga agtgacggct 360

gggggcacag tgggctgggc gcccctgcag aacatgaacc ttccgctcct ggctgccaca 420

gggtcctccg atgctggcct ttgcgcctct agaggcagcc actcatggat tcaagtcctg 480

gctccgcctc ttccatcagg accacttttt ttagcgcgtg cgccaattct gcagacaaat 540

ggctctagag gtacccgtta cataacttac ggtaaatggc ccgcctggct gaccgcccaa 600

cgacccccgc ccattgacgt caatagtaac gccaataggg actttccatt gacgtcaatg 660

ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc atatgccaag 720

tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattgtg cccagtacat 780

gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg ctattaccat 840

ggtcgaggtg agccccacgt tctgcttcac tctccccatc tcccccccct ccccaccccc 900

aattttgtat ttatttattt tttaattatt ttgtgcagcg atgggggcgg gggggggggg 960

ggggcgcgcg ccaggcgggg cggggcgggg cgaggggcgg ggcggggcga ggcggagagg 1020

tgcggcggca gccaatcaga gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg 1080

gcggcggcgg ccctataaaa agcgaagcgc gcggcgggcg ggagtcgctg cgacgctgcc 1140

ttcgccccgt gccccgctcc gccgccgcct cgcgccgccc gccccggctc tgactgaccg 1200

cgttactccc acaggtgagc gggcgggacg gcccttctcc tccgggctgt aattagctga 1260

gcaagaggta agggtttaag ggatggttgg ttggtggggt attaatgttt aattacctgg 1320

agcacctgcc tgaaatcact ttttttcagg ttggaccggt gccaccatgt ccgtcctgac 1380

gccgctgctg ctgcggggct tgacaggctc ggcccggcgg ctcccagtgc cgcgcgccaa 1440

gatccattcg ttgatggact ataaggacca cgacggagac tacaaggatc atgatattga 1500

ttacaaagac gatgacgata agatggccgg tatccacgga gtcccagcag ccgacaagaa 1560

gtacagcatc ggcctggaca tcggcaccaa ctctgtgggc tgggccgtga tcaccgacga 1620

gtacaaggtg cccagcaaga aattcaaggt gctgggcaac accgaccggc acagcatcaa 1680

gaagaacctg atcggagccc tgctgttcga cagcggcgaa acagccgagg ccacccggct 1740

gaagagaacc gccagaagaa gatacaccag acggaagaac cggatctgct atctgcaaga 1800

gatcttcagc aacgagatgg ccaaggtgga cgacagcttc ttccacagac tggaagagtc 1860

cttcctggtg gaagaggata agaagcacga gcggcacccc atcttcggca acatcgtgga 1920

cgaggtggcc taccacgaga agtaccccac catctaccac ctgagaaaga aactggtgga 1980

cagcaccgac aaggccgacc tgcggctgat ctatctggcc ctggcccaca tgatcaagtt 2040

ccggggccac ttcctgatcg agggcgacct gaaccccgac aacagcgacg tggacaagct 2100

gttcatccag ctggtgcaga cctacaacca gctgttcgag gaaaacccca tcaacgccag 2160

cggcgtggac gccaaggcca tcctgtctgc cagactgagc aagagcagac ggctggaaaa 2220

tctgatcgcc cagctgcccg gcgagaagaa gaatggcctg ttcggaaacc tgattgccct 2280

gagcctgggc ctgaccccca acttcaagag caacttcgac ctggccgagg atgccaaact 2340

gcagctgagc aaggacacct acgacgacga cctggacaac ctgctggccc agatcggcga 2400

ccagtacgcc gacctgtttc tggccgccaa gaacctgtcc gacgccatcc tgctgagcga 2460

catcctgaga gtgaacaccg agatcaccaa ggcccccctg agcgcctcta tgatcaagag 2520

atacgacgag caccaccagg acctgaccct gctgaaagct ctcgtgcggc agcagctgcc 2580

tgagaagtac aaagagattt tcttcgacca gagcaagaac ggctacgccg gctacattga 2640

cggcggagcc agccaggaag agttctacaa gttcatcaag cccatcctgg aaaagatgga 2700

cggcaccgag gaactgctcg tgaagctgaa cagagaggac ctgctgcgga agcagcggac 2760

cttcgacaac ggcagcatcc cccaccagat ccacctggga gagctgcacg ccattctgcg 2820

gcggcaggaa gatttttacc cattcctgaa ggacaaccgg gaaaagatcg agaagatcct 2880

gaccttccgc atcccctact acgtgggccc tctggccagg ggaaacagca gattcgcctg 2940

gatgaccaga aagagcgagg aaaccatcac cccctggaac ttcgaggaag tggtggacaa 3000

gggcgcttcc gcccagagct tcatcgagcg gatgaccaac ttcgataaga acctgcccaa 3060

cgagaaggtg ctgcccaagc acagcctgct gtacgagtac ttcaccgtgt ataacgagct 3120

gaccaaagtg aaatacgtga ccgagggaat gagaaagccc gccttcctga gcggcgagca 3180

gaaaaaggcc atcgtggacc tgctgttcaa gaccaaccgg aaagtgaccg tgaagcagct 3240

gaaagaggac tacttcaaga aaatcgagtg cttcgactcc gtggaaatct ccggcgtgga 3300

agatcggttc aacgcctccc tgggcacata ccacgatctg ctgaaaatta tcaaggacaa 3360

ggacttcctg gacaatgagg aaaacgagga cattctggaa gatatcgtgc tgaccctgac 3420

actgtttgag gacagagaga tgatcgagga acggctgaaa acctatgccc acctgttcga 3480

cgacaaagtg atgaagcagc tgaagcggcg gagatacacc ggctggggca ggctgagccg 3540

gaagctgatc aacggcatcc gggacaagca gtccggcaag acaatcctgg atttcctgaa 3600

gtccgacggc ttcgccaaca gaaacttcat gcagctgatc cacgacgaca gcctgacctt 3660

taaagaggac atccagaaag cccaggtgtc cggccagggc gatagcctgc acgagcacat 3720

tgccaatctg gccggcagcc ccgccattaa gaagggcatc ctgcagacag tgaaggtggt 3780

ggacgagctc gtgaaagtga tgggccggca caagcccgag aacatcgtga tcgaaatggc 3840

cagagagaac cagaccaccc agaagggaca gaagaacagc cgcgagagaa tgaagcggat 3900

cgaagagggc atcaaagagc tgggcagcca gatcctgaaa gaacaccccg tggaaaacac 3960

ccagctgcag aacgagaagc tgtacctgta ctacctgcag aatgggcggg atatgtacgt 4020

ggaccaggaa ctggacatca accggctgtc cgactacgat gtggaccata tcgtgcctca 4080

gagctttctg aaggacgact ccatcgacaa caaggtgctg accagaagcg acaagaaccg 4140

gggcaagagc gacaacgtgc cctccgaaga ggtcgtgaag aagatgaaga actactggcg 4200

gcagctgctg aacgccaagc tgattaccca gagaaagttc gacaatctga ccaaggccga 4260

gagaggcggc ctgagcgaac tggataaggc cggcttcatc aagagacagc tggtggaaac 4320

ccggcagatc acaaagcacg tggcacagat cctggactcc cggatgaaca ctaagtacga 4380

cgagaatgac aagctgatcc gggaagtgaa agtgatcacc ctgaagtcca agctggtgtc 4440

cgatttccgg aaggatttcc agttttacaa agtgcgcgag atcaacaact accaccacgc 4500

ccacgacgcc tacctgaacg ccgtcgtggg aaccgccctg atcaaaaagt accctaagct 4560

ggaaagcgag ttcgtgtacg gcgactacaa ggtgtacgac gtgcggaaga tgatcgccaa 4620

gagcgagcag gaaatcggca aggctaccgc caagtacttc ttctacagca acatcatgaa 4680

ctttttcaag accgagatta ccctggccaa cggcgagatc cggaagcggc ctctgatcga 4740

gacaaacggc gaaaccgggg agatcgtgtg ggataagggc cgggattttg ccaccgtgcg 4800

gaaagtgctg agcatgcccc aagtgaatat cgtgaaaaag accgaggtgc agacaggcgg 4860

cttcagcaaa gagtctatcc tgcccaagag gaacagcgat aagctgatcg ccagaaagaa 4920

ggactgggac cctaagaagt acggcggctt cgacagcccc accgtggcct attctgtgct 4980

ggtggtggcc aaagtggaaa agggcaagtc caagaaactg aagagtgtga aagagctgct 5040

ggggatcacc atcatggaaa gaagcagctt cgagaagaat cccatcgact ttctggaagc 5100

caagggctac aaagaagtga aaaaggacct gatcatcaag ctgcctaagt actccctgtt 5160

cgagctggaa aacggccgga agagaatgct ggcctctgcc ggcgaactgc agaagggaaa 5220

cgaactggcc ctgccctcca aatatgtgaa cttcctgtac ctggccagcc actatgagaa 5280

gctgaagggc tcccccgagg ataatgagca gaaacagctg tttgtggaac agcacaagca 5340

ctacctggac gagatcatcg agcagatcag cgagttctcc aagagagtga tcctggccga 5400

cgctaatctg gacaaagtgc tgtccgccta caacaagcac cgggataagc ccatcagaga 5460

gcaggccgag aatatcatcc acctgtttac cctgaccaat ctgggagccc ctgccgcctt 5520

caagtacttt gacaccacca tcgaccggaa gaggtacacc agcaccaaag aggtgctgga 5580

cgccaccctg atccaccaga gcatcaccgg cctgtacgag acacggatcg acctgtctca 5640

gctgggaggc gacaaaaggc cggcggccac gaaaaaggcc ggccaggcaa aaaagaaaaa 5700

ggaattcggc agtggagagg gcagaggaag tctgctaaca tgcggtgacg tcgaggagaa 5760

tcctggccca atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt 5820

cgagctggac ggcgacgtaa acggccacaa gttcagcgtg tccggcgagg gcgagggcga 5880

tgccacctac ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc 5940

ctggcccacc ctcgtgacca ccctgaccta cggcgtgcag tgcttcagcc gctaccccga 6000

ccacatgaag cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg 6060

caccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 6120

cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 6180

cctggggcac aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa 6240

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 6300

gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 6360

cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga 6420

tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actctcggca tggacgagct 6480

gtacaagtaa ctcgagcaga agaagtgacg gctgggggca cagtgggctg ggcgcccctg 6540

cagaacatga accttccgct cctggctgcc acagggtcct ccgatgctgg cctttgcgcc 6600

tctagaggca gccactcatg gattcaagtc ctggctccgc ctcttccatc aggaccacga 6660

attctaacta gagctcgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt 6720

gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc 6780

taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt 6840

ggggtggggc aggacagcaa gggggaggat tgggaagaga atagcaggca tgctggggag 6900

cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 6960

actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg 7020

agcgagcgag cgcgcagctg cctgcagggg cgcctgatgc ggtattttct ccttacgcat 7080

ctgtgcggta tttcacaccg catacgtcaa agcaaccata gtacgcgccc tgtagcggcg 7140

cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgccc 7200

tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 7260

gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 7320

accccaaaaa acttgatttg ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 7380

tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 7440

gaacaacact caaccctatc tcgggctatt cttttgattt ataagggatt ttgccgattt 7500

cggcctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 7560

tattaacgtt tacaatttta tggtgcactc tcagtacaat ctgctctgat gccgcatagt 7620

taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc 7680

cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt 7740

caccgtcatc accgaaacgc gcgagacgaa agggcctcgt gatacgccta tttttatagg 7800

ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg ggaaatgtgc 7860

gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac 7920

aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt 7980

tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag 8040

aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg 8100

aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa 8160

tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc 8220

aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag 8280

tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa 8340

ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc 8400

taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg 8460

agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa 8520

caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg caacaattaa 8580

tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg 8640

gctggtttat tgctgataaa tctggagccg gtgagcgtgg aagccgcggt atcattgcag 8700

cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg 8760

caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt 8820

ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt 8880

aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 8940

gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 9000

atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 9060

tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 9120

gagcgcagat accaaatact gtccttctag tgtagccgta gttaggccac cacttcaaga 9180

actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 9240

gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 9300

agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 9360

ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 9420

aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 9480

cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 9540

gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 9600

cctttttacg gttcctggcc ttttgctggc cttttgctca catgt 9645

<210> 2

<211> 222

<212> DNA

<213> Cox8A-3'UTR

<400> 2

aggggtccgt tctgtccctc acactgtgac ctgaccagcc ccaccggccc atcctggtca 60

tgttactgca tttgtggccg gcctcccctg gatcatgtca ttcaattcca gtcacctctt 120

ctgcaatcat gacctcttga tgtctccatg gtgacctcct tgggggtcac tgaccctgct 180

tggtggggtc ccccttgtaa caataaaatc tatttaaact tt 222

<210> 3

<211> 201

<212> DNA

<213> SOD2-3'UTR

<400> 3

accacgatcg ttatgctgat cataccctaa tgatcccagc aagataatgt cctgtcttct 60

aagatgtgca tcaagcctgg tacatactga aaaccctata aggtcctgga taatttttgt 120

ttgattattc attgaagaaa catttatttt ccaattgtgt gaagtttttg actgttaata 180

aaagaatctg tcaaccatca a 201

<210> 4

<211> 162

<212> DNA

<213> MRPS12-3'UTR

<400> 4

cagaagaagt gacggctggg ggcacagtgg gctgggcgcc cctgcagaac atgaaccttc 60

cgctcctggc tgccacaggg tcctccgatg ctggcctttg cgcctctaga ggcagccact 120

catggattca agtcctggct ccgcctcttc catcaggacc ac 162

<210> 5

<211> 146

<212> DNA

<213> ATP5B-3'UTR

<400> 5

ggggtctttg tcctctgtac tgtctctctc cttgccccta acccaaaaag cttcattttt 60

ctgtgtaggc tgcacaagag ccttgattga agatatattc tttctgaaca gtatttaagg 120

tttccaataa aatgtacacc cctcag 146

<210> 6

<211> 141

<212> DNA

<213> ATP5B-MLS

<400> 6

atgttggggt ttgtgggtcg ggtggccgct gctccggcct ccggggcctt gcggagactc 60

accccttcag cgtcgctgcc cccagctcag ctcttactgc gggccgctcc gacggcggtc 120

catcctgtca gggactatgc g 141

<210> 7

<211> 87

<212> DNA

<213> Cox8A-MLS

<400> 7

atgtccgtcc tgacgccgct gctgctgcgg ggcttgacag gctcggcccg gcggctccca 60

gtgccgcgcg ccaagatcca ttcgttg 87

<210> 8

<211> 20

<212> DNA

<213> RP

<400> 8

tctccctgag cttcagggag 20

<210> 9

<211> 63

<212> DNA

<213> 2A

<400> 9

ggcagtggag agggcagagg aagtctgcta acatgcggtg acgtcgagga gaatcctggc 60

cca 63

<210> 10

<211> 19

<212> DNA

<213>Artificial sequence

<400> 10

ctcaccacct cttgctcag 19

<210> 11

<211> 20

<212> DNA

<213>Artificial sequence

<400> 11

ggctacacct tgacctaacg 20

<210> 12

<211> 326

<212> DNA

<213>Artificial sequence

<400> 12

aggacgaaac accgggtctt cgagaagacc tgttttagag ctagaaatag caagttaaaa 60

taaggctagt ccgttatcaa cttgaaaaag tggcaccgag tcggtgccag aagaagtgac 120

ggctgggggc acagtgggct gggcgcccct gcagaacatg aaccttccgc tcctggctgc 180

cacagggtcc tccgatgctg gcctttgcgc ctctagaggc agccactcat ggattcaagt 240

cctggctccg cctcttccat caggaccaca ctagtttttt tagcgcgtgc gccaattctg 300

cagacaaatg gctctagagg tacccg 326

<210> 13

<211> 39

<212> DNA

<213>Artificial sequence

<400> 13

atcttgtgga aaggacgaaa caccgggtct tcgagaaga 39

<210> 14

<211> 42

<212> DNA

<213>Artificial sequence

<400> 14

gtaagttatg taacgggtac ctctagagcc atttgtctgc ag 42

<210> 15

<211> 451

<212> DNA

<213>Artificial sequence

<400> 15

accggtgcca ccatgtccgt cctgacgccg ctgctgctgc ggggcttgac aggctcggcc 60

cggcggctcc cagtgccgcg cgccaagatc cattcgttga tggactataa ggaccacgac 120

ggagactaca aggatcatga tattgattac aaagacgatg acgataagat ggccggtatc 180

cacggagtcc cagcagccga caagaagtac agcatcggcc tggacatcgg caccaactct 240

gtgggctggg ccgtgatcac cgacgagtac aaggtgccca gcaagaaatt caaggtgctg 300

ggcaacaccg accggcacag catcaagaag aacctgatcg gagccctgct gttcgacagc 360

ggcgaaacag ccgaggccac ccggctgaag agaaccgcca gaagaagata caccagacgg 420

aagaaccgga tctgctatct gcaagagatc t 451

<210> 16

<211> 20

<212> DNA

<213>Artificial sequence

<400> 16

taagggctat cgtagttttc 20

<210> 17

<211> 45

<212> DNA

<213>Artificial sequence

<400> 17

caccgtctcc ctgagcttca gggagtaagg gctatcgtag ttttc 45

<210> 18

<211> 45

<212> DNA

<213>Artificial sequence

<400> 18

aaacgaaaac tacgatagcc cttactccct gaagctcagg gagac 45

<210> 19

<211> 20

<212> DNA

<213>Artificial sequence

<400> 19

atcccgtttc gtgcaagaat 20

<210> 20

<211> 20

<212> DNA

<213>Artificial sequence

<400> 20

tctccctgag cttcagggag 20

<210> 21

<211> 45

<212> DNA

<213>Artificial sequence

<400> 21

caccgtctcc ctgagcttca gggagatccc gtttcgtgca agaat 45

<210> 22

<211> 45

<212> DNA

<213>Artificial sequence

<400> 22

aaacattctt gcacgaaacg ggatctccct gaagctcagg gagac 45

Claims (5)

1. the method for targeting editor being carried out to mitochondrial genome using CRISPR/Cas9 technologies, it is characterised in that：Including as follows Step：

（1）MitoCRISPR carriers are built, containing replaceable gene regulatory elements；

（2）The sgRNA of specific gene is inserted into into structure mitochondrial gene editor's carrier on MitoCRISPR carriers；

（3）Above-mentioned mitochondrial gene is modified into vector introduction to human or animal's cell, mitochondrial genome editor is carried out, is reached and strike Except or modification target gene purpose.

2. the method that utilization CRISPR/Cas9 technologies according to claim 1 carry out targeting editor to mitochondrial genome, Characterized in that, the method for the structure MitoCRISPR carriers is that following transformation is done on skeleton plasmid carrier PX459；Bone Primary element of the frame plasmid vector comprising CRISPR systems, i.e. Cas9 genes and U6 promoteres；The addition after U6 promoteres promotes Exogenous RNA enters mitochondrial signal sequence, i.e. 3 ' UTR sequences；3 ' UTR sequences help stable RNA, make it from nucleus Out, it is positioned on mitochondrial outer membrane；Then, RP sequences are added, to help RNA to enter mitochondrion；Then, Cas9 genes are removed Front nuclear localization signal, addition promote foreign protein to enter mitochondrial signal sequence, i.e. MLS sequences；Finally give for entering The MitoCRISPR plasmid vectors of row mitochondrial genome specific gene editor.

3. the method that utilization CRISPR/Cas9 according to claim 1 carries out targeting editor to mitochondrial genome, which is special Levy and be：Step（2）Concrete grammar is：Selecting step（1）Middle MitoCRISPR plasmid vectors are skeleton, in restricted enzyme The sgRNA sequences in target gene or site are inserted on BbsI sites, mitochondrial gene is built and is knocked out or edit carrier.

4. the method that utilization CRISPR/Cas9 according to claim 1 carries out targeting editor to mitochondrial genome, which is special Levy and be：Step（3）Concrete grammar is：By step（2）The plasmid vector of acquisition imports human or animal's cell, extracts thin after 3 days Born of the same parents' full-length genome, using real-time fluorescence quantitative PCR detection mitochondrial genome copy number change, to assess MitoCRISPR systems For the knockout efficiency of mitochondrial genome；Or Jing DNA sequencings determine the effect of gene editing.

5. the method that utilization CRISPR/Cas9 according to claim 4 carries out targeting knock out to mitochondrial genome, which is special Levy and be：Real-time fluorescence quantitative PCR primer is as follows：H-12sr RNA-qpcr-F:5 '-CTCACCACCTCTTGCTCAG-3 ', H-12sr RNA-qpcr-R: 5’-GGCTACACCTTGACCTAACG-3’;β-actin are compareed as internal reference.