CN114075593A

CN114075593A - Probe, kit, detection method and application for detecting human RET gene exon 12

Info

Publication number: CN114075593A
Application number: CN202010831715.7A
Authority: CN
Inventors: 赵丹; 王欢; 彭波
Original assignee: Paide Luoge Tianjin Biotechnology Co ltd
Current assignee: Paide Luoge Tianjin Biotechnology Co ltd
Priority date: 2020-08-18
Filing date: 2020-08-18
Publication date: 2022-02-22
Anticipated expiration: 2040-08-18
Also published as: CN114075593B

Abstract

The invention provides a probe kit for detecting human RET gene exon 12, a detection method and application. The probe includes three regions: (1) a 5 'end homologous region which is combined with the 5' end sequence of the target gene in a complementary way; (2) a 3 'end homologous region which is complementarily combined with the 3' end sequence of the target gene; (3) a circularization region complementarily binding to the fluorescent probe, the circularization region being located between the 5 'end homologous region and the 3' end homologous region; wherein, the number of the basic groups in the 3' homologous region is 20-24nt, and the GC content is 47.8-55%; the number of the basic groups in the 5' homologous region is 12-15nt, and the GC content is 60-75%; the Tm value of the 3 ' homologous region is-3-15 ℃ higher than that of the 5 ' homologous region, and the Tm value of the 5 ' terminal homologous sequence is more than 45 ℃. The probe is adopted to carry out in-situ detection, and the positioning and copy number of the human RET gene in the cell nucleus in a cell or clinical tissue sample can be directly observed by naked eyes.

Description

Probe, kit, detection method and application for detecting human RET gene exon 12

Technical Field

The invention relates to the technical field of molecular biology and oncology, in particular to a probe, a kit, a detection method and application for detecting human RET gene exon 12.

Background

In recent years, with the rapid progress of molecular pathological diagnosis. The diagnosis and treatment of malignant tumors are obviously advanced. The occurrence and development of malignant tumors are often caused by the inactivation of cancer suppressor genes and the activation of proto-oncogenes. The RET (full name: RET proto-oncogene) gene is a protooncogene, which is located on the long arm of chromosome 10 and has a full length of 80kb (containing 21 exons), and it encodes a protein whose expression is known to be a driving factor in many malignant tumors. The RET gene has a variety of variations within cancer cells, from point mutations to amplification to rearrangement. It was found that expression of the fusion gene after RET rearrangement could be detected in 12% of thyroid cancers.

The traditional detection method needs to extract RNA from tumor tissues, carry out reverse transcription, and then carry out PCR product sequencing or second-generation high-throughput sequencing so as to determine whether the exon 12 of the RET gene is fused with other genes. And in-situ detection (in-situ detection refers to detection by keeping the natural state of DNA in a cell nucleus) is adopted, and if a method for positioning in the cell nucleus is adopted, the detection is simpler, more convenient and easier to observe. The conventional FISH technology is adopted as a method for positioning genes in cell nucleus, but the FISH technology can only position large-fragment DNA (usually hundreds of kb), and the exon 12 of the human RET gene only consists of 148bp DNA, so that the conventional FISH technology cannot be used for positioning at all. No methods for mapping the 12 th exon nuclei of the human RET gene have been reported.

Disclosure of Invention

In view of the above, the present invention is directed to a probe, a kit, a detection method and an application for detecting the exon 12 of the human RET gene, so as to conveniently detect whether the exon 12 of the RET gene in a cell sample is fused with other genes, thereby diagnosing cancer prognosis and targeting drugs.

The invention provides a probe for detecting the exon 12 of the human RET gene in a first aspect, which comprises three regions: (1) a 5 'end homologous region which is combined with the 5' end sequence of the target gene in a complementary way; (2) a 3 'end homologous region which is complementarily combined with the 3' end sequence of the target gene; (3) a circularization region complementarily binding to the fluorescent probe, the circularization region being located between the 5 'end homologous region and the 3' end homologous region; wherein, the number of the basic groups of the 3' homologous region is 20-24nt, and the GC content is 47.8-55%; the number of the basic groups of the 5' homologous region is 12-15nt, and the GC content is 60-75%; the Tm value of the 3 ' homologous region is-3-15 ℃ higher than that of the 5 ' homologous region, and the Tm value of the 5 ' end homologous sequence is more than 45 ℃.

It should be noted that, here, the "target gene" refers to exon 12 of human RET gene, and its nucleotide sequence is shown in SEQ ID No. 5: 5'-gaggatccaaagtgggaattccctcggaagaacttggttcttggaaaaactctaggagaaggcgaatttggaaaagtggtcaaggcaacggccttccatctgaaaggcagagcagggtacaccacggtggccgtgaagatgctgaaag-3' are provided.

The probe for detecting exon 12 of human RET gene is linear single-stranded DNA, and the composition of the probe can be expressed as 5 'end homologous region-cyclization region-3' end homologous region, wherein "-" can be expressed as direct connection (through phosphodiester bond) and/or connection through a linker (for example, several continuous bases).

When the probe is bound to the single-stranded DNA of the target gene, wherein the 5 '-terminal homologous region and the 3' -terminal homologous region are simultaneously folded toward the circularization region and are respectively bound to the target DNA, the probe forms an incompletely closed circular single-stranded DNA since the phosphodiester bond between the 5 '-terminal homologous region and the 3' -terminal homologous region is not connected.

The Tm value is a temperature at which 1/2 indicating that the ultraviolet absorption value of the double helix structure of DNA reaches its maximum value during thermal denaturation. The Tm value of the probe is in direct correlation with the number of bases and GC content, and is also related to the salt ion concentration. In the present invention, the Tm value is measured under the conditions that the probe concentration is 100. mu.M and the salt ion concentration is 50 nM.

Illustratively, the number of bases of the 3' homologous region may be 20nt, 21nt, 22nt, 23nt, 24nt, preferably 22 nt. The GC content of the 3' homologous region can be 47.8%, 52.4%, 50%, 55%, preferably 50%.

Illustratively, the number of bases in the 5' homologous region may be 12nt, 13nt, 14nt, 15nt, preferably 13 nt. The GC content of the 5' homologous region can be 60%, 64.3%, 69.2%, 75%, preferably 69.2%.

Illustratively, the Tm value of the 3 'homology region is higher than the Tm value of the 5' homology region by-3 ℃, -2 ℃, -1 ℃, 2 ℃, 3 ℃, 4 ℃, 4.5 ℃,5 ℃, 5.5 ℃, 6 ℃, 6.5 ℃, 7 ℃, 7.5 ℃, 8 ℃, 8.5 ℃,9 ℃, 9.2 ℃, 9.5 ℃, 10 ℃, 10.3 ℃, 10.5 ℃, 11 ℃, 11.5 ℃, 12 ℃, 12.5 ℃, 13 ℃, 14 ℃ or 15 ℃.

Further, based on the technical scheme provided by the invention, the probe identifies the exposed DNA sequence of the target gene after being treated by II-type endonuclease (preferably Rsal enzyme, Hpyl8I enzyme, MslI enzyme or AleI enzyme) and Exonuclease (preferably Lambda Exonuclease).

Preferably, the Rsal enzyme, Hpyl8I enzyme, MslI enzyme or AleI enzyme are all endonucleases of class II, capable of recognizing palindromic sequences in exon 12 of the human RET gene. Wherein, the palindromic sequence recognized by the Rsal enzyme is as follows: gtac; the palindromic sequence recognized by the Hpyl8I enzyme is: gtnnac; the palindromic sequence recognized by the MslI enzyme is: caynnnrtg (SEQ ID NO. 12); the palindromic sequence recognized by the AleI enzyme is as follows: cacnnnggtg (SEQ ID NO. 13). More preferably the Rsal enzyme.

The invention selects specific Rsal enzyme, Hpyl8I enzyme, MslI enzyme or AleI enzyme from a plurality of II endonucleases according to the nucleotide sequence of the No.12 exon of the human RET gene. After class II endonuclease cuts the exposed blunt end of exon 12 of human RET gene, exonuclease degrades one DNA sequence from the blunt end, and single-stranded DNA sequence combined by the probe is exposed.

Further, on the basis of the technical scheme provided by the invention, the Tm value of the 5 'homologous region is 52-54 ℃, and the Tm value of the 3' homologous region is 62-65 ℃.

Exemplary Tm values of the 5' homologous regions are 52 ℃, 52.3 ℃, 52.5 ℃, 52.8 ℃, 53 ℃, 53.1 ℃, 53.3 ℃, 53.5 ℃, 53.8 ℃ or 54 ℃, preferably 53.1 ℃.

Exemplary Tm values of the 3' homologous regions are 62 ℃, 62.5 ℃, 62.8 ℃, 63 ℃, 63.3 ℃, 63.6 ℃, 64 ℃, 64.2 ℃, 64.5 ℃ or 65 ℃, preferably 63.6 ℃.

Further, on the basis of the technical scheme provided by the invention, the Tm value of the 3 'homologous region is 9-11 ℃ higher than that of the 5' homologous region.

In a preferred embodiment of the present invention, the Tm of the 5 'homologous region is 53.1 ℃, the Tm of the 3' homologous region is 63.6 ℃, and the Tm of the 3 'homologous region is 10.5 ℃ higher than the Tm of the 5' homologous region.

Further, the number of bases of the probe is 80-90 nt; more preferably, the number of bases in the circularized region is 40 to 55 nt.

The number of bases of the whole probe and the number of bases of the cyclization area are controlled, so that the probe is convenient to combine with a target gene and then to be easy to cyclize, the subsequent cyclized probe can be linearly self-copied, and the detection efficiency of the probe is improved.

Further, on the basis of the technical scheme provided by the invention, the method comprises the following steps5' end homologous regionComprises or consists of the following sequence:

1) a nucleotide sequence shown as SEQ ID NO. 1; or the like, or, alternatively,

2) a complementary sequence or a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 1;

3) a nucleotide sequence shown in SEQ ID NO.1, wherein one or more (for example, 1 to 3) bases are added, deleted or replaced, and the nucleotide sequence can be complementarily combined with a target gene; preferably, the homologous sequence is a nucleotide sequence having at least 90% similarity to the nucleotide sequence shown in SEQ ID No. 1.

In one embodiment of the invention, the5' end homologous regionThe nucleotide sequence of (A) is a nucleotide shown in SEQ ID NO. 1: 5'-GGAAGGCCGTTGC-3' are provided.

In one embodiment of the invention, the nucleotide sequence of the 5' end homology region is the complementary sequence of the nucleotide sequence shown in SEQ ID NO. 1. The complementary sequence is a nucleotide sequence capable of hybridizing with the nucleotide sequence of SEQ ID NO.1 under stringent conditions. Illustratively, the "stringent conditions" refer to conditions under which a probe will hybridize to a detectable degree to its target sequence over to other sequences (e.g., at least 2 times background). Stringent conditions are sequence dependent and will vary from one environment to another. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified that are 100% complementary to the probe.

In one embodiment of the invention, the nucleotide sequence of the 5' end homology region is a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 1. The homologous sequence includes, but is not limited to, a nucleotide sequence having about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% similarity to the nucleotide sequence shown in SEQ ID NO. 1.

In one embodiment of the invention, the nucleotide sequence of the 5' end homology region is a nucleotide sequence with one or more (e.g., 1-3) additions, deletions or substitutions of the nucleotide sequence shown in SEQ ID NO. 1. Illustratively, since the circularization region does not bind to the target gene, addition of 1, 2, 3 (or more) bases to the 5 'end of the homology region near the end of the circularization region that binds (or does not bind) to the target gene, or deletion of 1, 2, 3 bases, or substitution of 1, 2, 3 bases hardly affects the binding of the 5' end homology region to the target gene.

Further, on the basis of the technical scheme provided by the invention, the method comprises the following steps3' end homologous regionComprises or consists of the following sequence:

1) a nucleotide sequence shown as SEQ ID NO. 2; or the like, or, alternatively,

2) a complementary sequence or a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 2;

3) the nucleotide sequence shown in SEQ ID NO.2 is added, deleted, replaced by one or more (for example, 1 to 5) bases and can be combined with a target gene in a complementary way; preferably, the homologous sequence is a nucleotide sequence having at least 90% similarity to the nucleotide sequence shown in SEQ ID NO.2

In one embodiment of the present invention, the nucleotide sequence of the 3' end homology region is the nucleotide shown in SEQ ID NO. 2: 5'-ACCCTGCTCTGCCTTTCAGAT-3' are provided.

In one embodiment of the invention, the nucleotide sequence of the 3' end homology region is a complementary sequence of the nucleotide sequence shown in SEQ ID NO. 2. The complementary sequence is a nucleotide sequence capable of hybridizing with the nucleotide sequence of SEQ ID NO.2 under stringent conditions.

In one embodiment of the invention, the nucleotide sequence of the 3' end homology region is a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 2. The homologous sequence includes, but is not limited to, a nucleotide sequence having about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% similarity to the nucleotide sequence shown in SEQ ID NO. 2.

In one embodiment of the present invention, the nucleotide sequence of the 3' end homology region is a nucleotide sequence with one or more (e.g., 1-5) additions, deletions, or substitutions of the nucleotide sequence shown in SEQ ID NO. 2. Illustratively, since the circularization region does not bind to the target gene, adding 1, 2, 3, 4, 5 (or more) bases to the end of the 3 'terminal homology region near the circularization region that binds (or does not bind) to the target gene, or deleting 1, 2, 3, 4, 5 bases, or replacing 1, 2, 3, 4, 5 bases hardly affects the binding of the 3' terminal homology region to the target gene.

Further, on the basis of the technical scheme provided by the invention, the nucleotide sequence of the probe comprises or consists of the following sequences:

1) a nucleotide sequence shown as SEQ ID NO. 3; or the like, or, alternatively,

2) a complementary sequence or a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 3;

3) a nucleotide sequence in which one or more (for example, 1 to 10) bases are added, deleted, or substituted in the nucleotide sequence shown in SEQ ID NO. 3; preferably, the homologous sequence is a nucleotide sequence having at least 70% similarity to the nucleotide sequence shown in SEQ ID No. 3.

In one embodiment of the present invention, the nucleotide sequence of the probe is the nucleotide represented by SEQ ID No. 3: 5' -GGAAGGCCGTTGCCTGCGAATAGCCATCCACTCCATTCTTCTGCGAATAGCCATCCACTCCAT

-3'. Wherein, near the 5' endThe nucleotide sequence of the underline part is a 5 ' homologous region, the nucleotide sequence of the underline wavy line part close to the 3 ' end is a 3 ' homologous region, and the middle part is a cyclization region.

Since the circularization region is not bound to the gene of interest and functions to color the probe by binding to a fluorescent probe, the sequence of the circularization region is arbitrarily variable, and the circularization sequence shown in sequence SEQ ID NO.3 is only exemplary and not limiting.

In one embodiment of the present invention, the nucleotide sequence of the probe is a complementary sequence of the nucleotide sequence shown in SEQ ID NO. 3. The complementary sequence is a nucleotide sequence capable of hybridizing with the nucleotide sequence of SEQ ID NO.3 under stringent conditions.

In one embodiment of the present invention, the nucleotide sequence of the probe is a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 3. The homologous sequence includes, but is not limited to, a nucleotide sequence having about 70%, 72%, 75%, 78%, 80%, 82%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99% similarity to the nucleotide sequence shown in SEQ ID NO. 3.

In one embodiment of the present invention, the nucleotide sequence of the probe is a nucleotide sequence obtained by adding, deleting, or replacing one or more (e.g., 1 to 10, preferably 1 to 5, and more preferably 1 to 3) nucleotide sequences of the nucleotide sequence shown in SEQ ID NO. 3. Illustratively, addition of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more bases to the circularized region, or deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 bases, or substitution of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 bases does not affect the binding affinity of the probe to the gene of interest.

Further, the nucleotide sequence of the fluorescent probe bound to the probe comprises or consists of:

1) a nucleotide sequence shown as SEQ ID NO. 4; or the like, or, alternatively,

2) a complementary sequence or a homologous sequence of the nucleotide sequence shown in SEQ ID NO. 4;

3) a nucleotide sequence shown in SEQ ID NO.4, in which one or more (for example, 1 to 10) bases are added, deleted, or substituted, and which is capable of binding to the probe in a complementary manner.

In one embodiment of the present invention, the nucleotide sequence of the fluorescent probe is the nucleotide shown in SEQ ID No. 4: 5'-CTGCGAATAGCCATCCACTCCAT-3' are provided.

In one embodiment of the invention, the nucleotide sequence of the fluorescent probe is a complementary sequence of the nucleotide sequence shown in SEQ ID No. 4. The complementary sequence is a nucleotide sequence capable of hybridizing with the nucleotide sequence of SEQ ID NO.4 under stringent conditions.

In one embodiment of the invention, the nucleotide sequence of the fluorescent probe is a homologous sequence of the nucleotide sequence shown in SEQ ID No. 4. The homologous sequence includes, but is not limited to, a nucleotide sequence having about 70%, 72%, 75%, 78%, 80%, 82%, 85%, 88%, 90%, 93%, 95%, 96%, 97%, 98%, 99% similarity to the nucleotide sequence shown in SEQ ID NO. 4.

In one embodiment of the invention, the nucleotide sequence of the fluorescent probe is a nucleotide sequence which is added, deleted, substituted for one or more (e.g., 1-10) nucleotide sequences shown in SEQ ID NO.4 and is capable of complementarily binding to the probe. Illustratively, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more bases are added, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 bases are deleted, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 bases are substituted, as long as they are capable of binding complementarily to the probe.

The nucleotide sequence of the fluorescent probe of 1) or 2) or 3) is connected with a fluorescent label. Fluorescent labels include, but are not limited to Cy3, Cy5, 6-FAM, 6-TET, 5-FITC, 6-TRITC, 5-TAMRA, 6-TAMRA, AMC.

Comparing the nucleotide sequence shown in the fluorescent probe SEQ ID NO.4 with the nucleotide sequence shown in the probe SEQ ID NO.3 for detecting the exon 12 of the human RET gene, the probe in the latter is found to be formed by connecting two repeated sequences in series, the repeated sequences are the same as the sequence of the fluorescent probe, and a complementary sequence exists between the repeated sequences. Therefore, one copied probe sequence can be combined with two fluorescent probes, so that the fluorescent signal amount is obviously increased, and the fluorescent signals can be conveniently and clearly observed in time. And the two repeated sequences are connected by a supplementary sequence consisting of a plurality of basic groups, so that the two repeated sequences are separated, and the space distance of the two repeated sequences is increased, therefore, when the two repeated sequences are combined with the fluorescent probe, the situation that the combination of the two repeated sequences and the fluorescent probe is influenced because the fluorescent group connected with the fluorescent probe is larger can be avoided, and the combination efficiency of the fluorescent probe and the two repeated sequences is improved.

In a second aspect, the invention provides a reagent and/or a kit for in situ detection of exon 12 of human RET gene, comprising the probe for detecting exon 12 of human RET gene.

Further, the kit further comprises: a cell permeation treatment system, a blunt end treatment system, a target nucleotide exposure treatment system, a probe locking treatment system, a signal amplification treatment system, a signal detection treatment system, and optionally a cleaning treatment system.

Cell permeation treatment system

The transparent treatment system comprises: proteinase K (concentration 5 mg/mL-30 mg/mL), Tris-HCl buffer, EDTA, SDS. The function of the cell membrane permeation reagent is to permeate cell membrane and nuclear membrane, so that the reaction reagent can fully enter cell nucleus for reaction.

Blunt end treatment system

The blunt end processing system comprises: rsal endonuclease (Hpyl 8I enzyme, MslI enzyme or AleI enzyme may be substituted), CutSmart buffer, and nuclease-free ultrapure water. The function of the probe is to cut the palindromic DNA of the genome near the target point of the genomic DNA bound by the probe sequence, so that the blunt end is exposed.

Target nucleotide exposure treatment system

The nucleotide exposure treatment system of interest comprises: lambda Exonuclease, Exonuclease buffer and nuclease-free ultrapure water. The function is to degrade the single-stranded DNA from the blunt end along the 5 '-3' direction, so that the target genomic single-stranded DNA bound by the probe is exposed.

Probe lock processing bodyIs a system

The probe locking treatment system comprises the probe, DNA Ligase buffer, ATP and ultrapure water without nuclease. The function of the probe is to combine with the target single-stranded DNA and cyclize at the combining site under the action of ligase to form closed circular single-stranded DNA.

Signal amplification processing system

The signal amplification processing system comprises: DNA polymerase, DNA polymerase buffer, dNTPs, DTT and nuclease-free ultrapure water. The action is that closed circular single-stranded DNA is linearly self-replicated under the action of DNA polymerase to generate a large amount of single-stranded circular probe DNA containing repetitive sequences.

Signal detection processing system

The signal detection processing system comprises: fluorescent probes, formamide, sodium chloride, sodium citrate, salmon sperm DNA and nuclease-free ultrapure water. The fluorescent probe is combined with the single-stranded circular probe containing the repetitive sequence, and the positioning of the probe in a cell nucleus can be shown.

Cleaning treatment system

The cleaning treatment system specifically comprises: Tris-HCl, NaCl, Tween20 and nuclease-free ultrapure water. The function of the cleaning agent is to clean the reaction liquid after the reaction in each step.

In a third aspect, the invention provides a method for in situ detection of the exon 12 of the human RET gene, wherein the probe or the kit is used for intracellular localization of the exon 12 of the RET gene.

Further, on the basis of the technical scheme provided by the invention, the method comprises the following steps:

(a) fixing the cell sample to be detected, treating by using a permeable treatment system, and optionally cleaning;

(b) treating the sample treated in step (a) with a blunt end treatment system to expose the blunt ends, optionally washing;

(c) treating the sample treated in the step (b) with a target nucleic acid exposure treatment system, degrading the single-stranded DNA in the 5 '-3' direction from the blunt end, retaining the other single-stranded DNA, and optionally washing;

(d) treating the sample treated in the step (c) by using a probe locking treatment system, wherein the probe is combined with the target single-stranded DNA and the cyclization is carried out simultaneously, and optionally washing and drying;

(e) treating the sample treated in the step (d) by using a signal amplification treatment system, and performing self-replication on the circularized probe to generate a large amount of single-stranded circular probe DNA containing a repetitive sequence, and optionally cleaning;

(f) adopting a signal detection processing system for the sample processed in the step (e), combining a fluorescent probe on a single-chain annular probe containing a repetitive sequence, and optionally washing and drying;

(g) mounting and fluorescent color development observation.

Referring to the working schematic diagram shown in fig. 1, the working principle of the method for in situ detection of exon 12 of human RET gene is as follows: the nuclear membrane of the cell is firstly perforated by proteinase K, and then the genome DNA is cut near the genome DNA target point combined with the probe sequence by the type II restriction enzyme, so that the blunt end is exposed. Then, under the action of exonuclease, one strand at the 5 '-3' end in the double-stranded DNA is degraded from the blunt end, and the target genomic single-stranded DNA combined with the probe is exposed. Finally, the probe is cyclized at the binding site under the action of ligase to form closed circular single-stranded DNA; under the action of DNA polymerase, the closed circular single-stranded DNA is subjected to linear self-replication, a large number of DNA repetitive sequences which are not contained in human genes are generated in the sequence, and a specific fluorescent probe is combined with the repetitive sequences to show the positioning of the probe in a cell nucleus, so that the positioning of the RET gene No.12 exon in the cell nucleus is detected.

In a third aspect, the invention provides the use of the probe, or the reagent and/or kit, or the method for identifying in the nucleus of a cell the location of exon 12 of the human RET gene, and/or the fusion of exon 12 of the human RET gene with other genes.

The RET gene is ectopic in many tumor cells, resulting in gene fusion, and expression of fusion proteins that do not exist in the human body, resulting in malignant proliferation of cancer cells and cancer progression. For example: exon 1 of the CCDC6 gene and exon 12 of the RET gene, which are located in the long arm of chromosome 10 as shown by the sequencing results of the human genome, differ by 17,925,554bp, 17.9mb, 17925kb, and thus their spatial localization within the nucleus is divergent, but in some thyroid and lung cancers, these two genes are ectopic, resulting in the expression of a fusion protein in which exon 1 of the CCDC6 gene and exon 12 of the RET gene encode amino acids spliced together, where their spatial localization within the nucleus is close together, distinct from their localization within normal cells. Therefore, the probe provided by the invention is applied to in-situ detection of the exon 12 of the human RET gene, and is matched with in-situ detection of the exon 1 of the CCDC6 gene, so that whether the two genes are fused or not can be visually observed according to the in-situ detection result, and the diagnosis and prediction of cancer prognosis, targeted medication and the like can be realized.

Based on in-situ detection of the exon 12 of the human RET gene, the method is matched with other detection methods which are possibly subjected to gene fusion with the human RET gene, and a machine is not required to convert digital signals, so that the operation is simpler, and the result is more accurate and reliable.

The invention adopts the technical scheme and has the following beneficial effects:

1. the probe for detecting the RET gene exon 12 provided by the invention is combined with an in-situ detection method, and a target signal is amplified through a specific probe, so that the positioning and copy number of the RET gene exon 12 in a cell nucleus in a cell or clinical tissue sample can be directly observed by naked eyes.

2. The probe or the kit for detecting the exon 12 of the human RET gene in situ can be used for detecting the nuclear localization mutation of the exon 12 of the human RET gene in all solid tumors, can be used for detecting a small amount of cells or clinical tissue samples, and has the advantage of wide applicability.

3. The method for detecting the exon 12 of the human RET gene in situ does not need nucleic acid extraction, does not need a machine for converting digital signals, and has the advantages of low cost, high sensitivity, good specificity and simpler operation.

Drawings

FIG. 1 is a schematic diagram showing the operation of the method for detecting the nuclear localization of the exon 12 of human RET gene of the present invention.

FIG. 2 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 1.

FIG. 3 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 2.

FIG. 4 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 3.

FIG. 5 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 4.

FIG. 6 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 5.

FIG. 7 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 6.

FIG. 8 is a graph showing the results of detecting nuclear localization of human RET gene 12 exon in KTC cells using the probe of example 7.

FIG. 9 is a graph showing the results of nuclear localization of the exon 12 of the human RET gene in KTC and TPC-1 cells in example 11, with KTC cells on the left and TPC-1 cells on the right.

FIG. 10 is a graph showing the results of nuclear localization of the exon 12 of human RET gene in paraffin sections of KTC and TPC-1 in example 12, with KTC cells on the left and TPC-1 cells on the right.

FIG. 11 is a graph showing the results of the experiment for detecting nuclear localization of human RET gene 12 exon in KTC cells in example 13.

Detailed Description

Unless defined otherwise, all scientific and technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains.

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

The invention is described in detail below with reference to specific examples, which are intended to be illustrative, but not limiting, of the invention.

Formulation of 1 × CutSmart buffer: 50mM/L potassium acetate, 20mM/L Tri-acetate, 10mM/L magnesium acetate, 0.1mg/mL BSA.

1 XExonuclease buffer: 50mM/L potassium acetate, 20mM/L Tri-acetate, 10mM/L magnesium acetate, 0.1mg/mL BSA.

1 XDNA Ligase buffer formulation: 40mM/L Tris-HCl, 10mM/L magnesium chloride, 10mM/L DTT, 0.5mM/L ATP, 0.05Weiss U/. mu.L DNA.

1 XDNA polymerase buffer: 33mM/L Tris-acetate, 10mM/L magnesium acetate, 66mM/L potassium acetate, 0.1% (v/v) Tween 20.

Example 1

A probe for detecting the exon 12 of the human RET gene has the nucleotide sequence shown in SEQ ID NO.3, wherein the number of the bases in the 5 'homologous region is 13nt, the GC content is 69.23%, the Tm value is 53.1 ℃, the number of the bases in the 3' homologous region is 22nt, the GC content is 50%, and the Tm value is 63.6 ℃.

Example 2

A probe for detecting the exon 12 of the human RET gene has the nucleotide sequence shown in SEQ ID NO.6, wherein the number of the bases in the 5 'homologous region is 15nt, the GC content is 60%, the Tm value is 55.9 ℃, the number of the bases in the 3' homologous region is 15nt, the GC content is 60%, and the Tm value is 53.2 ℃.

Example 3

A probe for detecting the exon 12 of the human RET gene has the nucleotide sequence shown in SEQ ID NO.7, wherein the number of the bases in the 5 'homologous region is 12nt, the GC content is 66.67%, the Tm value is 46.7 ℃, the number of the bases in the 3' homologous region is 18nt, the GC content is 55.56%, and the Tm value is 60.7 ℃.

Example 4

A probe for detecting the exon 12 of the human RET gene has the nucleotide sequence shown in SEQ ID NO.8, wherein the number of the bases in the 5 'homologous region is 14nt, the GC content is 57.14 percent, the Tm value is 51.2 ℃, the number of the bases in the 3' homologous region is 18nt, the GC content is 55.56 percent, and the Tm value is 60.7 ℃.

Example 5

A probe for detecting the 12 th exon of the human RET gene has the nucleotide sequence shown in SEQ ID NO.9, wherein the number of the bases in the 5 'homologous region is 18nt, the GC content is 50%, the Tm value is 60.4 ℃, the number of the bases in the 3' homologous region is 14nt, the GC content is 64.29%, and the Tm value is 48.8 ℃.

Example 6

A probe for detecting the 12 th exon of human RET gene has the nucleotide sequence shown in SEQ ID NO.10, wherein the number of the bases in the 5' homologous region is 12nt, the GC content is 58.33%, and the Tm value is 46.9 ℃; the number of bases in the 3' homologous region was 21nt, GC content was 52.38%, and Tm was 63.6 ℃.

Example 7

A probe for detecting the exon 12 of the human RET gene has a nucleotide sequence shown in SEQ ID NO.11, and is different from the probe in the embodiment 1 in that the nucleotide sequence of a cyclization region is different, only one repetitive sequence is provided, and only one fluorescent probe is combined.

Example 8

A kit for in situ detection of exon 12 of human RET gene comprises the following components:

(1) cell permeation treatment system: 20mg/mL protease K, Tris-HCl buffer, EDTA, SDS;

(2) blunt end treatment system: 0.5U/. mu.L of Rsal endonuclease, 1 XCutSmart buffer and nuclease-free ultrapure water;

(3) target nucleotide exposure treatment system: 0.4U/. mu.L of Lambda Exonuclease, 1 XExonuclease buffer and nuclease-free ultrapure water;

(4) a probe locking treatment system: final concentration 100. mu.M/L of specific probe, 0.05Weiss U/. mu.L of DNA Ligase, 1 XDNA Ligase buffer, 0.5mM/L of ATP and nuclease-free ultrapure water;

(5) signal amplification processing system: final concentrations of 1U/. mu.L DNA polymerase, 1 XDNA polymerase buffer, 2.5mM/L dNTPs, 1mM/L DTT and nuclease-free ultrapure water;

(6) and a signal detection processing system: fluorescent probes (nucleotide sequence is shown as SEQ ID NO.4, 5' is connected with cy3 fluorescent label), 20% (v/v) formamide, 0.3M/L sodium chloride, 0.03M/L sodium citrate, 0.5 mu g/mu L salmon sperm DNA and nuclease-free ultrapure water.

(7) Washing solution treatment system: 0.1M/L Tris-HCl, 0.15M/L NaCl, 0.05% (v/v) Tween20 and nuclease-free ultrapure water.

Example 9

A method for nuclear localization of the exon 12 of human RET gene using the kit of example 8, comprising the steps of:

(1) after the cell sample to be detected is fixed, the cells are treated by using a permeable treatment system. After in vitro cells are fixed, processing for 3-4 minutes at 37 ℃; treating the clinical tissue sample at 37 ℃ for 15-20 minutes; after the completion, the liquid is discarded, the mixture is put into ultrapure water, and finally dehydrated and dried by 70 percent, 85 percent and 100 percent ethanol aqueous solution in sequence.

(2) Treating the sample treated in the step (1) by adopting a blunt end treatment system, and treating at 37 ℃ for 1 hour to expose the blunt end of the genomic DNA; after completion, the liquid is discarded, the liquid is cleaned by a cleaning treatment system, and then the cleaning liquid is discarded.

(3) Treating the sample treated in the step (2) by using a target nucleic acid exposure treatment system, treating at 37 ℃ for 0.5 hour, degrading single-stranded DNA from the flat end along the 5 '-3' direction, and reserving the other single-stranded DNA; after completion, the liquid is discarded, the liquid is cleaned by a cleaning treatment system, and then the cleaning liquid is discarded.

(4) Treating the sample treated in the step (3) by adopting a probe locking treatment system, treating for 0.5 hour at 37 ℃, and simultaneously performing probe combination on the target single-stranded DNA and cyclization; and (3) after the completion, removing the liquid, cleaning by using a cleaning treatment system, removing the cleaning liquid, and finally dehydrating and airing by using 70%, 85% and 100% ethanol aqueous solution in sequence.

(5) And (3) treating the sample treated in the step (4) by using a signal amplification treatment system, treating the sample at 44 ℃ for 1 hour, and performing self-replication on the circular probe DNA by using a single-stranded genomic DNA binding position as an origin under the action of polymerase to generate single-stranded DNA containing a large number of repetitive sequences. After completion, the liquid is discarded, the liquid is cleaned by a cleaning treatment system, and then the cleaning liquid is discarded.

(6) And (3) treating the sample treated in the step (5) for 10 minutes at 37 ℃ by adopting a signal detection treatment system, and binding the fluorescent probe on the single-stranded DNA containing the repetitive sequence. And (3) after the completion, removing the liquid, cleaning by using a cleaning treatment system, removing the cleaning liquid, and finally dehydrating and airing by using 70%, 85% and 100% ethanol aqueous solution in sequence.

(7) And (4) adding a sealing agent containing DAPI into the sample treated in the step (6) and sealing.

(8) The recorded results were finally observed under a fluorescence microscope.

Example 10Different probesLocation of human RET Gene exon 12 in KTC cells

The kit of example 8 was used (binding probes were eachExample 1 to example 7Provided) and the method of reference example 9 were performed on exon 12 of human RET gene in KTC cells for nuclear localization experiments.

The experimental results are shown in FIGS. 2-8. The experimental results were determined by the ratio of the number of signal spots in the nuclei to the number of nuclei, with the closer the ratio is to 2 the better the experimental results. The number of signal points versus nuclei and ratios in FIGS. 2-8 are shown in Table 1 below:

TABLE 1

As can be seen from the experimental results of FIGS. 2 to 8 and Table 1, the probe provided in example 1 has the best effect on nuclear localization. The probe provided in example 7 showed a weaker signal per reaction time (1hr) than the probe of example 1.

Example 11KTC and TPC-1 in vitro cell linesNuclear localization of the 12 exon of the middle human RET gene

The following experiment was carried out using the kit of example 8 (binding probes provided for example 1) and the method of reference example 9:

thyroid cancer cell lines, KTC and TPC-1 cell lines, were obtained from ATCC in the USA. Respectively inoculating two kinds of cells on a diagnosis glass slide, fixing the cells for 10 minutes by using 4% PFA after the cells adhere to the wall, then treating the cells in ultrapure water for 3 minutes, taking out the sample, airing the sample, dropwise adding 20 mu L of transparent treatment system reaction liquid, treating the sample in a wet box at 37 ℃ for 3 minutes, and putting the sample into a cleaning treatment system to clean the sample once; adding 15 mu L of blunt end treatment reaction liquid, treating for 1 hour at 37 ℃ in a wet box, and putting into a cleaning treatment system for cleaning once; adding 15 mu L of target nucleic acid exposure treatment system reaction liquid, treating for 0.5 hour at 37 ℃ in a wet box, and putting into a cleaning treatment system for cleaning once; adding 15 mu L of reaction solution of a probe locking treatment system, treating for 0.5 hour at 37 ℃ in a wet box, putting the wet box into a cleaning treatment system for cleaning once, and performing gradient treatment on ethanol for dehydration; after air drying, adding 15 mu L of signal amplification treatment reaction liquid, treating for 1 hour at 44 ℃ in a wet box, and putting into a cleaning treatment system for cleaning once; adding 15 μ L of reaction solution of the signal detection processing system, processing in a wet box at 37 deg.C in dark for 15 min, washing once in the washing processing system, and performing gradient treatment with ethanol for dehydration; after drying, adding a proper amount of tabletting agent, and sealing; and (5) observing the result under a fluorescence microscope.

As can be seen in fig. 9, the white is the nucleus, with the gray fluorescent spots as positive results (showing the localization of exon 12 of the RET gene within the nucleus). Among these, in the KTC cell result chart on the left side of fig. 9, there are cases where 1, 2 and 3 copies of exon 12 of RET gene exist in a plurality of nuclei. The TPC-1 cell results on the right side of fig. 9 show the presence of 1, 2, 3 and 4 copies of exon 12 of the RET gene in multiple nuclei. It can be seen that there is an abnormality in exon 12 of RET gene in the KTC and TPC-1 cells, for example, in the case of 3 or 4 copies, it is likely that RET gene is amplified.

Example 12Paraffin tissue section sampleNuclear localization of the 12 exon of the middle human RET gene

after TKC and TPC-1 cells are inoculated on the back of a nude mouse to form a tumor, the tumor is taken out and embedded into a paraffin sample, a paraffin tissue slice is cut into 5 mu m thick, 50 mu L of transparent treatment system reaction liquid is dripped after pretreatment, the mixture is treated for 15 minutes in a wet box at 37 ℃, and the mixture is put into a cleaning treatment system to be cleaned once; adding 50 mu L of reaction liquid of the blunt end processing system, processing for 1 hour at 37 ℃ in a wet box, and putting the mixture into a cleaning processing system for cleaning once; adding 50 mu L of reaction liquid of the target nucleic acid exposure treatment system, treating for 0.5 hour at 37 ℃ in a wet box, and putting into a cleaning treatment system for cleaning once; adding 50 mu L of reaction solution of a probe locking treatment system, treating for 0.5 hour at 37 ℃ in a wet box, putting the wet box into a cleaning treatment system for cleaning once, and performing gradient treatment on ethanol for dehydration; after drying, adding 50 mu L of reaction liquid of a signal amplification processing system, processing for 2 hours at 44 ℃ in a wet box, and putting into a cleaning processing system for cleaning once; adding 50 μ L of reaction solution of the signal detection processing system, processing in a wet box at 37 deg.C in dark for 10 min, washing once in the washing processing system, and performing gradient treatment with ethanol for dehydration; after drying, adding a proper amount of the tablet sealing agent, and sealing the tablet.

As can be seen in fig. 10, the white is the nucleus, with the gray fluorescent spots as positive results (showing the localization of exon 12 of the RET gene within the nucleus). Among them, in the KTC tumor-forming paraffin section result chart on the left side of fig. 10, there are cases where the copy number of 3, 4, 5, 6 or more exons 12 of RET gene is abnormal in a plurality of nuclei. The TPC-1 tumor-forming paraffin section results on the right side of FIG. 10 are also the case where there are a plurality of 3, 4, 5, 6 or more copies of exon 12 of RET gene in abnormal numbers in a plurality of nuclei. It can be seen that there is an abnormal condition that the copy number of RET gene exon 12 in the thyroid cancer cell line KTC and TPC-1 tumorigenic paraffin sections is obviously increased, and it is possible that RET gene exon 12 and other genes are subjected to gene fusion, so that the copy number is increased.

Example 13 nuclear localization of human RET Gene No.12 exon in KTC cells

The kit of example 8 was used (the binding probe wasExample 1Provided), nuclear localization experiments were performed on exon 12 of human RET gene in KTC cells according to the method of example 9.

But in step (4) of the experimental procedure,the binding and circularization of the probe are divided into two stepsThe method comprises the following specific operations:

the first step is as follows: the reaction solution for combining the probes consists of formamide, 2 XSSC, specific probes with the final concentration of 100 mu M/L and ultrapure water without nuclease.

The second step is that: the probe was circularized, and the reaction solution consisted of 1 XDNA Ligase buffer, PEG4000, ATP, 0.05Weiss U/. mu.L Ligase, and nuclease-free ultrapure water.

And (3) after the completion, removing the liquid, cleaning by using a cleaning treatment system, removing the cleaning liquid, and finally dehydrating and airing by using 70%, 85% and 100% ethanol aqueous solution in sequence.

As shown in FIG. 11, no fluorescent signal spot was detected, and the binding and self-circularization of the probe were separated into two steps, with no experimental result.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents and the like that are within the spirit and principle of the present invention are included in the present invention.

Sequence listing

<110> Padelog (Tianjin) Biotech Ltd

<120> probe, kit, detection method and application for detecting human RET gene exon 12

<160> 13

<170> PatentIn version 3.5

<210> 1

<211> 13

<212> DNA

<213> Artificial Sequence

<220>

<223> detection of 5' -terminal homology region of exon-12 probe of human RET Gene

<400> 1

ggaaggccgt tgc 13

<210> 2

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> detection of 3' -terminal homology region of exon-12 probe of human RET Gene

<400> 2

accctgctct gcctttcaga t 21

<210> 3

<211> 84

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 3

ggaaggccgt tgcctgcgaa tagccatcca ctccattctt ctgcgaatag ccatccactc 60

cataccctgc tctgcctttc agat 84

<210> 4

<211> 23

<212> DNA

<213> Artificial Sequence

<220>

<223> fluorescent probe for detecting exon 12 probe of human RET gene by combination

<400> 4

ctgcgaatag ccatccactc cat 23

<210> 5

<211> 148

<212> DNA

<213> exon 12 of human RET Gene

<400> 5

gaggatccaa agtgggaatt ccctcggaag aacttggttc ttggaaaaac tctaggagaa 60

ggcgaatttg gaaaagtggt caaggcaacg gccttccatc tgaaaggcag agcagggtac 120

accacggtgg ccgtgaagat gctgaaag 148

<210> 6

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 6

tcagatggaa ggccgctgcg aatagccatc cactccattc ttctgcgaat agccatccac 60

tccataccct gctctgcctt 80

<210> 7

<211> 80

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 7

gatggaaggc cgctgcgaat agccatccac tccattcttc tgcgaatagc catccactcc 60

ataccctgct ctgcctttca 80

<210> 8

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 8

gatggaaggc cgttctgcga atagccatcc actccattct tctgcgaata gccatccact 60

ccataccctg ctctgccttt ca 82

<210> 9

<211> 81

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 9

tttcagatgg aaggccgtct gcgaatagcc atccactcca ttcttctgcg aatagccatc 60

cactccatac cctgctctgc c 81

<210> 10

<211> 82

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 10

tggaaggccg ttctgcgaat agccatccac tccattcttc tgcgaatagc catccactcc 60

ataccctgct ctgcctttca ga 82

<210> 11

<211> 75

<212> DNA

<213> Artificial Sequence

<220>

<223> Probe for detecting exon 12 of human RET Gene

<400> 11

ggaaggccgt tgcttccttt tacgactgcg aatagccatc cactccattc ttctaccctg 60

ctctgccttt cagat 75

<210> 12

<211> 10

<212> DNA

<213> Unknown

<220>

<223> palindromic sequence recognized by MslI enzyme

<220>

<221> misc_feature

<222> (4)..(7)

<223> n is a, c, g, or t

<400> 12

caynnnnrtg 10

<210> 13

<211> 10

<212> DNA

<213> Unknown

<220>

<223> palindromic sequence recognized by AleI enzyme

<220>

<221> misc_feature

<222> (4)..(7)

<223> n is a, c, g, or t

<400> 13

cacnnnngtg 10

Claims

1. A probe for detecting exon 12 of human RET gene, which is characterized by comprising three regions: (1) a 5 'end homologous region which is combined with the 5' end sequence of the target gene in a complementary way; (2) a 3 'end homologous region which is complementarily combined with the 3' end sequence of the target gene; (3) a circularization region complementarily binding to the fluorescent probe, the circularization region being located between the 5 'end homologous region and the 3' end homologous region;

wherein, the number of the basic groups of the 3' homologous region is 20-24nt, and the GC content is 47.8-55%;

the number of the basic groups of the 5' homologous region is 12-15nt, and the GC content is 60-75%;

the Tm value of the 3 ' homologous region is-3-15 ℃ higher than that of the 5 ' homologous region, and the Tm value of the 5 ' end homologous sequence is more than 45 ℃.

2. The probe according to claim 1, wherein the probe recognizes a DNA sequence exposed by a class II endonuclease (preferably, Rsal enzyme, Hpyl8I enzyme, MslI enzyme, or AleI enzyme) and an Exonuclease (preferably, Lambda Exonuclease) treatment of a target gene.

3. The probe according to claim 1, wherein the Tm value of the 5 'homology region is 52 to 54 ℃ (preferably 53.1 ℃) and the Tm value of the 3' homology region is 62 to 65 ℃ (preferably 63.6 ℃);

preferably, the Tm value of the 3 'homologous region is 9-11 ℃ higher than that of the 5' homologous region;

preferably, the number of bases of the probe is 80 to 90 nt; more preferably, the number of bases in the circularized region is 40 to 55 nt.

4. The probe of claim 1, wherein the nucleotide sequence of the 5' homologous region comprises or consists of:

1) a nucleotide sequence shown as SEQ ID NO. 1; or the like, or, alternatively,

3) a nucleotide sequence shown in SEQ ID NO.1, wherein one or more (for example, 1 to 3) bases are added, deleted or replaced, and the nucleotide sequence can be complementarily combined with a target gene;

preferably, the homologous sequence is a nucleotide sequence having at least 90% similarity to the nucleotide sequence shown in SEQ ID No. 1; and/or

The nucleotide sequence of the 3' end homologous region comprises or consists of the following sequences:

1) a nucleotide sequence shown as SEQ ID NO. 2; or the like, or, alternatively,

3) a nucleotide sequence shown in SEQ ID NO.2, wherein one or more (for example, 1 to 5) bases are added, deleted or replaced, and the nucleotide sequence can be complementarily combined with a target gene;

preferably, the homologous sequence is a nucleotide sequence having at least 90% similarity to the nucleotide sequence shown in SEQ ID No. 2.

5. The probe of claim 1, wherein the nucleotide sequence of the probe comprises or consists of:

1) a nucleotide sequence shown as SEQ ID NO. 3; or the like, or, alternatively,

3) a nucleotide sequence in which one or more (for example, 1 to 10) bases are added, deleted, or substituted in the nucleotide sequence shown in SEQ ID NO. 3;

preferably, the homologous sequence is a nucleotide sequence having at least 70% similarity to the nucleotide sequence shown in SEQ ID No. 3.

6. The probe of claim 5, wherein the nucleotide sequence of the fluorescent probe that binds to the probe comprises or consists of:

1) a nucleotide sequence shown as SEQ ID NO. 4; or the like, or, alternatively,

3) a nucleotide sequence shown in SEQ ID NO.4 with one or more (for example, 1 to 10) bases added, deleted or replaced and capable of being complementarily combined with the probe;

the nucleotide sequence of the fluorescent probe of 1) or 2) or 3) is connected with a fluorescent label.

7. A reagent and/or kit for in situ detection of exon 12 of human RET gene, comprising the probe of any one of claims 1-6;

preferably, the reagent and/or kit further comprises: a cell permeation treatment system, a blunt end treatment system, a target nucleotide exposure treatment system, a probe locking treatment system, a signal amplification treatment system, a signal detection treatment system, and optionally a cleaning treatment system.

8. The reagent and/or kit of claim 7, wherein the permeabilization system comprises a biological enzyme (e.g., proteinase K); and/or the presence of a gas in the gas,

the blunt end treatment system comprises a class II endonuclease (preferably a Rsal enzyme, an Hpyl8I enzyme, an msl enzyme, or an AleI enzyme); and/or the presence of a gas in the gas,

the nucleotide exposure treatment system of interest comprises an Exonuclease (preferably Lambda Exonuclease); and/or the presence of a gas in the gas,

the probe locking treatment system comprises the probe and DNA ligase; and/or the presence of a gas in the gas,

the signal amplification processing system comprises DNA polymerase and dNTPs; and/or the presence of a gas in the gas,

the signal detection processing system comprises a fluorescent probe (complementarily binding to the probe of any one of claims 1 to 6).

9. A method for in situ detection of exon 12 of human RET gene, characterized in that the probe according to any of claims 1-6, or the reagent and/or kit according to claim 7 or 8 is used for intracellular localization of exon 12 of human RET gene;

preferably, the method for detecting exon 12 of human RET gene in situ comprises the following steps:

(g) mounting and fluorescent color development observation.

10. Use of a probe according to any one of claims 1 to 6, or a reagent and/or kit according to claim 7 or 8, or a method according to claim 9 for identifying in the nucleus of a cell the exon 12 of the human RET gene, and/or fusion of the exon 12 of the human RET gene with other genes.