CN114075525A - Genetic engineering strain of streptococcus zooepidemicus and application thereof - Google Patents

Abstract

The invention provides a genetic engineering strain of streptococcus zooepidemicus. The genetic engineering strain carries an exogenous gene expression frame, wherein the exogenous gene expression frame comprises a first gene expression frame and a second gene expression frame, the first gene expression frame comprises a first promoter and a hasA gene, and the first promoter is operably connected with the hasA gene; the second gene expression cassette includes a second promoter and a hasB gene, which are operably linked. According to the genetic engineering strain of the streptococcus zooepidemicus, which is disclosed by the embodiment of the invention, the exogenous hasA gene expression frame and the exogenous hasB gene expression frame are carried, but the exogenous hasC gene expression frame is not carried, and the hasA gene and the hasB gene in the exogenous gene expression frame are started to express under two independent promoters, so that compared with the existing genetic engineering strain of the streptococcus zooepidemicus, the genetic engineering strain HAs the advantage of obviously higher HA synthetic yield.

Description

Genetic engineering strain of streptococcus zooepidemicus and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a genetic engineering strain of streptococcus zooepidemicus and application thereof, and more particularly relates to a genetic engineering strain of streptococcus zooepidemicus, a method for improving the synthesis of hyaluronic acid by streptococcus zooepidemicus and a method for producing hyaluronic acid.

Background

Hyaluronic Acid (HA) is a polysaccharide composed of repeating units of disaccharides including glucuronic acid and glucosamine, widely distributed in the dermis and epidermis of cartilage tissue, synovial fluid and skin tissue, and plays a physiological role in moisturizing, nourishing, repairing and preventing injury, etc. therein. The production method of hyaluronic acid includes animal tissue extraction method and fermentation method, and the animal tissue extraction method has high preparation cost and complicated separation and purification, and is gradually replaced by the fermentation method.

Because the fermentation method is simple, the required raw materials are easy to obtain, and the cost is relatively low, the production of the hyaluronic acid by the microbial fermentation method is one of the most main modes for producing the hyaluronic acid at present. Currently, the microbial strains that can be used for directly producing HA are mainly classified into A and C in Streptococcus, such as Streptococcus pyogenes and Streptococcus zooepidemicus. Streptococcus zooepidemicus, a member of the group C streptococci, is often favored because of its lower pathogenicity, higher HA yields. However, the production of HA by microbial fermentation also exhibits a number of limitations. The HA production capacity of different hosts is different under the influence of host bacteria, but the yield of the shake flask is mostly less than 1g/L, and the yield of the fermentation tank is generally within 7g/L, so that the production cost is increased, and the ever-increasing market demand is difficult to meet. With the current host improvement technology, chemical mutagenesis or physical mutagenesis technology is one of the mainstream ways to screen excellent production strains, but the disadvantages of long mutagenesis breeding period, large uncertainty of result and high toxicity are also one of the main factors limiting the development of the mutagenesis breeding.

Compared with mutation breeding, the method for directionally transforming the host by using a genetic engineering means so as to obtain the high-yield strain has the advantages of rapidness, controllability and short period, and is one of the most important breeding techniques in the present and future.

Disclosure of Invention

The present invention is directed to solving, at least to some extent, one of the technical problems in the related art.

The inventor of the application unexpectedly finds that the hasB gene has particularly remarkable effect in the hyaluronic acid production of streptococcus zooepidemicus, and the inventor originally splits hasAB into two independently completed expression frames, and mutates a rare initiation codon GTG of the hasB gene into ATG, so that the expression ratio of the hasB gene is enhanced, and finally the shake flask fermentation yield reaches 2.4-2.8g/L, and is improved by more than 160% compared with the yield of hyaluronic acid production of wild streptococcus zooepidemicus, namely 0.8-0.9 g/L.

In a first aspect of the invention, the invention provides a genetically engineered strain of streptococcus zooepidemicus. According to an embodiment of the invention, the genetic engineering strain carries an exogenous gene expression cassette, and the exogenous gene expression cassette comprises a first gene expression cassette and a second gene expression cassette, wherein the first gene expression cassette comprises a first promoter and a hasA gene, and the first promoter and the hasA gene are operably connected; the second gene expression cassette includes a second promoter and a hasB gene, which are operably linked. It should be noted that the term "exogenous gene expression cassette" as used herein refers to a gene expression cassette derived from an external source other than the gene expression cassette present in the genome of Streptococcus zooepidemicus, and the gene expression cassette derived from the external source can be obtained by introducing a desired gene expression cassette into the Streptococcus zooepidemicus through a construct or a vector, and its structure can be the same as or different from the gene expression cassette present in the genome of Streptococcus zooepidemicus. According to the genetic engineering strain of streptococcus zooepidemicus provided by the embodiment of the invention, the exogenous hasA gene expression cassette and the exogenous hasB gene expression cassette are carried, but the exogenous hasC gene expression cassette is not carried, and the hasA gene and the hasB gene in the exogenous gene expression cassette can be started to express under two independent promoters, so that compared with the existing genetic engineering strain of streptococcus zooepidemicus, the genetic engineering strain of streptococcus zooepidemicus HAs a remarkably higher HA synthetic yield.

According to an embodiment of the present invention, the genetically engineered streptococcus zooepidemicus strain may further include at least one of the following additional technical features:

according to an embodiment of the invention, the first gene expression cassette and the second gene expression cassette are provided on different constructs or on the same construct.

According to an embodiment of the invention, said construct comprises at least one selected from pSET4, pSET4s, pEU308, pDL 276.

According to an embodiment of the invention, the first gene expression cassette and the second gene expression cassette are arranged on the same construct, the 3 'end of the first gene expression cassette being linked to the 5' end of the second gene expression cassette or the 3 'end of the second gene expression cassette being linked to the 5' end of the first gene expression cassette.

According to an embodiment of the invention, the construct is an episomal pSET4 vector. The episomal pSET4 vector according to the examples of the invention is more stable.

According to an embodiment of the invention, the strength with which said first promoter promotes gene expression is weaker than the strength with which said second promoter promotes gene expression. The inventors found that when the strength of the first promoter controlling hasA gene is weaker than that of the second promoter controlling hasB gene, the HA synthesis yield of the genetically engineered strain of streptococcus zooepidemicus according to the embodiment of the present invention is higher. For example, the inventors tried to obtain HA at a lower yield than when using Pldh for controlling hasA gene and PABC for controlling hasB gene, and the strength of PABC promoter is weaker than that of Pldh promoter, or when using Pldh for controlling hasA gene and hasB gene at the same time, and Pldh for controlling hasA gene.

According to an embodiment of the invention, the first and second promoters are each independently selected from PGAPDH (glyceraldehyde-3-phosphate dehydrogenase promoter), PacK (acetate kinase promoter), PABC or Pldh.

According to an embodiment of the invention, said first promoter is PABC and said second promoter is Pldh. The inventor finds that the function of the hasB gene in the hyaluronic acid production of streptococcus zooepidemicus is particularly remarkable, the hasB gene is expressed by adopting a promoter Pldh which is the same as that of lactate dehydrogenase, and the generation of lactic acid in the fermentation process is obviously reduced through a promoter competition mechanism, so that the fermentation process is easier to control.

According to an embodiment of the invention, the initiation codon of the hasB gene is ATG. The inventor finds that the expression ratio of the hasB gene can be further improved by changing the GTG initiation codon of the hasB gene into the ATG initiation codon, and the HA synthesis yield is further improved.

According to the embodiment of the invention, the Streptococcus zooepidemicus is classified and named as Streptococcus equi subsp.

In a second aspect of the invention, the invention provides a method for increasing the synthesis of hyaluronic acid by streptococcus zooepidemicus. According to an embodiment of the invention, the method comprises the steps of enabling streptococcus zooepidemicus to carry an exogenous gene expression cassette, wherein the exogenous gene expression cassette comprises a first gene expression cassette and a second gene expression cassette, wherein the first gene expression cassette comprises a first promoter and a hasA gene, and the first promoter is operably connected with the hasA gene; the second gene expression cassette includes a second promoter and a hasB gene, which are operably linked. The method according to the embodiment of the invention can remarkably improve the synthesis amount of hyaluronic acid.

The method according to the embodiment of the invention has the same additional technical characteristics as the streptococcus zooepidemicus genetic engineering strain, and the technical effects are the same, and are not described again.

According to a particular embodiment of the invention, the bringing of the foreign gene expression cassette by streptococcus zooepidemicus is carried out by introducing a construct carrying the desired gene expression cassette into streptococcus zooepidemicus by electroporation.

In a third aspect of the invention, the invention provides a method of producing hyaluronic acid. According to an embodiment of the present invention, the method comprises subjecting the genetically engineered strain described above to a fermentation treatment in order to obtain the hyaluronic acid. The amount of hyaluronic acid obtained by the method according to the embodiment of the present invention is significantly increased.

Additional aspects and advantages of the invention will be set forth in part in the description which follows and, in part, will be obvious from the description, or may be learned by practice of the invention.

Drawings

The above and/or additional aspects and advantages of the present invention will become apparent and readily appreciated from the following description of the embodiments, taken in conjunction with the accompanying drawings of which:

FIG. 1 is a plasmid map of pSET4-PAT according to example 3 of the present invention;

FIG. 2 is a plasmid map of pSET4-PASBT according to example 4 of the present invention;

FIG. 3 is a plasmid map of pSET4-PASBSCT according to example 5 of the present invention;

FIG. 4 is a plasmid map of pSET4-P1AT-P1BT according to example 6 of the present invention;

FIG. 5 is a plasmid map of pSET4-P2AT-P1BT according to example 7 of the present invention;

FIG. 6 is a plasmid map of pSET4-P2AT-P2BT according to example 8 of the present invention;

FIG. 7 is a plasmid map of pSET4-P1AT-P2BT according to example 9 of the present invention;

FIG. 8 is a photograph of agarose gel electrophoresis of the transformant according to example 9 of the present invention.

Detailed Description

Reference will now be made in detail to embodiments of the present invention, examples of which are illustrated in the accompanying drawings. The embodiments described below with reference to the drawings are illustrative and intended to be illustrative of the invention and are not to be construed as limiting the invention.

Furthermore, the terms "first", "second" and "first" are used for descriptive purposes only and are not to be construed as indicating or implying relative importance or implicitly indicating the number of technical features indicated. Thus, a feature defined as "first" or "second" may explicitly or implicitly include at least one such feature. In the description of the present invention, "a plurality" means at least two, e.g., two, three, etc., unless specifically limited otherwise.

According to a specific embodiment of the present invention, the method for modifying streptococcus zooepidemicus for producing hyaluronic acid is as follows:

1. the method comprises the steps of taking a large intestine-streptococcus zooepidemicus shuttle-type genome editing vector pSET4s as a starting vector, mutating the starting vector into a free type pSET4 vector by a point mutation technology, and taking the free type pSET4 vector as a framework vector of a subsequent free overexpression vector;

2. the PABC + hasA expression cassette is cloned from the genome of streptococcus zooepidemicus by using a primer 01F/01R (PABC is a promoter of a ha gene cluster of streptococcus zooepidemicus). Wherein 01F introduces Bgl II enzyme cutting site, 01R introduces a terminator sequence Ter and EcoRI enzyme cutting site, the cloned expression frame is named as PAT (PABC + hasA + Ter), and the PAT expression frame is inserted between Bgl II and EcoRI enzyme cutting site of pSET4 vector by enzyme cutting enzyme connection mode, thereby generating a first free expression vector pSET 4-PAT;

3. the Pldh promoter sequence (lactate dehydrogenase promoter) was cloned from the genome of Streptococcus zooepidemicus with primer 02F/02R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus with primer 03F/03R. Wherein, EcoRI enzyme cutting site is introduced through 02F primer, GTG of hasB gene is mutated into ATG through 03F to enhance translation efficiency of hasB, and terminator sequence Ter and sal I enzyme cutting site are introduced through 03R. The Pldh promoter and hasB + Ter fragment were then ligated together by overlap PCR using 02F/03R to make up the Pldh + hasB + Ter expression cassette and designated P2 BT. Finally, inserting P2BT between EcoRI and sal I enzyme cutting sites of the pSET4-PAT vector by adopting an enzyme cutting enzyme connection mode, thereby generating a second free expression vector pSET4-PAT-P2 BT;

4. preparing streptococcus zooepidemicus into competent cells, introducing a pSET4-PAT-P2BT vector into the streptococcus zooepidemicus by an electroporation method, screening transformants on a BHI solid culture medium containing spectinomycin with the final concentration of 50 mu g/mL, verifying the transformants by YF/YR, and verifying the correct transformants, namely the final strain.

Compared with the prior art, the method for modifying streptococcus zooepidemicus has the following advantages:

1) compared with the traditional mutation breeding, the method has the advantages of simple operation, short period and better result expectation. On the basis of metabolic flow of an original strain, an HA synthesis way is enhanced, namely the excellent characteristics of the strain are maintained, the yield can be improved, the yield of a shake flask reaches 2.4g/L-2.8g/L, the yield of a 15L fermentation tank reaches 9g/L-11g/L, the yield of a 50L fermentation tank reaches 9g/L-10g/L, the yield of the shake flask of streptococcus zooepidemicus generally reported at present is generally 0.1g/L-1.0g/L, and the streptococcus zooepidemicus modified by the method disclosed by the invention is improved by more than 160% compared with the original strain.

2) The technology separately over-expresses the hasA gene and the hasB gene, each gene is started by a separate strong promoter, the GTG initiation codon of the hasB gene is originally changed into the ATG initiation codon, the expression proportion of the hasB gene is further improved, and finally, the yield of a shake flask is improved by more than 160 percent compared with that of a starting strain to reach 2.4-2.8 g/L.

3) In the technology, the hasB gene is expressed by adopting a promoter Pldh which is the same as the lactate dehydrogenase, and the generation of lactic acid in the fermentation process is obviously reduced by a promoter competition mechanism, so that the fermentation process is easier to control.

4) The constructed strain is stable in fermentation in 15L and 50L fermentation tanks, the result reproducibility is high, the molecular weight can reach 2-2.8MDa while the hyaluronic acid is high in yield, the molecular weight and the distribution width are consistent with those of HA produced by the original strain, the molecular weight is uniform in concentration, and the production potential is huge.

The invention will now be described with reference to specific examples, which are intended to be illustrative only and not to be limiting in any way.

The original strain employed in the following examples was Streptococcus zooepidemicus with a preservation number of CCTCC NO: M2020231 (designated herein as Streptococcus equi subsp. zooepidemicus HEC-SE01, Streptococcus equi subsp. zooepidicus HEC-SE 01).

Seed medium (g/L): glucose 10, peptone 15, yeast extract 5, K₂HPO₄ 1.5，MgSO₄ 0.35， pH 6.5；

Shake flask fermentation medium (g/L): 30 portions of glucose, 5.55 portions of yeast powder, 16.67 portions of peptone and K₂HPO₄ 1.72，MgSO₄0.36 part of monosodium glutamate, 3.44 parts of monosodium glutamate, 9.36 parts of anhydrous sodium dihydrogen phosphate and 43.69 parts of disodium hydrogen phosphate dodecahydrate, wherein the pH value is 7.5.

The primer sequences used in the following examples are shown in table 1 below.

Table 1:

the nucleotide sequences of the element units in the constructs of the following examples are shown below.

Streptococcus zooepidemicus has gene cluster promoter PABC

TCGGAGCTCCTTATAGAATTGCTTTATTACCAATATGAAGTGGCCTGATAAGGGCT GCTTTTTTGATGTCAAAAAAGAGAGCGAAAAGCGGCTGTCCAAAGCGCTTTAGTTTT GGACGGGCCATTTAGCTGCTTGTTATCAGGCACATGCTAGCGATAGCCACAGGTAAAC TCAGGCTATCATTTGTTTTTTGTAGGGGATTGATGACTTGGTGAGCATAGGCAAATCTT AGAAAAAGCTGTATTGACACTAAGATTAATCTATCTTTAATAGAATGGTAAATTAATGA CCTTGTTTGCTTGCTGTGACAGATAGTATATTATGGTTAGCGTTTAAAGGCAAAATACA AAGCGCAAGAAAGGAACAAACCAATCACA(SEQ ID NO:1)。

hasA gene

ATGAGAACATTAAAAAACCTCATAACTGTTGTGGCCTTTAGTATTTTTTGGGTACT GTTGATTTACGTCAATGTTTATCTCTTTGGTGCTAAAGGAAGCTTGTCAATTTATGGCTT TTTGCTGATAGCTTACCTATTAGTTAAAATGTCCTTATCCTTTTTTTACAAGCCATTTAA GGGAAGGGCTGGGCAATATAAGGTTGCAGCCATTATTCCCTCTTATAACGAAGATGCT GAGTCATTGCTAGAGACCTTAAAAAGTGTTCAGCAGCAAACCTATCCCCTAGCAGAAA TTTATGTTGTTGACGATGGAAGTGCTGATGAGACAGGTATTAAGCGCATTGAAGACTAT GTGCGTGAAACTGGTGACCTATCAAGCAATGTCATTGTTCATCGGTCAGAGAAAAATC AAGGAAAGCGTCATGCACAGGCCTGGGCCTTTGAAAGATCAGACGCTGATGTCTTTT TGACCGTTGACTCAGATACTTATATCTACCCTGATGCTTTGGAGGAGCTGTTAAAAACC TTTAATGACCCAACAGTATATGCTGCTACAGGTCATTTGAATGTTCGAAATAGAGAAGT GAATCTTCTAACGCGTTTAACGGATATTCGCTATGATAATGCTTTTGGCGTGGAGCGAG CTGCCCAATCTGTTACGGGTAATATCCTTGTTTGCTCAGGACCTCTTAGCATTTACAGA CGCGAGGTTGTAGTACCTAACATAGATAAATACATCAATCAAACCTTCTTAGGCATTCC TGTAAGCATCGGTGATGATAGGTGCTTGACCAACTATGCAACTGATTTAGGAAAGACC GTTTATCAATCTACTGCTAAATGTATTACAGATGTTCCTGACAAGATGTCTACTTACTTG AAGCAGCAAAACCGCTGGAACAAGTCCTTCTTTAGAGAGTCCATTATTTCTGTTAAGA AAATCATGAACAATCCTTTTGTAGCCCTATGGACCATACTTGAGGTGTCTATGTTTATGA TGCTTGTTTATTCTGTGGTGGATTTCTTTGTAGGCAATGTCAGAGAATTTGATTGGTTA AGGGTTTTAGCCTTTCTGGTGATTATCTTCATTGTTGCTCTTTGTCGTAATATTCACTATA TGCTTAAGCACCCGCTGTCCTTCTTGTTATCTCCATTTTATGGGGTGCTGCACTTGTTTG TCCTACAGCCCTTGAAATTATATTCTCTTTTTACTATTAGAAACGCTGACTGGGGAACA CGTAAAAAATTATTATAA(SEQ ID NO:2)。

hasB gene

GTGAAAATTTCTGTAGCAGGCTCAGGATATGTCGGCCTATCCTTGAGTATTTTACT GGCACAACATAATGACGTCACTGTTGTTGACATTATTGATGAAAAGGTGAGATTGATC AATCAAGGCATATCGCCAATCAAGGATGCTGATATTGAGGAGTATTTAAAAAATGCGCC GCTAAATCTCACAGCGACGCTTGATGGCGCAAGCGCTTATAGCAATGCAGACCTTATTA TCATTGCTACTCCGACAAATTATGACAGCGAACGCAACTACTTTGACACAAGGCATGT TGAAGAGGTCATCGAGCAGGTCCTAGACCTAAATGCGTCAGCAACCATTATTATCAAA TCAACCATACCACTAGGCTTTATCAAGCATGTTAGGGAAAAATACCAGACAGATCGTAT TATTTTTAGCCCAGAATTTTTAAGAGAATCAAAAGCCTTATACGATAACCTTTACCCAA GTCGGATCATTGTTTCTTATGAAAAGGACGACTCACCAAGGGTTATTCAGGCTGCTAA AGCCTTTGCTGGTCTTTTAAAGGAAGGAGCCAAAAGCAAGGATACTCCGGTCTTATTT ATGGGCTCACAGGAGGCTGAGGCGGTCAAGCTATTTGCGAATACCTTTTTGGCCATGC GGGTGTCTTACTTTAATGAATTAGACACCTATTCCGAAAGCAAGGGTCTAGATGCTCA GCGCGTGATTGAAGGAGTCTGTCATGATCAGCGCATTGGTAACCATTACAATAACCCTT CCTTTGGATATGGCGGCTATTGCCTGCCAAAGGACAGCAAGCAGCTGTTGGCAAATTA TAGAGGCATTCCCCAGTCCTTGATGTCAGCGATTGTTGAGTCCAACAAGATACGAAAA TCCTATTTAGCTGAACAAATATTAGACAGAGCCTCTAGTCAAAAGCAGGCTGGTGTAC CATTAACGATTGGCTTTTACCGCTTGATTATGAAAAGCAACTCTGATAATTTCCGAGAA AGCGCCATTAAAGATATTATTGATATCATCAACGACTATGGGATTAATATTGTCATTTAC GAACCAATGCTTGGTGAGGACATTGGCTACAGGGTTGTCAAGGACTTAGAGCAGTTC AAAAACGAGTCTACAATCATTGTGTCAAATCGCTTTGAGGACGACCTAGGAGATGTCA TTGACAAGGTTTACACGAGAGATGTCTTTGGAAGAGACTAG(SEQ ID NO:3)。

hasC gene

ATGACCAAAGTCAGAAAAGCCATTATTCCTGCTGCAGGTCTAGGAACACGTTTTT TACCTGCTACCAAAGCTCTTGCCAAAGAGATGTTGCCCATCGTTGATAAACCAACCAT CCAGTTTATCGTCGAAGAAGCGCTAAAATCTGGCATCGAGGAAATCCTTGTGGTGACC GGAAAAGCTAAACGCTCTATCGAGGACCATTTTGATTCAAACTTTGAATTAGAATACA ACCTCCAAGCTAAGGGGAAAAATGAACTGTTGAAATTAGTGGATGAAACCACTGCCA TTAACCTTCATTTTATCCGTCAAAGCCACCCAAGAGGGCTGGGAGATGCTGTCTTACA AGCCAAAGCCTTTGTGGGCAATGAACCCTTTGTGGTCATGCTTGGAGATGACTTAATG GACATTACAAATGCATCCGCTAAACCTCTCACCAAACAACTCATGGAGGACTATGACA AGACGCATGCATCCACTATCGCTGTGATGAAAGTTCCTCATGAAGATGTGTCTAGCTAT GGGGTTATCGCTCCTCAAGGCAAGGCTGTCAAGGGCCTTTACAGTGTAGACACCTTTG TTGAAAAACCACAACCAGAAGATGCGCCTAGTGATTTGGCTATTATTGGTCGTTACCT CCTAACCCCTGAAATTTTTGGTATTTTGGAAAGACAGACCCCTGGAGCAGGTAACGAA GTGCAACTCACAGATGCTATCGATACCCTCAATAAAACTCAGCGTGTCTTTGCACGAG AATTTAAAGGCAATCGTTACGATGTTGGGGATAAATTTGGATTCATGAAAACATCTATC GACTATGCCTTAGAACACCCACAGGTCAAAGAGGACTTGAAAAATTACATTATCAAAC TAGGAAAAGCTTTGGAAAAAAGTAAAGTACCAACACATTCAAAGTAA(SEQ ID NO:4)。

Pldh:

CTTAAGGAATGCTCCTTTTCTAGTCAATACTCTTTTAATTATACCATAAAATCCTTAT TTTTTCTGGTTGGAAACGCTATCCGAAAACAATTTTCATAATTTGGTCGAATATCATGA CAAAGACATTACAATGTGTTAAAATAAGATCGTATGAGCAATTTGCTCTAACTAAAATG AAGGAGATGTTTAGAA(SEQ ID NO:5)。

Example 1 starting Strain Shake flask fermentation validation

Collecting Streptococcus zooepidemicus (Streptococcus)s Zoopeptidermicus) strain was inoculated into a seed medium in one thousandth of the inoculum size and cultured to OD₆₆₀Transferring the strain to a fermentation medium according to the inoculation amount of 10 percent, culturing at 37 ℃ and 220rpm for 48h, sampling and detecting the HA yield and the molecular weight, wherein the yield is 0.8-0.9g/L, and the molecular weight is 2-3 MDa.

Example 2 construction of pSET4 episomal expression vector

And (3) carrying out overall amplification on a pSET4s vector by using a pSET4-F/pSET4-R point mutation primer, carrying out enzyme digestion on a PCR product obtained by amplification by Dpn I, then transforming escherichia coli, selecting a transformant, inoculating the transformant into an LB liquid culture medium containing 50 mu g/mL spectinomycin, carrying out overnight culture at 37 ℃ and 220rpm, extracting a plasmid, and carrying out sequencing, wherein the vector with a correct sequencing result is the free pSET 4.

Example 3 construction of hasA overexpression Strain

The PABC + hasA expression cassette is cloned from the genome of streptococcus zooepidemicus by using a primer 01F/01R (PABC is a promoter of a ha gene cluster of streptococcus zooepidemicus). Wherein 01F introduces BglII restriction enzyme cutting site, 01R introduces a terminator sequence Ter and EcoRI restriction enzyme cutting site, the cloned expression frame is named as PAT (PABC + hasA + Ter, and the PAT expression frame is inserted between BglII and EcoRI restriction enzyme cutting site of pSET4 vector by enzyme cutting enzyme connection, thereby generating hasA over-expression vector pSET4-PAT, plasmid map of pSET4-PAT is shown in figure 1, streptococcus zooepidemicus is prepared into competent cells, pSET4-PAT vector is introduced into streptococcus zooepidemicus by electroporation method, transformants are screened on BHI solid medium containing spectinomycin with 50 mug/mL final concentration, YF/YR is used for verifying correct transformant, namely hasA over-expression strain in shake flask, and HA fermentation yield is 1.1-1.26 g/L.

Example 4 HasAB Combined overexpression Strain construction

The primer 01F/04R is used for cloning the hasAB expression cassette from the genome of the streptococcus zooepidemicus (PABC + hasA-RBS-hasB, PABC is the promoter of the hass gene cluster of the streptococcus zooepidemicus, and RBS is the ribosome binding site). Wherein BglII enzyme cutting sites are introduced into 01F, a terminator sequence Ter and SmaI enzyme cutting sites are introduced into 04R, the cloned expression frame is named as PASBT (PABC + hasA + RBS + hasB + Ter), and the PASBT expression frame is inserted between the BglII enzyme cutting sites and the SmaI enzyme cutting sites of the pSET4 vector in an enzyme cutting enzyme connection mode, so that a plasmid map of the hasA B combined over-expression vector pSET4-PASBT, pSET4-PASBT is generated and is shown in figure 2; preparing streptococcus zooepidemicus into competent cells, introducing pSET4-PASBT vector into streptococcus zooepidemicus by an electroporation method, screening transformants on a solid culture medium containing spectinomycin BHI with a final concentration of 50 mu g/mL, verifying the transformants by YF/YR, verifying the correct transformant, namely hasAB combined over-expression strain, and ensuring that the yield of a shake flask is 1.4-1.6 g/L.

Example 5 HasaBC Combined overexpression Strain construction

The primer 01F/05R is used for cloning the hasAB expression cassette from the genome of the streptococcus zooepidemicus (PABC + hasA + RBS + hasB + RBS + hasC, and PABC is a promoter of the ha gene cluster of the streptococcus zooepidemicus). Wherein 01F introduces Bgl II enzyme cutting sites, 05R introduces a terminator sequence Ter and SmaI enzyme cutting sites, the cloned expression frame is named as PASSCT (PABC + hasA + RBS + hasB + RBS + hasC + Ter), and the PASSCT expression frame is inserted between the Bgl II and SmaI enzyme cutting sites of the pSET4 vector by adopting an enzyme cutting enzyme connection mode, so that a plasmid map of the hasACC combined over-expression vector pSET 4-PASSCT is generated, and the pSET 4-PASSCT is shown in figure 3; preparing streptococcus zooepidemicus into competent cells, introducing a pSET4-PASBSCT vector into the streptococcus zooepidemicus by an electroporation method, screening transformants on a solid culture medium containing spectinomycin BHI with the final concentration of 50 mu g/mL, verifying the transformants by YF/YR, verifying the correct transformant, namely a hasAB combined over-expression strain, and ensuring that the yield of a shake flask is 1.2-1.3 g/L.

Example 6 overexpression of hasA and hasB Using the PABC promoter, respectively

The PABC + hasA expression cassette is cloned from the genome of streptococcus zooepidemicus by using a primer 01F/01R (PABC is a promoter of a ha gene cluster of streptococcus zooepidemicus). Wherein 01F introduces BglII enzyme cutting site, 01R introduces a terminator sequence Ter and EcoRI enzyme cutting site, the cloned expression frame is named as P1AT (PABC + hasA + Ter), and the PAT expression frame is inserted between the BglII and EcoRI enzyme cutting site of pSET4 vector by adopting enzyme cutting enzyme connection mode, thereby generating a first free expression vector pSET4-P1 AT; the PABC promoter sequence was cloned from the genome of Streptococcus zooepidemicus with primer 06F/06R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus with primer 07F/03R. Wherein, EcoRI enzyme cutting site is introduced through 07F primer, GTG of hasB gene is mutated into ATG to enhance translation efficiency of hasB, and terminator sequence Ter and sal I enzyme cutting site are introduced through 03R. The PABC promoter and hasB + Ter fragment were then ligated together by overlap PCR using 06F/03R to form the PABC + hasB + Ter expression cassette, which was designated P1 BT. Finally, the plasmid map of a second free expression vector pSET4-P1AT-P1BT, pSET4-P1AT-P1BT, which is generated by inserting P1BT between the EcoRI and sal I cleavage sites of the vector pSET4-P1AT by means of enzymatic ligation, is shown in FIG. 4.

Example 7 overexpression of hasA Using the Pldh promoter and overexpression of hasB by the PABC promoter

The Pldh promoter (labeled P2) was cloned from the genome of Streptococcus zooepidemicus with primer 04F/07R, the hasA fragment was cloned from the genome of Streptococcus zooepidemicus with 08F/01R, and the Pldh and hasA fragments were fused with 04F/01R. Wherein, BglII enzyme cutting site is introduced into 04F, and a terminator sequence Ter and EcoRI enzyme cutting site is introduced into 01R. The cloned expression cassette was named P2AT (Pldh + hasA + Ter, initials) and the P2AT expression cassette was inserted between the bglii and ecori cleavage sites of the pSET4 vector by means of enzymatic ligation, thus generating the first free expression vector pSET4-P2 AT; the PABC promoter sequence was cloned from the genome of Streptococcus zooepidemicus with primer 06F/06R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus with primer 07F/03R. Wherein, EcoRI enzyme cutting site is introduced through 07F primer, GTG of hasB gene is mutated into ATG to enhance translation efficiency of hasB, and terminator sequence Ter and sal I enzyme cutting site are introduced through 03R. The PABC promoter and hasB + Ter fragment were then ligated together by overlap PCR using 06F/03R to form the PABC + hasB + Ter expression cassette, which was designated P1 BT. Finally, the plasmid map of a second free expression vector pSET4-P2AT-P1BT, pSET4-P2AT-P1BT, which is generated by inserting P1BT between the EcoRI and sal I cleavage sites of the vector pSET4-P2AT by means of enzymatic ligation, is shown in FIG. 5.

Example 8 overexpression of hasA and hasB Using Pldh, respectively

The Pldh promoter (labeled P2) was cloned from the genome of Streptococcus zooepidemicus with primer 04F/07R, the hasA fragment was cloned from the genome of Streptococcus zooepidemicus with 08F/01R, and the Pldh and hasA fragments were fused with 04F/01R. Wherein, 03F introduces BglII restriction enzyme cutting site, 01R introduces a terminator sequence Ter and EcoRI restriction enzyme cutting site. The cloned expression cassette is named as P2AT (Pldh + hasA + Ter), and the P2AT expression cassette is inserted between Bgl II and EcoRI enzyme cutting sites of the pSET4 vector by adopting enzyme cutting enzyme connection, so that a first free expression vector pSET4-P2AT is generated; the Pldh promoter sequence (lactate dehydrogenase promoter) was cloned from the genome of Streptococcus zooepidemicus with primer 02F/02R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus with primer 03F/03R. Wherein, EcoRI enzyme cutting site is introduced through 02F primer, GTG of hasB gene is mutated into ATG through 03F to enhance translation efficiency of hasB, and terminator sequence Ter and sal I enzyme cutting site are introduced through 03R. The Pldh promoter and hasB + Ter fragment were then ligated together by overlap PCR using 02F/03R to make up the Pldh + hasB + Ter expression cassette and designated P2 BT. Finally, the plasmid map of the second free expression vector pSET4-P2AT-P2BT, pSET4-P2AT-P2BT is shown in FIG. 6, which is generated by inserting P2BT between the EcoRI and sal I cleavage sites of the pSET4-PAT vector by means of enzymatic ligation.

Example 9 construction of HEC-SE02 Strain

The PABC + hasA expression cassette is cloned from the genome of streptococcus zooepidemicus by using a primer 01F/01R (PABC is a promoter of a ha gene cluster of streptococcus zooepidemicus). Wherein 01F introduces BglII enzyme cutting site, 01R introduces a terminator sequence Ter and EcoRI enzyme cutting site, the cloned expression frame is named as P1AT (PABC + hasA + Ter), and the PAT expression frame is inserted between the BglII and EcoRI enzyme cutting site of pSET4 vector by adopting enzyme cutting enzyme connection mode, thereby generating a first free expression vector pSET4-P1 AT; the Pldh promoter sequence (lactate dehydrogenase promoter) was cloned from the genome of Streptococcus zooepidemicus with primer 02F/02R, and the hasB gene was cloned from the genome of Streptococcus zooepidemicus with primer 03F/03R. Wherein, EcoRI enzyme cutting site is introduced through 02F primer, GTG of hasB gene is mutated into ATG through 03F to enhance translation efficiency of hasB, and terminator sequence Ter and sal I enzyme cutting site are introduced through 03R. The Pldh promoter and hasB + Ter fragment were then ligated together by overlap PCR using 02F/03R to make up the Pldh + hasB + Ter expression cassette and designated P2 BT. Finally, inserting P2BT between EcoRI and sal I cutting sites of pSET4-P1AT vector by enzyme digestion enzyme ligation, thereby generating a second free expression vector pSET4-P1AT-P2BT, and the plasmid map of pSET4-P1AT-P2BT is shown in FIG. 7; preparing streptococcus zooepidemicus into competent cells, introducing pSET4-P1AT-P2BT vector into streptococcus zooepidemicus by an electroporation method, screening transformants on a solid culture medium containing spectinomycin BHI with a final concentration of 50 mug/mL, verifying the transformants by YF/YR, and verifying the correct transformants, namely the final strain, by a transformant agarose gel electrophoresis picture as shown in figure 8.

Example 10 Final Strain Shake flask fermentation validation

Taking the final strain obtained in the example 9, streaking and activating the final strain on a solid medium containing spectinomycin BHI with the final concentration of 50 mu g/ml, and culturing for 24h at 37 ℃; washing the thallus with 5mL sterile physiological saline, inoculating to seed culture medium containing 50 μ g/mL spectinomycin at final concentration, culturing at 37 deg.C and 220rpm for 12 hr to OD₆₆₀Inoculating to fermentation medium at 10% of 0.3-0.6, culturing at 37 deg.C and 220rpm for 48h, sampling, diluting 20 times, measuring HA yield and molecular weight by GPC, and measuring HA yield 2.4-2.8g/L and molecular weight 2-2.8MDa in shake flask.

EXAMPLE 11 detection of lactic acid content in fermentation Process of Final Strain 15L fermenter

The final strain obtained in example 9, which was stored in glycerin tube, was inoculated at 1% inoculum size to 1L seed medium supplemented with spectinomycin at a final concentration of 50. mu.g/mL and cultured to OD₆₆₀Inoculating the seed solution to a 15L fermentation tank, fermenting at 37 deg.C for 48h, adjusting pH to 7.0 by adding NaOH, and collecting the final fermentation liquid sample to detect lactic acid content. The detection shows that the lactic acid content of the HEC-HAZ strain is 30-35g/L, the lactic acid content of the original strain is 42-50g/L, and the lactic acid content is obviously reducedLow.

Genotype and HA shake flask yield, molecular weight comparisons for each of the above examples are shown in table 2.

Table 2: comparison of genotype and HA Shake flask yields, molecular weights for each example

As can be seen from the results in table 1, the HA shake flask yield was higher for the combined expression of hasAB compared to either overexpression of hasA alone or combined expression of hasABC; PABC expresses hasA, Pldh expresses hasB, and PABC expresses hasB or Pldh overexpresses hasA and hasB, respectively, with higher HA shake flask yield than PABC expresses hasA and hasB, respectively, Pldh expresses hasB.

In the description herein, references to the description of the term "one embodiment," "some embodiments," "an example," "a specific example," or "some examples," etc., mean that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the invention. In this specification, the schematic representations of the terms used above are not necessarily intended to refer to the same embodiment or example. Furthermore, the particular features, structures, materials, or characteristics described may be combined in any suitable manner in any one or more embodiments or examples. Furthermore, various embodiments or examples and features of different embodiments or examples described in this specification can be combined and combined by one skilled in the art without contradiction.

Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention, and that variations, modifications, substitutions and alterations can be made to the above embodiments by those of ordinary skill in the art within the scope of the present invention.

SEQUENCE LISTING

<110> Yichangdong sunshine Biochemical pharmacy Co., Ltd

<120> genetic engineering strain of streptococcus zooepidemicus and application thereof

<130> PIDC4200127

<160> 23

<170> PatentIn version 3.5

<210> 1

<211> 377

<212> DNA

<213> Artificial Sequence

<220>

<223> Streptococcus zooepidemicus has Gene Cluster promoter PABC

<400> 1

tcggagctcc ttatagaatt gctttattac caatatgaag tggcctgata agggctgctt 60

ttttgatgtc aaaaaagaga gcgaaaagcg gctgtccaaa gcgctttagt tttggacggg 120

ccatttagct gcttgttatc aggcacatgc tagcgatagc cacaggtaaa ctcaggctat 180

catttgtttt ttgtagggga ttgatgactt ggtgagcata ggcaaatctt agaaaaagct 240

gtattgacac taagattaat ctatctttaa tagaatggta aattaatgac cttgtttgct 300

tgctgtgaca gatagtatat tatggttagc gtttaaaggc aaaatacaaa gcgcaagaaa 360

ggaacaaacc aatcaca 377

<210> 2

<211> 1254

<212> DNA

<213> Artificial Sequence

<220>

<223> hasA Gene

<400> 2

atgagaacat taaaaaacct cataactgtt gtggccttta gtattttttg ggtactgttg 60

atttacgtca atgtttatct ctttggtgct aaaggaagct tgtcaattta tggctttttg 120

ctgatagctt acctattagt taaaatgtcc ttatcctttt tttacaagcc atttaaggga 180

agggctgggc aatataaggt tgcagccatt attccctctt ataacgaaga tgctgagtca 240

ttgctagaga ccttaaaaag tgttcagcag caaacctatc ccctagcaga aatttatgtt 300

gttgacgatg gaagtgctga tgagacaggt attaagcgca ttgaagacta tgtgcgtgaa 360

actggtgacc tatcaagcaa tgtcattgtt catcggtcag agaaaaatca aggaaagcgt 420

catgcacagg cctgggcctt tgaaagatca gacgctgatg tctttttgac cgttgactca 480

gatacttata tctaccctga tgctttggag gagctgttaa aaacctttaa tgacccaaca 540

gtatatgctg ctacaggtca tttgaatgtt cgaaatagag aagtgaatct tctaacgcgt 600

ttaacggata ttcgctatga taatgctttt ggcgtggagc gagctgccca atctgttacg 660

ggtaatatcc ttgtttgctc aggacctctt agcatttaca gacgcgaggt tgtagtacct 720

aacatagata aatacatcaa tcaaaccttc ttaggcattc ctgtaagcat cggtgatgat 780

aggtgcttga ccaactatgc aactgattta ggaaagaccg tttatcaatc tactgctaaa 840

tgtattacag atgttcctga caagatgtct acttacttga agcagcaaaa ccgctggaac 900

aagtccttct ttagagagtc cattatttct gttaagaaaa tcatgaacaa tccttttgta 960

gccctatgga ccatacttga ggtgtctatg tttatgatgc ttgtttattc tgtggtggat 1020

ttctttgtag gcaatgtcag agaatttgat tggttaaggg ttttagcctt tctggtgatt 1080

atcttcattg ttgctctttg tcgtaatatt cactatatgc ttaagcaccc gctgtccttc 1140

ttgttatctc cattttatgg ggtgctgcac ttgtttgtcc tacagccctt gaaattatat 1200

tctcttttta ctattagaaa cgctgactgg ggaacacgta aaaaattatt ataa 1254

<210> 3

<211> 1206

<212> DNA

<213> Artificial Sequence

<220>

<223> hasB Gene

<400> 3

gtgaaaattt ctgtagcagg ctcaggatat gtcggcctat ccttgagtat tttactggca 60

caacataatg acgtcactgt tgttgacatt attgatgaaa aggtgagatt gatcaatcaa 120

ggcatatcgc caatcaagga tgctgatatt gaggagtatt taaaaaatgc gccgctaaat 180

ctcacagcga cgcttgatgg cgcaagcgct tatagcaatg cagaccttat tatcattgct 240

actccgacaa attatgacag cgaacgcaac tactttgaca caaggcatgt tgaagaggtc 300

atcgagcagg tcctagacct aaatgcgtca gcaaccatta ttatcaaatc aaccatacca 360

ctaggcttta tcaagcatgt tagggaaaaa taccagacag atcgtattat ttttagccca 420

gaatttttaa gagaatcaaa agccttatac gataaccttt acccaagtcg gatcattgtt 480

tcttatgaaa aggacgactc accaagggtt attcaggctg ctaaagcctt tgctggtctt 540

ttaaaggaag gagccaaaag caaggatact ccggtcttat ttatgggctc acaggaggct 600

gaggcggtca agctatttgc gaataccttt ttggccatgc gggtgtctta ctttaatgaa 660

ttagacacct attccgaaag caagggtcta gatgctcagc gcgtgattga aggagtctgt 720

catgatcagc gcattggtaa ccattacaat aacccttcct ttggatatgg cggctattgc 780

ctgccaaagg acagcaagca gctgttggca aattatagag gcattcccca gtccttgatg 840

tcagcgattg ttgagtccaa caagatacga aaatcctatt tagctgaaca aatattagac 900

agagcctcta gtcaaaagca ggctggtgta ccattaacga ttggctttta ccgcttgatt 960

atgaaaagca actctgataa tttccgagaa agcgccatta aagatattat tgatatcatc 1020

aacgactatg ggattaatat tgtcatttac gaaccaatgc ttggtgagga cattggctac 1080

agggttgtca aggacttaga gcagttcaaa aacgagtcta caatcattgt gtcaaatcgc 1140

tttgaggacg acctaggaga tgtcattgac aaggtttaca cgagagatgt ctttggaaga 1200

gactag 1206

<210> 4

<211> 915

<212> DNA

<213> Artificial Sequence

<220>

<223> hasC Gene

<400> 4

atgaccaaag tcagaaaagc cattattcct gctgcaggtc taggaacacg ttttttacct 60

gctaccaaag ctcttgccaa agagatgttg cccatcgttg ataaaccaac catccagttt 120

atcgtcgaag aagcgctaaa atctggcatc gaggaaatcc ttgtggtgac cggaaaagct 180

aaacgctcta tcgaggacca ttttgattca aactttgaat tagaatacaa cctccaagct 240

aaggggaaaa atgaactgtt gaaattagtg gatgaaacca ctgccattaa ccttcatttt 300

atccgtcaaa gccacccaag agggctggga gatgctgtct tacaagccaa agcctttgtg 360

ggcaatgaac cctttgtggt catgcttgga gatgacttaa tggacattac aaatgcatcc 420

gctaaacctc tcaccaaaca actcatggag gactatgaca agacgcatgc atccactatc 480

gctgtgatga aagttcctca tgaagatgtg tctagctatg gggttatcgc tcctcaaggc 540

aaggctgtca agggccttta cagtgtagac acctttgttg aaaaaccaca accagaagat 600

gcgcctagtg atttggctat tattggtcgt tacctcctaa cccctgaaat ttttggtatt 660

ttggaaagac agacccctgg agcaggtaac gaagtgcaac tcacagatgc tatcgatacc 720

ctcaataaaa ctcagcgtgt ctttgcacga gaatttaaag gcaatcgtta cgatgttggg 780

gataaatttg gattcatgaa aacatctatc gactatgcct tagaacaccc acaggtcaaa 840

gaggacttga aaaattacat tatcaaacta ggaaaagctt tggaaaaaag taaagtacca 900

acacattcaa agtaa 915

<210> 5

<211> 192

<212> DNA

<213> Artificial Sequence

<220>

<223> Pldh

<400> 5

cttaaggaat gctccttttc tagtcaatac tcttttaatt ataccataaa atccttattt 60

tttctggttg gaaacgctat ccgaaaacaa ttttcataat ttggtcgaat atcatgacaa 120

agacattaca atgtgttaaa ataagatcgt atgagcaatt tgctctaact aaaatgaagg 180

agatgtttag aa 192

<210> 6

<211> 33

<212> DNA

<213> Artificial Sequence

<220>

<223> 01F

<400> 6

gaagatcttc ggagctcctt atagaattgc ttt 33

<210> 7

<211> 63

<212> DNA

<213> Artificial Sequence

<220>

<223> 01R

<400> 7

ggaattccaa aaaagcccgc tcattaggcg ggctttataa taatttttta cgtgttcccc 60

agt 63

<210> 8

<211> 28

<212> DNA

<213> Artificial Sequence

<220>

<223> 02F

<400> 8

ggaattcctt aaggaatgct ccttttct 28

<210> 9

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> 02R

<400> 9

gcctgctaca gaaattttca tttctaaaca tctccttcat tttagtt 47

<210> 10

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> 03F

<400> 10

aactaaaatg aaggagatgt ttagaaatga aaatttctgt agcaggc 47

<210> 11

<211> 62

<212> DNA

<213> Artificial Sequence

<220>

<223> 03R

<400> 11

acgcgtcgac gtcaaaaaag cccgctcatt aggcgggctc tagtctcttc caaagacatc 60

tc 62

<210> 12

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> 04F

<400> 12

gaagatcttt aaggaatgct ccttttctag t 31

<210> 13

<211> 61

<212> DNA

<213> Artificial Sequence

<220>

<223> 04R

<400> 13

tcccccgggg gaaaaaaagc ccgctcatta ggcgggctct agtctcttcc aaagacatct 60

c 61

<210> 14

<211> 61

<212> DNA

<213> Artificial Sequence

<220>

<223> 05R

<400> 14

tcccccgggg gaaaaaaagc ccgctcatta ggcgggctct atttcttgac gtccttgttc 60

a 61

<210> 15

<211> 31

<212> DNA

<213> Artificial Sequence

<220>

<223> 06F

<400> 15

ggaattccgg agctccttat agaattgctt t 31

<210> 16

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> 06R

<400> 16

gcctgctaca gaaattttca ttgtgattgg tttgttcctt tctt 44

<210> 17

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> 07F

<400> 17

aagaaaggaa caaaccaatc acaatgaaaa tttctgtagc aggc 44

<210> 18

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> 07R

<400> 18

atgaggtttt ttaatgttct catttctaaa catctccttc attttag 47

<210> 19

<211> 47

<212> DNA

<213> Artificial Sequence

<220>

<223> 08F

<400> 19

ctaaaatgaa ggagatgttt agaaatgaga acattaaaaa acctcat 47

<210> 20

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> pSET4-F

<400> 20

gatacatgga atagtagtga tgttatacga aatggaaagc acta 44

<210> 21

<211> 44

<212> DNA

<213> Artificial Sequence

<220>

<223> pSET4-R

<400> 21

tagtgctttc catttcgtat aacatcacta ctattccatg tatc 44

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<220>

<223> YF

<400> 22

tgagaggagg gattattgaa t 21

<210> 23

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223> YR

<400> 23

gtcatagctg tttcctg 17

Claims (10)

1. A genetic engineering strain of streptococcus zooepidemicus is characterized by carrying an exogenous gene expression frame, wherein the exogenous gene expression frame comprises a first gene expression frame and a second gene expression frame,

wherein the first gene expression cassette comprises a first promoter and a hasA gene, the first promoter and the hasA gene being operably linked;

the second gene expression cassette includes a second promoter and a hasB gene, which are operably linked.

2. The genetically engineered strain of claim 1, wherein the first gene expression cassette and the second gene expression cassette are disposed on different constructs or on the same construct;

optionally, the construct comprises at least one selected from pSET4, pSET4s, pEU308, pDL 276;

optionally, the first gene expression cassette and the second gene expression cassette are disposed on the same construct, the 3 'end of the first gene expression cassette is linked to the 5' end of the second gene expression cassette or the 3 'end of the second gene expression cassette is linked to the 5' end of the first gene expression cassette.

3. The genetically engineered strain of claim 2, wherein the construct is an episomal pSET4 vector.

4. The genetically engineered strain of claim 1, wherein the first promoter promotes gene expression at a strength that is weaker than the strength of the second promoter promotes gene expression.

5. The genetically engineered strain of claim 1, wherein the first and second promoters are each independently selected from PGAPDH, PacK, PABC, or Pldh;

preferably, the first promoter is PABC and the second promoter is Pldh.

6. The genetically engineered strain of claim 1, wherein the initiation codon of the hasB gene is ATG.

7. The genetically engineered strain of claim 1, wherein the streptococcus zooepidemicus has a preservation number of CCTCC NO: M2020231.

8. A method for improving the synthesis of hyaluronic acid by streptococcus zooepidemicus is characterized in that the streptococcus zooepidemicus carries an exogenous gene expression frame, the exogenous gene expression frame comprises a first gene expression frame and a second gene expression frame,

wherein the first gene expression cassette comprises a first promoter and a hasA gene, the first promoter and the hasA gene being operably linked; the second gene expression cassette includes a second promoter and a hasB gene, which are operably linked.

9. The method of claim 8, wherein the first gene expression cassette and the second gene expression cassette are provided on different constructs or on the same construct;

optionally, the construct comprises at least one selected from pSET4, pSET4s, pEU308, pDL 276;

optionally, the first gene expression cassette and the second gene expression cassette are disposed on the same construct, the 3 'end of the first gene expression cassette is linked to the 5' end of the second gene expression cassette or the 3 'end of the second gene expression cassette is linked to the 5' end of the first gene expression cassette;

optionally, the construct is an episomal pSET4 vector;

optionally, the strength of the first promoter promoting gene expression is weaker than the strength of the second promoter promoting gene expression;

optionally, the first and second promoters are each independently selected from PABC or Pldh;

preferably, the first promoter is PABC and the second promoter is Pldh;

optionally, the initiation codon of the hasB gene is ATG;

optionally, allowing the Streptococcus zooepidemicus to carry an exogenous gene expression cassette is achieved by introducing a construct carrying the desired gene expression cassette into the Streptococcus zooepidemicus by electroporation.

10. A method for producing hyaluronic acid, characterized in that the genetically engineered strain of any one of claims 1 to 7 is subjected to a fermentation treatment to obtain the hyaluronic acid.

Images