CN110904155B - Base editor and preparation method and application thereof - Google Patents

Base editor and preparation method and application thereof Download PDF

Info

Publication number
CN110904155B
CN110904155B CN201911182893.5A CN201911182893A CN110904155B CN 110904155 B CN110904155 B CN 110904155B CN 201911182893 A CN201911182893 A CN 201911182893A CN 110904155 B CN110904155 B CN 110904155B
Authority
CN
China
Prior art keywords
cell
plasmid
tada
base editor
sgrna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911182893.5A
Other languages
Chinese (zh)
Other versions
CN110904155A (en
Inventor
朱向星
唐冬生
严爱芬
杨映
冯娟
刘连
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Foshan University
Original Assignee
Foshan University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Foshan University filed Critical Foshan University
Priority to CN201911182893.5A priority Critical patent/CN110904155B/en
Publication of CN110904155A publication Critical patent/CN110904155A/en
Application granted granted Critical
Publication of CN110904155B publication Critical patent/CN110904155B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90—Stable introduction of foreign DNA into chromosome
    • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
    • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/575—Hormones
    • C07K14/655—Somatostatins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102—Mutagenizing nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Endocrinology (AREA)
  • Cell Biology (AREA)
  • Mycology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present disclosure provides a base editor, which is a PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid, wherein the PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid includes a vector backbone PX459-U6-sgRNA-CBh-Cas9-PURO and TadA-D10A expression cassette DNA fragment. The base editor is a single recombinant plasmid, and in application, the single plasmid is utilized to carry out cell transfection operation, so that not only can the base editing efficiency be improved, but also adenine A of a target site can be specifically mutated into guanine G.

Description

Base editor and preparation method and application thereof
Technical Field
The present disclosure belongs to the technical field of gene editing, and in particular relates to a base editor, a preparation method and an application thereof.
Background
Gene editing (genome editing), also known as genome editing (genome editing) or genome engineering (genome engineering), is an emerging relatively precise genetic engineering technology that can modify a specific target gene in the genome of an organism. The gene editing technology refers to the technology that a human can perform fixed-point 'editing' on a target gene to modify specific DNA fragments. Gene editing relies on genetically engineered nucleases, also known as "molecular scissors," to create site-specific Double Strand Breaks (DSBs) at specific locations in the genome, inducing organisms to repair DSBs by non-homologous end joining (NHEJ) or Homologous Recombination (HR), the process of repair leading to gene mutations.
Somatic cell nuclear transfer (Somatic Cell Nuclear Transfer), abbreviated as "nuclear transfer," refers to a technique in which somatic cells of one species are transferred into enucleated oocytes, the transferred donor nuclei are reprogrammed in recipient egg cytoplasm, and then transferred to surrogate mother to produce new animal individuals. Somatic cell nuclear transfer is also known as "somatic cloning" (Somatic Cell Cloning) because the cytogenetic material is contained within the nucleus and the resulting offspring have identical genetic information to the nuclear donor. Since the genetic information of somatic cloned pigs is derived from donor cells, gene editing is performed on the donor cells, and cloned pigs are produced by using the gene editing cells, so that the gene editing pigs expressing the predetermined phenotype can be obtained. At present, the gene editing technology represented by CRISPR/Cas9 is combined with somatic cloning, so that the gene editing technology has been widely applied to the genetic modification of various animals including pigs, cattle and sheep, and the number of the gene editing pigs which are publicly reported in a short period of years and aim at improving economic characters and disease models is up to 100, so that powerful assistance is brought to agricultural production and medical research.
The adenine base editor (Adenine Gene Editor) is prepared by fusing escherichia coli tRNA adenine deaminase on Cas9n (D10A) protein with single-chain cleavage capability in a traditional CRISPR-Cas9 system, and can be used for efficiently converting a.T base pair of a target sequence into a.C base pair under the guidance of guide RNA (gRNA) to realize single base mutation so as to change the function of a gene, for example, ATG-GTG mutation is carried out on a gene start codon, so that the gene cannot be translated or frame shift mutation, namely gene knockout can be caused. Compared with the traditional CRISPR-Cas9 system, the adenine base editor can realize single base mutation to control gene functions, and does not cause DNA double strand break, so that the harmful cutting to genome is smaller. The adenine base editor is utilized to carry out gene editing on the pig somatic cells, so that the change of genome can be reduced to the greatest extent, and the pig somatic cells have higher precision and biological safety. The adenine base editor is gradually applied to pig gene editing at present, and if the operation steps can be further optimized, the program can be simplified, great impetus can be generated for pig gene editing.
The preparation of gene editing cells using an adenine base editor is the first step in producing single adenine base editing pigs using somatic cloning. The most common approach is to use a double plasmid (one carrying an adenine base editor and one carrying sgRNA) for cell co-transfection. In practical application, the method needs to prepare 2 plasmids and simultaneously transfect cells, has complex procedures and low cotransfection efficiency, and meanwhile, the single base editing effect on the cells is poor because the unmatched expression of the two plasmids also affects the base editing efficiency.
Disclosure of Invention
The purpose of the present disclosure is to provide a base editor, a preparation method and an application thereof, so as to achieve the purpose of improving the base editing efficiency.
In order to achieve the above purpose, the technical scheme is as follows:
a base editor which is a PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid, wherein the PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid comprises a vector backbone PX459-U6-sgRNA-CBh-Cas9-PURO and TadA-D10A expression cassette DNA fragment.
The nucleotide sequence of the PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid is shown as SEQ ID NO. 1.
The nucleotide sequence of the TadA-TadA x-D10A expression frame is shown as SEQ ID NO. 2.
A preparation method of a base editor comprises the following specific steps:
(I) Double enzyme digestion is carried out on PX459 plasmid to obtain PX459-U6-sgRNA-CBh-Cas9-PURO carrier skeleton;
(II) carrying out PCR amplification on the pCMV-ABE plasmid by using a primer with double enzyme cutting sites, and recovering a PCR product to obtain a TadA-TadA x-D10A expression frame sequence through double enzyme cutting;
(III) connecting PX459-U6-sgRNA-CBh-Cas9-PURO vector skeleton and TadA-D10A expression frame sequence by using ligase to obtain PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid.
The enzyme for double enzyme digestion is AgeI restriction endonuclease and BglII restriction endonuclease.
An application of a base editor in gene editing, wherein the application method comprises the following steps:
(1) Determining target sites of genes to be edited;
(2) Synthesizing a gRNA primer according to a target site of the gene, and then annealing the gRNA primer at a high temperature to form a primer dimer;
(3) Linearizing the base editor plasmid by using restriction enzyme, and then mixing the plasmid with the primer dimer for ligation to obtain a ligation product;
(4) Converting the connection product into competent cells, plating the competent cells for culture, selecting positive clones, amplifying bacteria, and purifying and recovering plasmids;
(5) Performing cell transfection on the purified and recovered plasmid;
(6) After cell transfection, carrying out cell subculture;
(7) After the cell is subcultured, antibiotics are added to carry out resistance screening of the cell;
(8) After resistance selection, the antibiotics are removed and cell culture is continued until single cell clones are grown.
The restriction enzyme is BbsI restriction enzyme.
The step (5) of cell transfection is cell transfection using Lipofectamine 3000 reagent, preferably the time of cell transfection is 6h.
The density of the cell subculture in the step (6) is 1 ten thousand/35 mm diameter culture dish, and the time of the cell subculture is preferably 2 days.
The antibiotic in the step (7) is puromycin, preferably the puromycin is used in an amount of 1 mug/mL, and the time for selecting the cell resistance is preferably 72 hours.
The beneficial effects of the present disclosure are: the invention provides a base editor and a preparation method and application thereof, wherein the base editor is a single recombinant plasmid, comprises gene elements such as adenine base editor, gRNA expression and other screening marks required by gene editing, and in the application, the single plasmid is utilized for cell transfection operation, so that the base editing efficiency can be improved, adenine A of a target site can be specifically mutated into guanine G, no influence is caused on bases of non-target sites, the preparation method is simple and convenient, and the base editor has wide application field, and can be applied to pig somatic gene editing and animal cell gene editing such as cattle and sheep.
Drawings
FIG. 1 shows a schematic diagram of a base editor structure.
Detailed Description
The following steps are merely illustrative of the technical solution of the present disclosure, and are not limiting thereof; although the present disclosure has been described in detail with reference to the foregoing steps, one of ordinary skill in the art will appreciate that: the technical scheme recorded in each step can be modified or part or all of the technical characteristics can be replaced equivalently; such modifications and substitutions do not depart from the essence of the corresponding technical solutions from the scope of the technical solutions of the steps of the present disclosure.
Example 1
A preparation method of a base editor comprises the following specific steps:
(1) Preparing a vector basic structure by using a PX459 plasmid, wherein the vector basic structure comprises Cas9 and sgRNA expression elements, wherein the Cas9 is provided with puromycin resistance gene (PURO) screening markers at the back, and the vector basic structure can be used for eukaryotic cell screening expression and is obtained by using AgeI+BglII double enzyme digestion;
(2) Obtaining TadA-D10A by using a pCMV-ABE7.10 plasmid, respectively synthesizing primers with an upstream AgeI cleavage site sequence and a downstream BglII cleavage site sequence, preparing a fragment containing a TadA-domain and containing a D10A sequence at the N-terminal of Cas9 by using the pCMV-ABE7.10 plasmid as a template, and carrying out double cleavage by using AgeI+BglII to obtain a fragment with a sticky end;
(3) Constructing recombinant plasmid, connecting the recombinant plasmid with sequences obtained in the steps (1) and (2) by using T4DNA ligase, transforming competent cells, plating and culturing, and performing colony identification to obtain PX 459-U6-sgRNA-CBh-TadA-10A-Cas 9-PURO recombinant plasmid, wherein the structure diagram is shown in figure 1, and the nucleotide sequence is shown in SEQ ID NO. 1.
Example 2
The application of the base editor in pig somatic cell (selected Bama miniature pig muscle growth inhibitor hormone) gene editing comprises the following specific operation steps:
(1) The gene sequencing is used for obtaining the No.1 exon of the Bama pig muscle growth inhibitor hormone gene, the nucleotide sequence of the gene is shown as SEQ ID NO.3, a CRISPR/Cas9 gene editing online design tool CRISPOR (http:// crispor.tefor.net /) is used for designing a target point positioned on the No.1 exon of the muscle growth inhibitor hormone gene, and the sequence SEQ ID NO.4 is found: gctgAttgttgctggtcccgtgg is high in score and is selected as an editing target, and uppercase A in the sequence is adenine targeted by an adenine base editor.
(2) The gRNA primer is synthesized according to the sequence, the upstream primer and the downstream primer are diluted and mixed according to the concentration of 10 mu M, the mixture is treated for 5min at 95 ℃, and then the mixture is cooled to room temperature at the speed of 1 ℃/min to form a primer dimer, wherein the upstream primer of the gRNA is SEQ ID NO.5: CACCgctgattgttgctggtcccg; the downstream primer of the gRNA is SEQ ID NO.6: AAACcgggaccagcaacaatcagc;
(3) Linearizing an adenine base editor plasmid by using BbsI restriction enzyme, splitting a gene fragment by agarose gel electrophoresis, cutting gel, recovering, mixing with the obtained primer dimer, and reacting overnight by using T4DNA ligase to obtain a ligation product;
(4) Converting the connection product into competent cells, plating, screening and culturing, selecting positive bacteria, amplifying and culturing, extracting plasmids from positive bacteria liquid, determining that the connection of the gRNA primer dimer is correct through gene sequencing, storing the adenine base editor plasmids in a refrigerator at the temperature of-20 ℃, and transfecting the cells;
(5) Culturing low-generation hypo-Bama pig fibroblasts, and carrying out cell transfection after about 50% confluence, wherein the transfection system is as follows: 0.5 microgram of plasmid, 1.5 microliter of Lipofectamine 3000, transfected for 6 hours in serum-free environment, and then replaced with complete cell culture broth;
(6) 24 hours after transfection, cells were passaged at a density of 1 ten thousand/35 mm petri dishes;
(7) After 2 days of cell subculture, 1 microgram/milliliter puromycin antibiotic is added for resistance screening for 72 hours;
(8) The puromycin antibiotic was removed and culture continued for 14 days, and single cell clones were grown.
Example 3
Experimental group: using the method of using a base editor in pig somatic gene editing as described in example 2 above, 3 parallel experiments were set up in the step of performing cell transfection.
Control group: meanwhile, the double plasmids of linearized PX459+pCMV-ABE7.10 are simultaneously transfected as a control, and the operation method is the same as that of the example 2, wherein in the step (3), the plasmid PX459 is linearized by using a restriction enzyme BglII enzyme, then a primer dimer is connected, and in the step (4), the linear recombinant plasmid PX459 connected with the primer dimer and the pCMV-ABE7.10 plasmid are simultaneously transfected as a double plasmid gene editing control test.
Finally, the single cells obtained are selected and then are subjected to cloning and amplification culture, the genomic DNA extracted from the cells is collected, the detection gene fragment is shown by the selection sequence SEQ ID NO.9 (which is not subjected to gene editing) of the editing site as described in the above example 1, and a specific primer is designed according to the detection gene fragment, wherein the upstream primer SEQ ID NO.7: aacctctgacagcgagattc; the downstream primer SEQ ID NO.8: atgatcgttt ccgtcgtagc, then, a gene sequence is obtained by PCR using specific primers, and the PCR fragment is recovered and ligated with an 18T sequencing vector for sequencing, and the ratio of the mutation of target adenine (A) to guanine (G) is analyzed.
100 18T sequencing assays were obtained according to the two sets of experiments described above, respectively, wherein the target sequence in the single plasmid transfected cell clone using the base editor described in the present disclosure in the experimental set consisted of SEQ ID NO.4: gctg Attgttgctggtcccgtgg is mutated to SEQ ID NO.10: gctgGttgttgctggtcccgtgg results were 18, base editing efficiency was 18%; target sequence in "linearized PX459+pCMV-ABE7.10" double plasmid transfected cell clone in control group consists of SEQ ID NO.4: gctgAttgttgctggtcccgtgg is mutated to SEQ ID NO.10: gctgGttgttgctggtcccgtgg results were 5, 5% in proportion. The base editor disclosed by the disclosure not only simplifies the operation procedure, but also greatly improves the single adenine base editing efficiency in use.
SEQUENCE LISTING
<110> academy of science and technology of Buddha mountain
<120> a base editor, method for preparing the same and use thereof
<130> 2019.11.26
<160> 10
<170> PatentIn version 3.5
<210> 1
<211> 10245
<212> DNA
<213> Synthesis
<400> 1
gagggcctat ttcccatgat tccttcatat ttgcatatac gatacaaggc tgttagagag 60
ataattggaa ttaatttgac tgtaaacaca aagatattag tacaaaatac gtgacgtaga 120
aagtaataat ttcttgggta gtttgcagtt ttaaaattat gttttaaaat ggactatcat 180
atgcttaccg taacttgaaa gtatttcgat ttcttggctt tatatatctt gtggaaagga 240
cgaaacaccg ggtcttcgag aagacctgtt ttagagctag aaatagcaag ttaaaataag 300
gctagtccgt tatcaacttg aaaaagtggc accgagtcgg tgcttttttg ttttagagct 360
agaaatagca agttaaaata aggctagtcc gtttttagcg cgtgcgccaa ttctgcagac 420
aaatggctct agaggtaccc gttacataac ttacggtaaa tggcccgcct ggctgaccgc 480
ccaacgaccc ccgcccattg acgtcaatag taacgccaat agggactttc cattgacgtc 540
aatgggtgga gtatttacgg taaactgccc acttggcagt acatcaagtg tatcatatgc 600
caagtacgcc ccctattgac gtcaatgacg gtaaatggcc cgcctggcat tgtgcccagt 660
acatgacctt atgggacttt cctacttggc agtacatcta cgtattagtc atcgctatta 720
ccatggtcga ggtgagcccc acgttctgct tcactctccc catctccccc ccctccccac 780
ccccaatttt gtatttattt attttttaat tattttgtgc agcgatgggg gcgggggggg 840
ggggggggcg cgcgccaggc ggggcggggc ggggcgaggg gcggggcggg gcgaggcgga 900
gaggtgcggc ggcagccaat cagagcggcg cgctccgaaa gtttcctttt atggcgaggc 960
ggcggcggcg gcggccctat aaaaagcgaa gcgcgcggcg ggcgggagtc gctgcgcgct 1020
gccttcgccc cgtgccccgc tccgccgccg cctcgcgccg cccgccccgg ctctgactga 1080
ccgcgttact cccacaggtg agcgggcggg acggcccttc tcctccgggc tgtaattagc 1140
tgagcaagag gtaagggttt aagggatggt tggttggtgg ggtattaatg tttaattacc 1200
tggagcacct gcctgaaatc actttttttc aggttggacc ggtgccacca tgtccgaagt 1260
cgagttttcc catgagtact ggatgagaca cgcattgact ctcgcaaaga gggcttggga 1320
tgaacgcgag gtgcccgtgg gggcagtact cgtgcataac aatcgcgtaa tcggcgaagg 1380
ttggaatagg ccgatcggac gccacgaccc cactgcacat gcggaaatca tggcccttcg 1440
acagggaggg cttgtgatgc agaattatcg acttatcgat gcgacgctgt acgtcacgct 1500
tgaaccttgc gtaatgtgcg cgggagctat gattcactcc cgcattggac gagttgtatt 1560
cggtgcccgc gacgccaaga cgggtgccgc aggttcactg atggacgtgc tgcatcaccc 1620
aggcatgaac caccgggtag aaatcacaga aggcatattg gcggacgaat gtgcggcgct 1680
gttgtccgac ttttttcgca tgcggaggca ggagatcaag gcccagaaaa aagcacaatc 1740
ctctactgac tctggtggtt cttctggtgg ttctagcggc agcgagactc ccgggacctc 1800
agagtccgcc acacccgaaa gttctggtgg ttcttctggt ggttcttccg aagtcgagtt 1860
ttcccatgag tactggatga gacacgcatt gactctcgca aagagggctc gagatgaacg 1920
cgaggtgccc gtgggggcag tactcgtgct caacaatcgc gtaatcggcg aaggttggaa 1980
tagggcaatc ggactccacg accccactgc acatgcggaa atcatggccc ttcgacaggg 2040
agggcttgtg atgcagaatt atcgacttat cgatgcgacg ctgtacgtca cgtttgaacc 2100
ttgcgtaatg tgcgcgggag ctatgattca ctcccgcatt ggacgagttg tattcggtgt 2160
tcgcaacgcc aagacgggtg ccgcaggttc actgatggac gtgctgcatt acccaggcat 2220
gaaccaccgg gtagaaatca cagaaggcat attggcggac gaatgtgcgg cgctgttgtg 2280
ttactttttt cgcatgccca ggcaggtctt taacgcccag aaaaaagcac aatcctctac 2340
tgactctggt ggttcttctg gtggttctag cggcagcgag actcccggga cctcagagtc 2400
cgccacaccc gaaagttctg gtggttcttc tggtggttct gataaaaagt attctattgg 2460
tttagccatc ggcactaatt ccgttggatg ggctgtcata accgatgaat acaaagtacc 2520
ttcaaagaaa tttaaggtgt tggggaacac agaccgtcat tcgattaaaa agaatcttat 2580
cggtgccctc ctattcgata gtggcgaaac ggcagaggcg actcgcctga aacgaaccgc 2640
tcggagaagg tatacacgtc gcaagaaccg aatatgttac ttacaagaga tcttcagcaa 2700
cgagatggcc aaggtggacg acagcttctt ccacagactg gaagagtcct tcctggtgga 2760
agaggataag aagcacgagc ggcaccccat cttcggcaac atcgtggacg aggtggccta 2820
ccacgagaag taccccacca tctaccacct gagaaagaaa ctggtggaca gcaccgacaa 2880
ggccgacctg cggctgatct atctggccct ggcccacatg atcaagttcc ggggccactt 2940
cctgatcgag ggcgacctga accccgacaa cagcgacgtg gacaagctgt tcatccagct 3000
ggtgcagacc tacaaccagc tgttcgagga aaaccccatc aacgccagcg gcgtggacgc 3060
caaggccatc ctgtctgcca gactgagcaa gagcagacgg ctggaaaatc tgatcgccca 3120
gctgcccggc gagaagaaga atggcctgtt cggaaacctg attgccctga gcctgggcct 3180
gacccccaac ttcaagagca acttcgacct ggccgaggat gccaaactgc agctgagcaa 3240
ggacacctac gacgacgacc tggacaacct gctggcccag atcggcgacc agtacgccga 3300
cctgtttctg gccgccaaga acctgtccga cgccatcctg ctgagcgaca tcctgagagt 3360
gaacaccgag atcaccaagg cccccctgag cgcctctatg atcaagagat acgacgagca 3420
ccaccaggac ctgaccctgc tgaaagctct cgtgcggcag cagctgcctg agaagtacaa 3480
agagattttc ttcgaccaga gcaagaacgg ctacgccggc tacattgacg gcggagccag 3540
ccaggaagag ttctacaagt tcatcaagcc catcctggaa aagatggacg gcaccgagga 3600
actgctcgtg aagctgaaca gagaggacct gctgcggaag cagcggacct tcgacaacgg 3660
cagcatcccc caccagatcc acctgggaga gctgcacgcc attctgcggc ggcaggaaga 3720
tttttaccca ttcctgaagg acaaccggga aaagatcgag aagatcctga ccttccgcat 3780
cccctactac gtgggccctc tggccagggg aaacagcaga ttcgcctgga tgaccagaaa 3840
gagcgaggaa accatcaccc cctggaactt cgaggaagtg gtggacaagg gcgcttccgc 3900
ccagagcttc atcgagcgga tgaccaactt cgataagaac ctgcccaacg agaaggtgct 3960
gcccaagcac agcctgctgt acgagtactt caccgtgtat aacgagctga ccaaagtgaa 4020
atacgtgacc gagggaatga gaaagcccgc cttcctgagc ggcgagcaga aaaaggccat 4080
cgtggacctg ctgttcaaga ccaaccggaa agtgaccgtg aagcagctga aagaggacta 4140
cttcaagaaa atcgagtgct tcgactccgt ggaaatctcc ggcgtggaag atcggttcaa 4200
cgcctccctg ggcacatacc acgatctgct gaaaattatc aaggacaagg acttcctgga 4260
caatgaggaa aacgaggaca ttctggaaga tatcgtgctg accctgacac tgtttgagga 4320
cagagagatg atcgaggaac ggctgaaaac ctatgcccac ctgttcgacg acaaagtgat 4380
gaagcagctg aagcggcgga gatacaccgg ctggggcagg ctgagccgga agctgatcaa 4440
cggcatccgg gacaagcagt ccggcaagac aatcctggat ttcctgaagt ccgacggctt 4500
cgccaacaga aacttcatgc agctgatcca cgacgacagc ctgaccttta aagaggacat 4560
ccagaaagcc caggtgtccg gccagggcga tagcctgcac gagcacattg ccaatctggc 4620
cggcagcccc gccattaaga agggcatcct gcagacagtg aaggtggtgg acgagctcgt 4680
gaaagtgatg ggccggcaca agcccgagaa catcgtgatc gaaatggcca gagagaacca 4740
gaccacccag aagggacaga agaacagccg cgagagaatg aagcggatcg aagagggcat 4800
caaagagctg ggcagccaga tcctgaaaga acaccccgtg gaaaacaccc agctgcagaa 4860
cgagaagctg tacctgtact acctgcagaa tgggcgggat atgtacgtgg accaggaact 4920
ggacatcaac cggctgtccg actacgatgt ggaccatatc gtgcctcaga gctttctgaa 4980
ggacgactcc atcgacaaca aggtgctgac cagaagcgac aagaaccggg gcaagagcga 5040
caacgtgccc tccgaagagg tcgtgaagaa gatgaagaac tactggcggc agctgctgaa 5100
cgccaagctg attacccaga gaaagttcga caatctgacc aaggccgaga gaggcggcct 5160
gagcgaactg gataaggccg gcttcatcaa gagacagctg gtggaaaccc ggcagatcac 5220
aaagcacgtg gcacagatcc tggactcccg gatgaacact aagtacgacg agaatgacaa 5280
gctgatccgg gaagtgaaag tgatcaccct gaagtccaag ctggtgtccg atttccggaa 5340
ggatttccag ttttacaaag tgcgcgagat caacaactac caccacgccc acgacgccta 5400
cctgaacgcc gtcgtgggaa ccgccctgat caaaaagtac cctaagctgg aaagcgagtt 5460
cgtgtacggc gactacaagg tgtacgacgt gcggaagatg atcgccaaga gcgagcagga 5520
aatcggcaag gctaccgcca agtacttctt ctacagcaac atcatgaact ttttcaagac 5580
cgagattacc ctggccaacg gcgagatccg gaagcggcct ctgatcgaga caaacggcga 5640
aaccggggag atcgtgtggg ataagggccg ggattttgcc accgtgcgga aagtgctgag 5700
catgccccaa gtgaatatcg tgaaaaagac cgaggtgcag acaggcggct tcagcaaaga 5760
gtctatcctg cccaagagga acagcgataa gctgatcgcc agaaagaagg actgggaccc 5820
taagaagtac ggcggcttcg acagccccac cgtggcctat tctgtgctgg tggtggccaa 5880
agtggaaaag ggcaagtcca agaaactgaa gagtgtgaaa gagctgctgg ggatcaccat 5940
catggaaaga agcagcttcg agaagaatcc catcgacttt ctggaagcca agggctacaa 6000
agaagtgaaa aaggacctga tcatcaagct gcctaagtac tccctgttcg agctggaaaa 6060
cggccggaag agaatgctgg cctctgccgg cgaactgcag aagggaaacg aactggccct 6120
gccctccaaa tatgtgaact tcctgtacct ggccagccac tatgagaagc tgaagggctc 6180
ccccgaggat aatgagcaga aacagctgtt tgtggaacag cacaagcact acctggacga 6240
gatcatcgag cagatcagcg agttctccaa gagagtgatc ctggccgacg ctaatctgga 6300
caaagtgctg tccgcctaca acaagcaccg ggataagccc atcagagagc aggccgagaa 6360
tatcatccac ctgtttaccc tgaccaatct gggagcccct gccgccttca agtactttga 6420
caccaccatc gaccggaaga ggtacaccag caccaaagag gtgctggacg ccaccctgat 6480
ccaccagagc atcaccggcc tgtacgagac acggatcgac ctgtctcagc tgggaggcga 6540
caaaaggccg gcggccacga aaaaggccgg ccaggcaaaa aagaaaaagg aattcggcag 6600
tggagagggc agaggaagtc tgctaacatg cggtgacgtc gaggagaatc ctggcccaat 6660
gaccgagtac aagcccacgg tgcgcctcgc cacccgcgac gacgtcccca gggccgtacg 6720
caccctcgcc gccgcgttcg ccgactaccc cgccacgcgc cacaccgtcg atccggaccg 6780
ccacatcgag cgggtcaccg agctgcaaga actcttcctc acgcgcgtcg ggctcgacat 6840
cggcaaggtg tgggtcgcgg acgacggcgc cgcggtggcg gtctggacca cgccggagag 6900
cgtcgaagcg ggggcggtgt tcgccgagat cggcccgcgc atggccgagt tgagcggttc 6960
ccggctggcc gcgcagcaac agatggaagg cctcctggcg ccgcaccggc ccaaggagcc 7020
cgcgtggttc ctggccaccg tcggagtctc gcccgaccac cagggcaagg gtctgggcag 7080
cgccgtcgtg ctccccggag tggaggcggc cgagcgcgcc ggggtgcccg ccttcctgga 7140
gacctccgcg ccccgcaacc tccccttcta cgagcggctc ggcttcaccg tcaccgccga 7200
cgtcgaggtg cccgaaggac cgcgcacctg gtgcatgacc cgcaagcccg gtgcctgaga 7260
attctaacta gagctcgctg atcagcctcg actgtgcctt ctagttgcca gccatctgtt 7320
gtttgcccct cccccgtgcc ttccttgacc ctggaaggtg ccactcccac tgtcctttcc 7380
taataaaatg aggaaattgc atcgcattgt ctgagtaggt gtcattctat tctggggggt 7440
ggggtggggc aggacagcaa gggggaggat tgggaagaga atagcaggca tgctggggag 7500
cggccgcagg aacccctagt gatggagttg gccactccct ctctgcgcgc tcgctcgctc 7560
actgaggccg ggcgaccaaa ggtcgcccga cgcccgggct ttgcccgggc ggcctcagtg 7620
agcgagcgag cgcgcagctg cctgcagggg cgcctgatgc ggtattttct ccttacgcat 7680
ctgtgcggta tttcacaccg catacgtcaa agcaaccata gtacgcgccc tgtagcggcg 7740
cattaagcgc ggcgggtgtg gtggttacgc gcagcgtgac cgctacactt gccagcgcct 7800
tagcgcccgc tcctttcgct ttcttccctt cctttctcgc cacgttcgcc ggctttcccc 7860
gtcaagctct aaatcggggg ctccctttag ggttccgatt tagtgcttta cggcacctcg 7920
accccaaaaa acttgatttg ggtgatggtt cacgtagtgg gccatcgccc tgatagacgg 7980
tttttcgccc tttgacgttg gagtccacgt tctttaatag tggactcttg ttccaaactg 8040
gaacaacact caactctatc tcgggctatt cttttgattt ataagggatt ttgccgattt 8100
cggtctattg gttaaaaaat gagctgattt aacaaaaatt taacgcgaat tttaacaaaa 8160
tattaacgtt tacaatttta tggtgcactc tcagtacaat ctgctctgat gccgcatagt 8220
taagccagcc ccgacacccg ccaacacccg ctgacgcgcc ctgacgggct tgtctgctcc 8280
cggcatccgc ttacagacaa gctgtgaccg tctccgggag ctgcatgtgt cagaggtttt 8340
caccgtcatc accgaaacgc gcgagacgaa agggcctcgt gatacgccta tttttatagg 8400
ttaatgtcat gataataatg gtttcttaga cgtcaggtgg cacttttcgg ggaaatgtgc 8460
gcggaacccc tatttgttta tttttctaaa tacattcaaa tatgtatccg ctcatgagac 8520
aataaccctg ataaatgctt caataatatt gaaaaaggaa gagtatgagt attcaacatt 8580
tccgtgtcgc ccttattccc ttttttgcgg cattttgcct tcctgttttt gctcacccag 8640
aaacgctggt gaaagtaaaa gatgctgaag atcagttggg tgcacgagtg ggttacatcg 8700
aactggatct caacagcggt aagatccttg agagttttcg ccccgaagaa cgttttccaa 8760
tgatgagcac ttttaaagtt ctgctatgtg gcgcggtatt atcccgtatt gacgccgggc 8820
aagagcaact cggtcgccgc atacactatt ctcagaatga cttggttgag tactcaccag 8880
tcacagaaaa gcatcttacg gatggcatga cagtaagaga attatgcagt gctgccataa 8940
ccatgagtga taacactgcg gccaacttac ttctgacaac gatcggagga ccgaaggagc 9000
taaccgcttt tttgcacaac atgggggatc atgtaactcg ccttgatcgt tgggaaccgg 9060
agctgaatga agccatacca aacgacgagc gtgacaccac gatgcctgta gcaatggcaa 9120
caacgttgcg caaactatta actggcgaac tacttactct agcttcccgg caacaattaa 9180
tagactggat ggaggcggat aaagttgcag gaccacttct gcgctcggcc cttccggctg 9240
gctggtttat tgctgataaa tctggagccg gtgagcgtgg aagccgcggt atcattgcag 9300
cactggggcc agatggtaag ccctcccgta tcgtagttat ctacacgacg gggagtcagg 9360
caactatgga tgaacgaaat agacagatcg ctgagatagg tgcctcactg attaagcatt 9420
ggtaactgtc agaccaagtt tactcatata tactttagat tgatttaaaa cttcattttt 9480
aatttaaaag gatctaggtg aagatccttt ttgataatct catgaccaaa atcccttaac 9540
gtgagttttc gttccactga gcgtcagacc ccgtagaaaa gatcaaagga tcttcttgag 9600
atcctttttt tctgcgcgta atctgctgct tgcaaacaaa aaaaccaccg ctaccagcgg 9660
tggtttgttt gccggatcaa gagctaccaa ctctttttcc gaaggtaact ggcttcagca 9720
gagcgcagat accaaatact gttcttctag tgtagccgta gttaggccac cacttcaaga 9780
actctgtagc accgcctaca tacctcgctc tgctaatcct gttaccagtg gctgctgcca 9840
gtggcgataa gtcgtgtctt accgggttgg actcaagacg atagttaccg gataaggcgc 9900
agcggtcggg ctgaacgggg ggttcgtgca cacagcccag cttggagcga acgacctaca 9960
ccgaactgag atacctacag cgtgagctat gagaaagcgc cacgcttccc gaagggagaa 10020
aggcggacag gtatccggta agcggcaggg tcggaacagg agagcgcacg agggagcttc 10080
cagggggaaa cgcctggtat ctttatagtc ctgtcgggtt tcgccacctc tgacttgagc 10140
gtcgattttt gtgatgctcg tcaggggggc ggagcctatg gaaaaacgcc agcaacgcgg 10200
cctttttacg gttcctggcc ttttgctggc cttttgctca catgt 10245
<210> 2
<211> 1456
<212> DNA
<213> Synthesis
<400> 2
accggtgcca ccatgtccga agtcgagttt tcccatgagt actggatgag acacgcattg 60
actctcgcaa agagggcttg ggatgaacgc gaggtgcccg tgggggcagt actcgtgcat 120
aacaatcgcg taatcggcga aggttggaat aggccgatcg gacgccacga ccccactgca 180
catgcggaaa tcatggccct tcgacaggga gggcttgtga tgcagaatta tcgacttatc 240
gatgcgacgc tgtacgtcac gcttgaacct tgcgtaatgt gcgcgggagc tatgattcac 300
tcccgcattg gacgagttgt attcggtgcc cgcgacgcca agacgggtgc cgcaggttca 360
ctgatggacg tgctgcatca cccaggcatg aaccaccggg tagaaatcac agaaggcata 420
ttggcggacg aatgtgcggc gctgttgtcc gacttttttc gcatgcggag gcaggagatc 480
aaggcccaga aaaaagcaca atcctctact gactctggtg gttcttctgg tggttctagc 540
ggcagcgaga ctcccgggac ctcagagtcc gccacacccg aaagttctgg tggttcttct 600
ggtggttctt ccgaagtcga gttttcccat gagtactgga tgagacacgc attgactctc 660
gcaaagaggg ctcgagatga acgcgaggtg cccgtggggg cagtactcgt gctcaacaat 720
cgcgtaatcg gcgaaggttg gaatagggca atcggactcc acgaccccac tgcacatgcg 780
gaaatcatgg cccttcgaca gggagggctt gtgatgcaga attatcgact tatcgatgcg 840
acgctgtacg tcacgtttga accttgcgta atgtgcgcgg gagctatgat tcactcccgc 900
attggacgag ttgtattcgg tgttcgcaac gccaagacgg gtgccgcagg ttcactgatg 960
gacgtgctgc attacccagg catgaaccac cgggtagaaa tcacagaagg catattggcg 1020
gacgaatgtg cggcgctgtt gtgttacttt tttcgcatgc ccaggcaggt ctttaacgcc 1080
cagaaaaaag cacaatcctc tactgactct ggtggttctt ctggtggttc tagcggcagc 1140
gagactcccg ggacctcaga gtccgccaca cccgaaagtt ctggtggttc ttctggtggt 1200
tctgataaaa agtattctat tggtttagcc atcggcacta attccgttgg atgggctgtc 1260
ataaccgatg aatacaaagt accttcaaag aaatttaagg tgttggggaa cacagaccgt 1320
cattcgatta aaaagaatct tatcggtgcc ctcctattcg atagtggcga aacggcagag 1380
gcgactcgcc tgaaacgaac cgctcggaga aggtatacac gtcgcaagaa ccgaatatgt 1440
tacttacaag agatct 1456
<210> 3
<211> 373
<212> DNA
<213> Synthesis
<400> 3
atgcaaaaac tgcaaatcta tgtttatatt tacctgttta tgctgattgt tgctggtccc 60
gtggatctga atgagaacag cgagcaaaag gaaaatgtgg aaaaagaggg gctgtgtaat 120
gcatgtatgt ggagacaaaa cactaaatct tcaagactag aagccataaa aattcaaatc 180
ctcagtaaac ttcgcctgga aacagctcct aacattagca aagatgctat aagacaactt 240
ttgcccaaag ctcctccact ccgggaactg attgatcagt acgatgtcca gagagatgac 300
agcagtgatg gctccttgga agatgatgat tatcacgcta cgacggaaac gatcattacc 360
atgcctacag agt 373
<210> 4
<211> 23
<212> DNA
<213> Synthesis
<400> 4
gctgattgtt gctggtcccg tgg 23
<210> 5
<211> 24
<212> DNA
<213> Synthesis
<400> 5
caccgctgat tgttgctggt cccg 24
<210> 6
<211> 24
<212> DNA
<213> Synthesis
<400> 6
aaaccgggac cagcaacaat cagc 24
<210> 7
<211> 20
<212> DNA
<213> Synthesis
<400> 7
aacctctgac agcgagattc 20
<210> 8
<211> 20
<212> DNA
<213> Synthesis
<400> 8
atgatcgttt ccgtcgtagc 20
<210> 9
<211> 590
<212> DNA
<213> Synthesis
<400> 9
aacctctgac agcgagattc attgtggagc aagagccaat catagatcct gacgacactt 60
gtctcatcaa gtggaatata aaaagccact tggaatacag tataaaagat tcactggtgt 120
ggcaagttgt ctctcagaca gtgcaggcat taaaattttg cttggcgtta ctcaaaagca 180
aaagtaaaag gaagaaataa gaacaaggag aaagattgta ttgattttaa aatcatgcaa 240
aaactgcaaa tctatgttta tatttacctg tttatgctga ttgttgctgg tcccgtggat 300
ctgaatgaga acagcgagca aaaggaaaat gtggaaaaag aggggctgtg taatgcatgt 360
atgtggagac aaaacactaa atcttcaaga ctagaagcca taaaaattca aatcctcagt 420
aaacttcgcc tggaaacagc tcctaacatt agcaaagatg ctataagaca acttttgccc 480
aaagctcctc cactccggga actgattgat cagtacgatg tccagagaga tgacagcagt 540
gatggctcct tggaagatga tgattatcac gctacgacgg aaacgatcat 590
<210> 10
<211> 23
<212> DNA
<213> Synthesis
<400> 10
gctggttgtt gctggtcccg tgg 23

Claims (8)

1. The base editor is characterized in that the base editor is a PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid, and the nucleotide sequence of the PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid is shown as SEQ ID NO. 1.
2. The method for preparing a base editor according to claim 1, characterized in that it comprises the following specific steps:
(I) Double enzyme digestion is carried out on PX459 plasmid to obtain PX459-U6-sgRNA-CBh-Cas9-PURO carrier skeleton;
(II) carrying out PCR amplification on the pCMV-ABE plasmid by using a primer with double enzyme cutting sites, and recovering a PCR product to obtain a TadA-TadA x-D10A expression frame sequence through double enzyme cutting;
(III) connecting PX459-U6-sgRNA-CBh-Cas9-PURO vector skeleton and TadA-D10A expression frame sequence by using ligase to obtain PX 459-U6-sgRNA-CBh-TadA-D10A-Cas 9-PURO recombinant plasmid.
3. The method for producing a base editor as claimed in claim 2, wherein the enzymes for double cleavage are AgeI restriction enzyme and BglII restriction enzyme, respectively.
4. Use of the base editor of claim 1 for pig somatic gene editing, wherein the method of use is:
(1) Determining target sites of genes to be edited;
(2) Synthesizing a gRNA primer according to a target site of the gene, and then annealing the gRNA primer at a high temperature to form a primer dimer;
(3) Linearizing the base editor plasmid by using restriction enzyme, and then mixing the plasmid with the primer dimer for ligation to obtain a ligation product;
(4) Converting the connection product into competent cells, plating the competent cells for culture, selecting positive clones, amplifying bacteria, and purifying and recovering plasmids;
(5) Performing cell transfection on the purified and recovered plasmid;
(6) After cell transfection, carrying out cell subculture;
(7) After the cell is subcultured, antibiotics are added to carry out resistance screening of the cell;
(8) After resistance selection, the antibiotics are removed and cell culture is continued until single cell clones are grown.
5. The use according to claim 4, wherein the restriction enzyme is a BbsI restriction enzyme.
6. The use according to claim 4, wherein the cell transfection in step (5) is performed using Lipofectamine 3000 reagent for a period of 6 hours.
7. The use according to claim 4, wherein the density of the cell subculture in step (6) is 1 ten thousand/35 mm diameter culture dish and the time of the cell subculture is 2 days.
8. The use according to claim 4, wherein the antibiotic in step (7) is puromycin, the puromycin is used in an amount of 1 μg/mL, and the time for cell resistance selection is 72h.
CN201911182893.5A 2019-11-27 2019-11-27 Base editor and preparation method and application thereof Active CN110904155B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911182893.5A CN110904155B (en) 2019-11-27 2019-11-27 Base editor and preparation method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911182893.5A CN110904155B (en) 2019-11-27 2019-11-27 Base editor and preparation method and application thereof

Publications (2)

Publication Number Publication Date
CN110904155A CN110904155A (en) 2020-03-24
CN110904155B true CN110904155B (en) 2023-04-25

Family

ID=69818609

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911182893.5A Active CN110904155B (en) 2019-11-27 2019-11-27 Base editor and preparation method and application thereof

Country Status (1)

Country Link
CN (1) CN110904155B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111518838A (en) * 2020-05-01 2020-08-11 山东瑞辑通慧生物技术有限公司 Primer and kit for editing single-base gene of eukaryotic cell, use method and application
CN113774087A (en) * 2021-09-24 2021-12-10 佛山科学技术学院 Method for constructing dwarfism syndrome animal model
CN114561429A (en) * 2022-03-22 2022-05-31 绍兴市妇幼保健院 Treatment method for inhibiting HBV surface antigen based on base editing ATG initiation codon
CN114561392A (en) * 2022-03-22 2022-05-31 绍兴市妇幼保健院 Method for removing HBV e antigen by closing target gene based on base editing technology

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
Adenine base-editing-mediated exon skipping induces gene;Xiang-xing Zhu等;《Biotechnol Lett》;20220108;第44卷;59-76 *
CRISPR/Cas9-Mediated Generation of Guangxi Bama Minipigs Harboring Three Mutations in α-Synuclein Causing Parkinson’s Disease;Xiang-Xing Zhu等;《Scientific Reports》;20180820;第8卷;1-11 *
Precise AT to GC Base Editing in the Rice Genome;Kai Hua等;《Molecular Plant》;20180430;第11卷;627-630 *
Simplified adenine base editors improve adenine base editing efficiency in rice;Kai Hua等;《Plant Biotechnology Journal》;20190919;第18卷(第3期);1-9 *

Also Published As

Publication number Publication date
CN110904155A (en) 2020-03-24

Similar Documents

Publication Publication Date Title
CN110904155B (en) Base editor and preparation method and application thereof
CN107922953B (en) Nuclease for improving gene editing efficiency
CN106520830B (en) method for targeted editing of mitochondrial genome by using CRISPR/Cas9
US20240156919A1 (en) Dystrophin gene exon deletion using engineered nucleases
US11779657B2 (en) Compositions and methods for mitochondrial genome editing
KR102387830B1 (en) Stable and minimal side effects for genome editing complex and nucleic acid encoding the same
CN1774500B (en) An expression cassette and vector for transient or stable expression of exogenous molecules
CN111850034B (en) Gene editing carrier and method
CA2587092A1 (en) A method of expressing small peptides using cereal non-storage proteins as fusion carrier in endosperm and the use thereof
CN106834394B (en) Preparation method of glutamine dipeptide
CN112592900B (en) Method for constructing oncolytic adeno-associated virus oAAVs expressing pyroprotein and application thereof
CN110184260B (en) Optimized heat-resistant leucine aminopeptidase Thelap as well as coding gene and application thereof
CN109652394B (en) Optimized high-temperature acidic trem 1 and coding gene and application thereof
CN112138152A (en) AAV vector-based coronavirus infection universal gene therapy medicine and preparation method thereof
CN114634923B (en) Adenosine deaminase, base editor fusion protein, base editor system and use
US6280937B1 (en) Shuttle vectors
CN110218737B (en) Recombinant vector for improving antigen binding capacity of yeast cell surface display Fab fragment by using endoplasmic reticulum retention signal peptide
CN114457098B (en) Multi-gene vector system and application thereof
CN108004198B (en) Method for establishing high-throughput drug screening model based on ICAM-1 signal channel
CN109182379A (en) It is a kind of with reducing triglycerides and the stem cell of cholesterol effect and its preparation method and application simultaneously
CN109943563A (en) The method that the rabies virus gene group of CRISPR-Cas9 System-mediated knocks out
CN107090473A (en) Antibacterial peptide PR39 and PG1 coexpression vector and turn PR39 and PG1 DNA murine preparation methods
CN112410375B (en) Adenovirus vector AdC68XY, virus packaged by adenovirus vector AdC68XY and application of adenovirus vector AdC68XY
CN113652439A (en) Nannochloropsis oculata genetic transformation system, gene for synthesizing triglyceride and application
CN113774087A (en) Method for constructing dwarfism syndrome animal model

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CP03 Change of name, title or address
CP03 Change of name, title or address

Address after: 528000 No. 18, Jiangwan Road, Chancheng District, Guangdong, Foshan

Patentee after: Foshan University

Country or region after: China

Address before: 528000 No. 18, Jiangwan Road, Chancheng District, Guangdong, Foshan

Patentee before: FOSHAN University

Country or region before: China