CN111560383A

CN111560383A - Recombinant bacterium for promoting bacillus subtilis to synthesize menadione-7 and gene modification method thereof

Info

Publication number: CN111560383A
Application number: CN202010178402.6A
Authority: CN
Inventors: 宋浩; 杨绍梅; 张国银; 蔡志刚
Original assignee: Tianjin University Marine Technology Research Institute
Current assignee: Tianjin University Marine Technology Research Institute
Priority date: 2020-03-14
Filing date: 2020-03-14
Publication date: 2020-08-21

Abstract

The invention discloses a gene modification method for promoting bacillus subtilis to synthesize menadione-7, which comprises the following steps: firstly, constructing a starting strain BSMK _ 9; (II) overexpression of vitreoscilla hemoglobin genevgb. BSMK _9 derived from bacillus subtilis 168 is used as an original strain, the transmission of intracellular oxygen of cells is promoted and the utilization efficiency of the oxygen is improved by over-expressing vitreoscilla hemoglobin, and the influence of the vitreoscilla hemoglobin on MK-7 synthesis is inspected; and the maximum synthetic amount of MK-7 is promoted by optimizing carbon source combination and fermentation in a tank, so that a theoretical basis is provided for genetic modification and fermentation optimization of Bacillus natto to construct an MK-7 high-yield strain.

Description

Recombinant bacterium for promoting bacillus subtilis to synthesize menadione-7 and gene modification method thereof

The technical field is as follows:

the invention relates to a gene modification method for promoting bacillus subtilis to synthesize menadione-7 and a recombinant strain thereof, belonging to the field of biological genetic engineering.

Background art:

natural fat-soluble vitamin K includes vitamin K1 (also known as phylloquinone, PK) derived from plants and vitamin K2 (also known as menadione, MK) derived from bacteria. According to the number of isoprene units in the side chain, there are 14 kinds of menaquinones, which are marked as MK-n, and MK-4, MK-7 and the like are common. In prokaryotes, MK-n is involved in electron transport in the respiratory chain. For humans and other mammals, vitamin K, because it is an important cofactor for the translational conversion of glutamate residues of specific proteins in blood and bone to gamma-carboxyglutamic acid (Gla), serves to maintain calcium homeostasis, inhibit vascular wall calcification, support endothelial integrity, promote bone mineralization, and participate in tissue turnover and cell growth control. Common vitamin K-dependent proteins include coagulation factors (II, VII, IX, X and prothrombin), protein C and protein S, osteocalcin, Matrix Gla Protein (MGP), periostin, and the like. Studies have shown that, despite the high PK content in food, PK is less bioactive than MK-n (especially MK-7); long-chain MK-n, such as MK-7, has a more durable effect on normal coagulation than PK and MK-4. Therefore, due to its long half-life and high bioavailability, MK-7 is more popular in the food, pharmaceutical and health care industries and is widely used as a dietary supplement or a medicament for treating osteoporosis, arterial calcification, cardiovascular diseases, cancer, Parkinson's disease and the like.

Conventional MK-7 production methods include chemical synthesis and microbial fermentation. Although the process for producing MK-7 by a chemical synthesis method is continuously innovated, the defects of low yield, more byproducts, organic solvent residues, production environment danger and hidden danger of environmental protection are not completely solved, and the production and application of MK-7 are restricted. The large-scale and high-density continuous submerged fermentation (mainly based on bacillus natto fermentation) of microorganisms for producing MK-7 is more advantageous due to the characteristics of controllable quality, safety, greenness, naturalness and the like. Sato et al isolate strain B.subtilis from Japanese food natto, screen out menadione resistant strain by traditional mutagenesis, ferment in 7L tank for 4 days to produce 35mg/L MK-7; the selected diphenylamine resistant strain is put into a tank and fermented at 37 ℃ for 1 day and at 45 ℃ for 5 days to produce 60mg/L MK-7. The 1-hydroxy-2-naphthoic acid resistant mutant B.subtilis natto screened by Song et al can produce MK-7 of 3.593 +/-0.107 mg/L after being fermented in a 500mL bottle for 72 hours. Luo et al optimize the separated fermentation medium and fermentation conditions of the strain Bacillus natto and the extraction method of MK-7, and can produce 32.2mg/L MK-7 after fermenting in a 5L reactor for 72 hours. Recently, methods for improving MK-7 production in Bacillus amyloliquefaciens (Bacillus amyloliquefaciens) by metabolic pathway engineering have also been studied. Xu et al isolated 6 fibrinogen-producing B.amyloliquefaciens strains from Chinese fermented soybeans, and found that the strain B.amyloliquefaciens Y-2 was able to produce MK-7 at 7.1 + -0.5 mg/L. Sequence analysis indicated that the following six enzymes underwent missense mutations: MenA, MenC, MenD, MenE, MenH, HepS. By overexpressing these six enzymes of strain Y-2 in Bacillus subtilis 168, it was found that overexpression of MenA increased MK-7 levels by 1.6-fold over other enzymes; over-expression of these six enzymes by themselves in B.amyloliquefaciens Y-2 was found to result in the highest MK-7 production by over-expression of HepS, reaching 273 + -5.4 grams per Dry Cell Weight (DCW).

Disclosure of Invention

The invention aims to solve the technical problem of providing a gene modification method, and particularly relates to a method for cloning Vitreoscilla Hemoglobin (VHb) gene into bacillus subtilis and investigating the influence on the growth of a strain and the yield of MK-7.

The gene modification method for promoting bacillus subtilis to synthesize menadione-7 provided by the invention comprises the following steps:

construction of starting Strain BSMK _9

(1) Overexpression of menA Gene at the yxlA site on the B.subtilis chromosome

Firstly, using chromosome of B.subtilis 168 as a template, and respectively amplifying fragments U (1115bp), A (1057bp), D (1053bp) and G (806bp) by using primers yxlA-menA-U1/yxlA-menA-U2q, yxlA-menA-1q/yxlA-menA-2, yxlA-menA-D1q/yxlA-menA-D2 and yxlA-menA-G1 q/yxlA-menA-G2; the plasmid pUC57-1.8k-P1 was used as a template, and the promoter-containing P was amplified with primers yxlA-menA-P1/yxlA-menA-P2_lapSFragment P of (442 bp); fragment CR (2069bp) was amplified using primer yxlA-menA-CR1q/CR2, using chromosome of BS168NUm as a template. Then, splicing the segment U, P and A into a segment UPA (2614bp) by using a primer yxlA-menA-U1/yxlA-menA-2 through an overlapping PCR method; reuse primerThe fragment UPA and the fragment D are spliced into a fragment UPAD (3667bp) by yxlA-menA-U1/yxlA-menA-D2; finally, the fragment UPAD, the fragment CR and the fragment G are spliced into a fragment UPADCRG (6542bp) by using a primer yxlA-menA-U1/yxlA-menA-G2. And transforming the UPADCRG fragment into a competent cell of a recipient bacterium BS168NU, and finally obtaining a recombinant strain MK3 with menA gene integrated at a yxlA locus through two-step screening. Overexpression of dxs Gene at yjoB site, dxr Gene at ydeO site, yacM-yacN Gene at yqaL site, glpK Gene at pksJ site, glpD Gene at pksL site, aroG Gene at iolI site, pyrG Gene at iolE site, hepS Gene at yqaQ site of B.subtiis similar to overexpression of menA Gene at yxlA site.

(2) deletion of dhbB Gene

Using chromosome of B.subtilis 168 as template, respectively amplifying fragments U (1003bp), D (815bp) and G (605bp) by primers dhbB-U1/dhbB-U2, dhbB-D1q/dhbB-D2 and dhbB-G1 q/dhbB-G2; fragment CR (2069bp) carrying the selection cassette (cat-araR) was amplified with primer dhbB-CR1q/CR2 using chromosome of BS168NUm as template. Firstly, splicing the fragments U and D into UD (1818bp) by overlap PCR by using primers dhbB-U1/dhbB-D2; the three fragments UD, GR and G were then spliced into UDCRG (4492bp) by overlap PCR using primers dhbB-U1/dhbB-G2. And transforming the UDCRG fragment into a competent cell of a receptor bacterium MK3-MEP123, and finally screening to obtain a recombinant strain MK3-MEP 123-delta dhbB with a gene dhbB knocked out. The knockout of the mgsA gene and the araM gene is similar to that of dhbB. The recombinant strain BSMK _9 is finally obtained by sequentially over-expressing the 10 genes and knocking out 3 genes.

(II) overexpression of vitreoscilla hemoglobin gene vgb

Firstly, using chromosome of starting bacterium BSMK9 as template, respectively using primers cyd-vgb-U1/cyd-vgb-U2, cyd-vgb-D1/cyd-vgb-D2 and cyd-vgb-G1q/cyd-vgb-G2 to amplify fragments U (shown as SEQ ID No.11, 1149bp), D (shown as SEQ ID No.12, 1028bp) and G (shown as SEQ ID No.13, 1163 bp); using chromosome of BS168NUm as template, amplifying fragment CR (shown as SEQ ID No.14, 2069bp) by using primer cyd-vgb-CR1q/CR 2; plasmid pUC57-Simple-VHb is used as a template, and a primer cyd-vgb-1/cyd-vgb-2 is used for amplifying a fragment PV (689 bp shown as SEQ ID No. 15) containing a promoter TP2 expression cassette and a vitreoscilla hemoglobin gene vgb; then spliced into UPVDCRG (6058bp) by overlapping PCR method. UPVDCRG fragment is used to transform competent cells of receptor strain BSMK _9, and finally screening is carried out to obtain recombinant strain BSMK _11 with vgb gene integrated at cyd locus. UPVDCRG fragment sequence (shown as SEQ ID No. 16).

The PCR primer sequences are as follows

Primer	Number	Sequence(5'→3')
			cyd-vgb-U1	SEQ ID No.1	GTGACAGAACCGACAATAAG
cyd-vgb-U2	SEQ ID No.2	CCATCAACGCAACCATAAAC
			cyd-vgb-D1	SEQ ID No.3	CAGGAGCAGATTAGAGGAAA
cyd-vgb-D2	SEQ ID No.4	TGGATGGTAGATGCGAATG
			cyd-vgb-G1q	SEQ ID No.5	GCACGAAAACTGAATGAATAAGGAATCACAACCGATGAAA
cyd-vgb-G2	SEQ ID No.6	CACACCGCCAAGTATAGAA
			cyd-vgb-CR1q	SEQ ID No.7	ACATTCGCATCTACCATCCATCTTCAACTAAAGCACCCAT
CR2	SEQ ID No.8	TTATTCATTCAGTTTTCGTG
			cyd-vgb-1	SEQ ID No.9	GTTTATGGTTGCGTTGATGG
cyd-vgb-2	SEQ ID No.10	TTTCCTCTAATCTGCTCCTG

The sequences of primers and fragments overexpressing menA are disclosed in patent CN 108715824A.

The invention has the advantages of

The invention takes bacillus subtilis 168 as a starting bacterium, and sequentially overexpresses 1, 4-dihydroxy-2-naphthoic acid heptaene transferase (MenA), 1-deoxyxylulose-5-phosphate synthetase (Dxs) of a methylerythritol-4-phosphate pathway, 1-deoxyxylulose-5-phosphate reductoisomerase (Dxr), methylerythritol-4-phosphate cytidylyltransferase (YacM), methylerythritol-2, 4-cyclodiphosphate synthetase (YacN), glycerol kinase (GlpK), glycerol-1-phosphate dehydrogenase (GlpD), heterologous 3-deoxy-D-arabinose-7-phosphate heptulose synthetase (AroG) with feedback regulation and feedback regulation, cytidine triphosphate synthetase (PyrG) with feedback regulation and feedback regulation, and, Heptaene pyrophosphate synthetase I (HepS), genes dhbB (coding for isochorismate lyase), pyruvaldehyde synthetase (MgsA) and glycerol-1-phosphate synthetase (AraM) are knocked out, and a recombinant strain BSMK _9 is constructed. The invention takes BSMK _9 constructed in a laboratory as a starting bacterium, firstly overexpresses vitreoscilla hemoglobin (VHb), promotes the transmission of intracellular oxygen and improves the utilization efficiency of the oxygen, and inspects the influence of the vitreoscilla hemoglobin (VHb) on MK-7 synthesis; then, different carbon sources were additionally added to the medium: glycerol, glucose, sucrose, raffinose, sorbitol, mannitol, and their effects on MK-7 synthesis were examined; finally, the highest yield of MK-7 which can be produced by the constructed recombinant strain is determined through 5L tank fermentation, which provides a theoretical basis for industrially constructing the high-yield MK-7 strain of the bacillus natto through metabolic engineering and fermentation means in the future.

The effect of vitreoscilla hemoglobin expression on MK-7 synthesis has not been investigated so far. The BSMK-9 from bacillus subtilis 168, which is constructed in the laboratory of the applicant, is taken as a starting strain, the intracellular oxygen transmission and the oxygen utilization efficiency are promoted by over-expressing Vitreoscilla hemoglobin (VHb), and the influence of the BSMK-9 on MK-7 synthesis is inspected; and the maximum synthetic amount of MK-7 is promoted by optimizing carbon source combination and fermenting in a tank, so that a theoretical basis is provided for genetic modification and fermentation optimization of Bacillus natto to construct an MK-7 high-yield strain.

Description of the drawings:

FIG. 1 shows growth of the original strain BSMK _9 and the recombinant strain BSMK _11 (FIG. 1A) and a map of MK-7 production yield (FIG. 1B). FIG. 2 shows the effect of different carbon sources on MK-7 synthesis (FIG. 2A) and the effect of different concentrations of sucrose on MK-7 synthesis (FIG. 2B).

FIG. 3 is a graph showing cell growth and MK-7 productivity when recombinant bacteria BSMK _11 were fermented in a 5L tank.

The specific implementation mode is as follows:

example 1

The embodiment provides a gene modification method for promoting bacillus subtilis to synthesize menadione-7, which comprises the following steps:

materials (I) and (II)

Strains, plasmids and media

The information on all strains and plasmids involved in the present invention is detailed in Table 1.

LB medium (peptone 10g/L, yeast extract 5g/L, sodium chloride 10g/L) was used for general culture of B.subtilis, and solid medium was supplemented with 15g/L agar powder, neomycin 16. mu.g/mL, or chloramphenicol 8. mu.g/mL, as needed. Fermentation medium: 30mL/L of glycerol, 60g/L of soybean peptone, 5g/L of yeast extract and K₂HPO₄3g/L，MgSO₄·7H₂O 0.5g/L，pH7.3。

Table 1 strains and plasmids involved in the experiment

Reagent and instrument

FastTaq enzyme, Hifi DNA polymerase and dNTP were purchased from Beijing Quanjin Biotechnology Ltd; standard MK-7 was purchased from ChromaDex; the other biochemical reagents are imported or domestic analytical pure reagents. The apparatus used was: vortex mixer, vacuum centrifugal concentrator, high performance liquid chromatograph (Shimadzu).

Primers used for PCR are shown in Table 2.

TABLE 2 PCR primer sequences

Second, method

DNA manipulation

All DNA fragments were from PCR amplification; the DNA fragments used for transformation are spliced by adopting an overlapping PCR method. B. The preparation and transformation of the subtilis competent cells are performed by Spizzen method. Both gene overexpression and gene knockdown on chromosomes employ label-free modification methods, i.e., the use of a counter-selection cassette (P)_araNeo) and selection cassette (cat-araR). Primer synthesis and DNA sequencing were both responsible for Jinweizhi Biotechnology, Inc. (Suzhou, China). Gene synthesis was performed by Kingsry Biotechnology Ltd (Nanjing, China).

The method comprises the following specific steps

Construction of starting Strain BSMK _9

Overexpression of the menA gene at the yxlA locus on the chromosome of B.subtilis. Firstly, using chromosome of B.subtilis 168 as a template, and respectively amplifying fragments U (1115bp), A (1057bp), D (1053bp) and G (806bp) by using primers yxlA-menA-U1/yxlA-menA-U2q, yxlA-menA-1q/yxlA-menA-2, yxlA-menA-D1q/yxlA-menA-D2, yxlA-menA-G1 q/yxlA-menA-G2; the plasmid pUC57-1.8k-P1 was used as a template, and the promoter-containing P was amplified with primers yxlA-menA-P1/yxlA-menA-P2_lapSFragment P of (442 bp); fragment CR (2069bp) was amplified using a primer yxlA-menA-CR1q/CR2, using a chromosome of BS168NUm stored in the laboratory as a template. Then, splicing the segment U, P and A into a segment UPA (2614bp) by using a primer yxlA-menA-U1/yxlA-menA-2 through an overlapping PCR method; then the fragment UPA and the fragment D are spliced into a fragment UPAD (3667bp) by using a primer yxlA-menA-U1/yxlA-menA-D2; finally, the guide is utilizedThe yxlA-menA-U1/yxlA-menA-G2 spliced fragment UPAD, fragment CR and fragment G into fragment UPADCRG (6542 bp). And transforming the UPADCRG fragment into a competent cell of a recipient bacterium BS168NU, and finally obtaining a recombinant strain MK3 with menA gene integrated at a yxlA locus through two-step screening. Overexpression of dxs Gene at yjoB site, dxr Gene at ydeO site, yacM-yacN Gene at yqaL site, glpK Gene at pksJ site, glpD Gene at pksL site, aroG Gene at iolI site, pyrG Gene at iolE site, hepS Gene at yqaQ site of B.subtiis similar to overexpression of menA Gene at yxlA site.

deletion of dhbB Gene. Using chromosome of B.subtilis 168 as template, respectively amplifying fragments U (1003bp), D (815bp) and G (605bp) by primers dhbB-U1/dhbB-U2, dhbB-D1q/dhbB-D2 and dhbB-G1 q/dhbB-G2; fragment CR (2069bp) carrying the selection cassette (cat-araR) was amplified with primer dhbB-CR1q/CR2 using chromosome of BS168NUm as template. Fragments U and D were first spliced by overlap PCR into UD (1818bp) using primers dhbB-U1/dhbB-D2; the three fragments UD, GR and G were then spliced into UDCRG (4492bp) by the overlap PCR method using primers dhbB-U1/dhbB-G2. And transforming the UDCRG fragment into competent cells of receptor bacteria MK3-MEP123, and finally screening to obtain a recombinant strain MK3-MEP 123-delta dhbB with a gene dhbB knocked out. The knockout of the mgsA gene and the araM gene is similar to that of dhbB. The recombinant strain BSMK _9 is finally obtained by sequentially over-expressing the 10 genes and knocking out 3 genes.

(II) overexpression of vitreoscilla hemoglobin gene vgb

The cyd locus of the B.subtilis chromosome was selected to overexpress the vgb gene, which is not involved in the MK-7 synthesis pathway and whose knock-out did not affect the normal growth characteristics of the cells and did not affect MK-7 production as demonstrated in this laboratory. Firstly, using chromosome of starting bacterium BSMK9 as template, respectively amplifying fragment U (1149 bp shown by SEQ ID No. 11), D (1028 bp shown by SEQ ID No. 12) and G (1163 bp shown by SEQ ID No. 13) by using primers cyd-vgb-U1/cyd-vgb-U2, cyd-vgb-D1/cyd-vgb-D2 and cyd-vgb-G1 q/cyd-vgb-G2; using chromosome of BS168NUm as template, amplifying fragment CR (shown as SEQ ID No.14, 2069bp) by using primer cyd-vgb-CR1q/CR 2; plasmid pUC57-Simple-VHb is used as a template, and a primer cyd-vgb-1/cyd-vgb-2 is used for amplifying a fragment PV (shown as SEQ ID No.15, 689bp) containing a promoter TP2 expression cassette and a Vibrio lucidus hemoglobin gene vgb; then spliced into UPVDCRG (6058bp) by overlapping PCR method. UPVDCRG fragment is used for transforming competent cells of recipient bacterium BSMK _9, and finally, recombinant strain BSMK _11 with vgb gene integrated at cyd locus is obtained through screening. UPVDCRG fragment sequence (shown as SEQ ID No. 16).

Example 2 cultivation of recombinant Strain BSMK _11

The shake flask fermentation culture and the determination of the thallus growth, the fermentation medium and the fermentation conditions are shown in Table 3.

TABLE 3 fermentation media and fermentation conditions

Parameter(s)	Range of
		Glycerol	20～80mL/L
Soybean peptone
		60～180g/L
Yeast extract
		0～20g/L
K₂HPO₄			1～5g/L
	MgSO₄·7H₂O	0.1～0.8g/L
pH			6.5～7.5
	Amount of inoculation	1％～6％
Temperature of			35～45℃
	Rotational speed	100～250r/min
Time of fermentation			72-144h

500mL shake flask fermentation: selecting a newly activated plate single colony, inoculating the newly activated plate single colony into a 250mL shake flask filled with 30mL LB culture medium, and carrying out shake culture at 37 ℃ for 14h at 200 r/min; inoculating into 500mL conical flask (three parallel) containing 50mL fermentation medium at 1% inoculum size, and shake culturing at 220r/min at 37 deg.C under dark condition for 120 h.

Determination of biomass: sampling after fermenting for 6h, then sampling after 24h, taking a proper amount of fermentation liquor every 24h, centrifuging for 1min at 13000r/min to precipitate cells, washing, then re-suspending, diluting by proper times, and determining OD of the bacterial suspension₆₀₀The value is obtained.

Extraction and HPLC detection of MK-7:

taking 750 mu L of 96h fermentation liquor, adding 1mL of isopropanol and 2mL of n-hexane, shaking for 2min by vortex, centrifuging at 5000r/min and 4 ℃ for 6min, taking 1mL of supernatant, carrying out vacuum centrifugal concentration, and finally adding 750 mu L of methanol for dissolving. Filtering with 0.25 μm filter membrane, and detecting by HPLC, wherein the process should be protected from light.

Chromatographic conditions are as follows: column, Shim-pack GIST C18 column (250 mm. times.4.6 mm, 5 μm); a detector, ShimadzuSPD-20A; mobile phase, pure methanol; column temperature, 50 ℃; the detection wavelength is 270 nm; the flow rate was 1.0 mL/min. The quantitative method comprises the following steps: a standard solution of the standard MK-7 was assayed under the same chromatographic conditions, and MK-7 was quantified by plotting a concentration-peak area standard curve.

The invention promotes the intracellular oxygen transmission and improves the utilization efficiency of oxygen by over-expressing vitreoscilla hemoglobin, and considers the influence of the vitreoscilla hemoglobin on the growth of thalli and the synthesis of MK-7. As is clear from Table 4, the growth tendency of the recombinant bacteria was almost unchanged but the growth thereof was increased as compared with the growth of the initial bacteria. As shown in Table 5, after fermentation for 96h, the MK-7 yield of the starting strain is 80.2mg/L, and the MK-7 yield of the recombinant strain is 86.0mg/L, which is 7.2% higher than that of the starting strain. The research result shows that the overexpression of vitreoscilla hemoglobin (VHb) can promote the growth of the recombinant strain and the synthesis of MK-7. As shown in particular in figure 1.

TABLE 4 growth of the cells

Note:^*shows significant difference (P < 0.05) compared with the starting strain BSMK _ 9;^#shows very significant difference (P < 0.01) compared with the starting strain BSMK _ 9.

TABLE 5MK-7 production

Example 3 carbon source optimization

As can be seen from Table 4, the growth of the starting strain BSMK _9 decreased after 48h of fermentation, and then decreased, i.e., secondary growth occurred, indicating that the carbon source, glycerol, was exhausted, and then the soybean peptone provided a carbon source to satisfy the growth requirements of Bacillus subtilis in addition to the nitrogen source. In order to further increase MK-7 production, 1.0% of glycerol, glucose, sucrose, raffinose, sorbitol and mannitol are added into the fermentation medium respectively. As can be seen from Table 6, addition of glycerol resulted in an 8.3% reduction in MK-7 production from the initial conditions, indicating that the presence of 3.0% glycerol in the fermentation medium was most favorable for MK-7 synthesis; in addition, the addition of glucose, raffinose or mannitol also results in reduced MK-7 production; however, the addition of sucrose and sorbitol resulted in 9.5% and 8.0% increase in MK-7 production, respectively.

To determine the optimal concentration of sucrose for MK-7 synthesis, the present invention adds 0.5%, 1.0%, 1.5%, and 2.0% sucrose, respectively, to the fermentation medium. As shown in Table 7, MK-7 produced the highest amount of 94.2mg/L at a sucrose concentration of 1.0%. The results of the study indicated that the presence of 3.0% glycerol and 1.0% in the fermentation medium is the optimal carbon source combination for MK-7 synthesis. As shown in particular in fig. 2.

TABLE 6 Effect of adding 1.0% of different carbon sources to the fermentation Medium on MK-7 Synthesis

Kind of carbon source	MK-7 yield (mg/L)
		Control	86.0±1.8
Glycerol	78.9^*±0.7
		Glucose	65.5^#±0.4
Sucrose	94.2^#±1.3
		Cotton seed candy	83.8±1.3
Sorbitol	92.9^*±1.1
		Mannitol	85.3±0.8

Note:^*shows significant differences (P < 0.05) compared to control conditions;^#show a very significant difference (P < 0.01) compared to the control conditions.

TABLE 7 Effect of adding different ratios of sucrose to the fermentation Medium on MK-7 Synthesis

Ratio of sucrose	MK-7 yield (mg/L)
		0.5％	86.6±0.1
1.0％	94.2±1.3
		1.5％	65.0±1.5
2.0％	56.9±0.4

Example 4 cultivation in 5L tank fermentation

To further promote MK-7 production, recombinant bacteria BSMK _11 were selected for fermentation in a 5L tank. This is achieved byInitial fermentation medium: 30mL/L of glycerol, 10g/L of sucrose, 60g/L of soybean peptone, 5g/L of yeast extract and K₂HPO₄3g/L，MgSO₄·7H₂O0.5 g/L, pH 7.3; the inoculation amount is 10 percent; the fermentation temperature is 37 ℃; the rotating speed is 800 r/min; the fermentation time was 144 h. As is clear from Table 8, 14 hours after fermentation, the cells entered the stationary phase of growth, at which time feeding was started, feed medium: 135mL/L of glycerol, 45g/L of sucrose and 270g/L of soybean peptone; after fermentation for 144h, cell growth decreased, at which time the total volume of fermentation in the 5L tank was about 4L. As can be seen from Table 9, MK-7 yields increased gradually with increasing fermentation time, and after 132h of fermentation, the yield reached a maximum of 281.4mg/L, which is nearly 3 times the yield of fermentation in a 500mL shake flask. As shown in particular in figure 3.

Extracellular secretion of MK-7 assay: taking 1mL of fermentation broth of 108h, 120h, 132h and 144h respectively, centrifuging at 13000r/min for 8min, taking 750 mu L of supernatant, adding 1mL of isopropanol and 2mL of n-hexane, shaking in a vortex for 2min, centrifuging at 5000r/min and 4 ℃ for 6min, taking 1mL of supernatant, carrying out vacuum centrifugal concentration, and finally adding 375 mu L of methanol for dissolution. Filtering through a 0.25 mu m filter membrane, and taking the filtrate for HPLC detection. All procedures should be protected from light as much as possible.

Determination of the dry cell weight: taking 1mL of fermentation liquid of 108h, 120h, 132h and 144h respectively, centrifuging at 13000r/min for 8min, removing supernatant as much as possible, washing collected cell sediment twice by using sterile water and drying until the weight is not changed any more.

Previous researches show that the bacillus subtilis and the bacillus natto produce vitamin K in the fermentation culture process₂Can be combined with a specific acidic factor to form a soluble complex which is secreted to the outside of cells. As is clear from Table 10, MK-7 secreted extracellularly during fermentation was very small and increased slightly with the duration of fermentation; after 132h of fermentation, MK-7 is produced at 12.0 mg/g DCW expressed as dry cell weight.

TABLE 8 growth of the cells

TABLE 9 MK-7 yields

Fermentation time (h)	MK-7 yield (mg/L)
		6	10.2±0.3
12	31.8±0.3
		23.8	58.0±1.4
35.8	70.0±1.6
		48.1	94.5±0.6
60	126.2±0.9
		72	169.5±1.6
84	190.2±2.5
		96	208.6±2.8
108	230.0±3.1
		120	253.1±4.4
132	281.4±5.0
		144	272.7±3.6

Table 10 shows the amounts of extracellular MK-7 secreted by the recombinant strain BSMK _11 after fermentation for 108h, 120h, 132h and 144h in a 5L tank, the dry cell weights at the time, and the MK-7 yields expressed as the dry cell weights.

Watch 10

Sequence listing

<110> Qingdao ocean technology research institute of Tianjin university

<120> recombinant bacterium for promoting bacillus subtilis to synthesize menadione-7 and gene modification method thereof

<160>16

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gtgacagaac cgacaataag 20

<210>2

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

ccatcaacgc aaccataaac 20

<210>3

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

caggagcaga ttagaggaaa 20

<210>4

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

tggatggtag atgcgaatg 19

<210>5

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

gcacgaaaac tgaatgaata aggaatcaca accgatgaaa 40

<210>6

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

cacaccgcca agtatagaa 19

<210>7

<211>40

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>7

acattcgcat ctaccatcca tcttcaacta aagcacccat 40

<210>8

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>8

ttattcattc agttttcgtg 20

<210>9

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>9

gtttatggtt gcgttgatgg 20

<210>10

<211>20

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>10

tttcctctaa tctgctcctg 20

<210>11

<211>1149

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>11

gtgacagaac cgacaataag cggaataaag attttcatga atgcttttac gagtgtttct 60

cttttcatgc cgagaatgct tccgacgaca ataccggcga taaacaaata tagaaagttt 120

gagttttctg taaattctgt ggtggatttg acgatatcat taggcagcag gtgatagtac 180

acgacagcgg acggaataaa agtagctagg atggccgggc cgccgataga acgaacaatc 240

ggtatcgatt tgccgatttg ggcaaaggta aacccgaaaa acgccatgac ggcaatggat 300

gtcaaaatgt cactttttac atcgtgatgc ataacaaaaa cagtgattaa tataaacagc 360

aaggcataca caggaagcgg tatgatgcct acttttatat tcatggcttt cgcaaaccaa 420

ttctcttttc gaaccccttc gtgaattgta tccgtttgca attgcatgtg tgtttgaagc 480

tctcccattg aaaaacctcc cctattcttg atgcagtgaa attgttcact atgttaagta 540

tactaaaaaa ttgaaattat taatatatta aaaatttact attcaacttt tctcctctta 600

ccggttcaaa tgaaaagagg cattctgact aaaatcggtt taagacggaa tgctgagact 660

cgagtgctgg ggcgggggca agcattttgt tcgcaaggaa cgatgtgttg atgtacgata 720

ataaagggtc atttatccta gcagccgaca taaataagca acaaaataga caaaaatccg 780

tcacatagtg cgggactttt taggtatttt aggctttatt tttgaaatga atcgttgtaa 840

agtacttaat atgaaccagt cagagattgt gtcatttggt cagtctggca atcttgcatc 900

atattggatg actttttgac acatttgtga aatattgagc aatatttttt tcgtctattt 960

tgtgaattac tgatcaaagt ctcggttcta tttgtgaagt agtgagcaaa ttaacagttt 1020

taaccggaaa tggaggagaa agcatgagtg aattggtatt agcccgcata caatttgcat 1080

caacaacgtt gtttcacttc ttgtttgtgc cgatgtctat cgggcttgtg tttatggttg 1140

cgttgatgg 1149

<210>12

<211>1028

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>12

caggagcaga ttagaggaaa agttttcttg atcagctgtt ccgattaggc ccccgctttg 60

caaagaaaga ggggacgggg caaatggtga cgctggcgat ggaaggcatc agccagttcc 120

gccgctacct ggagctgttt ctgccgaaaa tggtcagcat ggcgattgtg cctgcggcag 180

ttgtcattta tgtgtttttt caggatcgga catcagccat cattttagtc gctgctatgc 240

cgattctgat catctttatg attctcctcg gccttgtcgc gcagagaaaa gcggatcgtc 300

agtggaaatc ctatcagaga ctttccaatc attttgttga ttctcttcgc gggctggaga 360

cattgcgttt cctaggtttg agcaagtcac acagcaaaaa tattttctat gtgagtgagc 420

ggtatcgcaa ggcaacgatg agcacactcc gggtggcgtt tttgtcatca ttcgccctcg 480

attttttcac gatgctgtcg gtggcgacag tcgcagtatt tctgggcctg cgcctcattg 540

acggcgatat tttgcttggc cctgctttaa cggcgcttat tctggcgcct gagtattttt 600

tgccggtgcg ggaagtgggg aatgattatc atgcaacgct gaacggccag gaagcaggaa 660

aaaccattca agagattttg tcgcagcctg gttttaaaga agagacgccg cttcagctcg 720

aagcttggtc cgatcaggat gagctgaagc tgtcaggcgt gtcagtcggc cgttcggtgt 780

ctgatattca tctctcattc aaaggcaaga aaaaaatcgg cattatcggt gcaagcggcg 840

ccggaaaatc aacattaatt gatattctcg gcggattttt agagccggat ggcgggatga 900

ttgaggttaa tggtacaagc cggtcccatt tgcaggacgg cagctggcag aagaaccttc 960

tttacattcc ccagcatccg tacatttttg atgatacgct tggcaacaac attcgcatct 1020

accatcca 1028

<210>13

<211>1163

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>13

ggaatcacaa ccgatgaaaa tggctgccag tgaaggccta tgggaagaca gcggtgaccc 60

tgctgcttgg accgcttttg cgacgatcga tacaaaaaat gaaaaaagct caaatgaaat 120

caaagttcct tatgccttga gctacttggc ttatcagaaa ttcagcggaa gtgtcaaagg 180

gatgaaaacc cttcaggctg agtacgaaaa aatatacgga aaaggcgact acattccgcc 240

agtgaaaacg acattctgga gcttccgcat catggtagga gcaggtgttg tcatgattct 300

tgctgcgtta ggcggccttt ggttaaaccg ccgtaaaaag cttgaaaaca gcaaatggta 360

tttgcgcatc atgatcgcgt tgatttcctt cccgtttctt gcaaactccg cgggctggat 420

tatgacagaa atcggacgtc agccttggac ggttatgggg ttaatgacaa ccgctcaatc 480

tgtgtcgcct aacgtaacag cgggttcctt gttattctca atcatcgcat tcggtgtgat 540

gtacatgatt cttggtgcactgcttgtctt cttgtttatc cgtgagatta aaaaaggtgc 600

ggagcatgat aatcatcatg atgtgcctgt atcaacagat ccatttagtc aggaggtata 660

ccatggcatc tcttcatgat ctttggttta tactcgttgc tgtattgttt gtaggattct 720

tctttttgga aggctttgat ttcggggtcg gcatggcgac ccgttttctt ggccataatg 780

aattagaacg cagagtgctg atcaacacga tcgggccgtt ctgggacgcg aatgaagtgt 840

ggcttttgac tggcgcaggc gccattttcg cggcattccc aaactggtat gcaacgatgc 900

tgagcggtta ttacattccg tttgtcatag tgctgcttgc gttaatgggc cgcggggtcg 960

cgtttgagtt ccgcggcaag gtggatcatt taaaatgggt aaaggtttgg gactgggtcg 1020

tttttttcgg cagtctaatt cctccgtttg tgcttggtgt gctgttcacg acattattcc 1080

gcgggatgcc gattgatgcc gacatgaaca ttcacgcaca tgtatctgat tatatcaatg 1140

tatattctat acttggcggt gtg 1163

<210>14

<211>2069

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>14

tcttcaacta aagcacccat tagttcaaca aacgaaaatt ggataaagtg ggatattttt 60

aaaatatata tttatgttac agtaatattg acttttaaaa aaggattgat tctaatgaag 120

aaagcagaca agtaagcctc ctaaattcac tttagataaa aatttaggag gcatatcaaa 180

tgaactttaa taaaattgat ttagacaatt ggaagagaaa agagatattt aatcattatt 240

tgaaccaaca aacgactttt agtataacca cagaaattga tattagtgtt ttataccgaa 300

acataaaaca agaaggatat aaattttacc ctgcatttat tttcttagtg acaagggtga 360

taaactcaaa tacagctttt agaactggtt acaatagcga cggagagtta ggttattggg 420

ataagttaga gccactttat acaatttttg atggtgtatc taaaacattc tctggtattt 480

ggactcctgt aaagaatgac ttcaaagagt tttatgattt atacctttct gatgtagaga 540

aatataatgg ttcggggaaa ttgtttccca aaacacctat acctgaaaat gctttttctc 600

tttctattat tccatggact tcatttactg ggtttaactt aaatatcaat aataatagta 660

attaccttct acccattatt acagcaggaa aattcattaa taaaggtaat tcaatatatt 720

taccgctatc tttacaggta catcattctg tttgtgatgg ttatcatgca ggattgttta 780

tgaactctat tcaggaattg tcagataggc ctaatgactg gcttttataa tatgagataa 840

tgccgactgt actttttaca gtcggttttc taatgtcact aacctgcccc gttagttgaa 900

ggcattttct gtcaatgttt tcttacaaag aacgctgtga tatactgaaa tttgtccgta 960

tacattttgg aggaatggat atgttaccaa aatacgcgca agtaaaagaa gaaatcagtt 1020

cttggattaa tcaaggcaaa atactgcccg atcaaaaaat ccctaccgaa aacgaattaa 1080

tgcagcaatt cggcgtcagc cggcatacca tccgcaaagc gatcggagac ctcgtatcac 1140

aaggtctgct gtacagcgtg caaggcggag gcacctttgt cgcttcacgc tctgctaagt 1200

cagcgctgca ttccaataaa acgatcggtg ttttgacaac ttacatatca gactatattt 1260

tcccgagcat catcagagga atcgagtcct atttaagcga gcaggggtat tctatgcttt 1320

tgacaagcac aaacaacaac ccggacaatg aaagaagagg cttagaaaac ctgctgtccc 1380

agcatattga cggactcatcgtagaaccga caaaaagcgc ccttcaaacc ccaaacatcg 1440

gctattatct gaacttggag aaaaacggca ttccttttgc gatgattaac gcgtcatatg 1500

ccgagcttgc cgcgccaagt tttaccttgg atgatgtgaa aggcgggatg atggcggcgg 1560

agcatttgct ttctctcggc cacacgcata tgatgggtat ttttaaagct gatgacacac 1620

aaggcgtgaa acggatgaac ggatttatac aggcgcaccg ggagcgtgag ttgtttcctt 1680

ctccggatat gatcgtgaca tttacaacgg aagaaaaaga atcaaaactt ctggagaaag 1740

taaaagccac actggagaaa aacagcaagc acatgccgac agccattctt tgttataacg 1800

atgaaattgc gctgaaggtg attgatatgc tgagggagat ggatcttaaa gtgccggagg 1860

atatgtctat tgtcgggtac gatgattcac atttcgccca aatctcagaa gtgaaactaa 1920

cctctgtcaa acatccgaaa tcagtgcttg gaaaagcagc cgccaaatat gtcattgact 1980

gcttagagca taaaaagccg aagcaagagg atgtcatatt tgagcctgag ttgatcattc 2040

gccagtccgc acgaaaactg aatgaataa 2069

<210>15

<211>2009

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>15

tcttcaacta aagcacccat tagttcaaca aacgaaaatt ggataaagtg ggatattttt 60

aaaatatata tttatgttac agtaatattg acttttaaaa aaggattgat tctaatgaag 120

aaagcagaca agtaagcctc ctaaattcac tttagataaa aatttaggag gcatatcaaa 180

tgaactttaa taaaattgat ttagacaatt ggaagagaaa agagatattt aatcattatt 240

tgaaccaaca aacgactttt agtataacca cagaaattga tattagtgtt ttataccgaa 300

acataaaaca agaaggatat aaattttacc ctgcatttat tttcttagtg acaagggtga 360

taaactcaaa tacagctttt agaactggtt acaatagcga cggagagtta ggttattggg 420

ataagttaga gccactttat acaatttttg atggtgtatc taaaacattc tctggtattt 480

ggactcctgt aaagaatgac ttcaaagagt tttatgattt atacctttct gatgtagaga 540

aatataatgg ttcggggaaa ttgtttccca aaacacctat acctgaaaat gctttttctc 600

tttctattat tccatggact tcatttactg ggtttaactt aaatatcaat aataatagta 660

attaccttct acccattatt acagcaggaa aattcattaa taaaggtaat tcaatatatt 720

taccgctatc tttacaggta catcattctg tttgtgatgg ttatcatgca ggattgttta 780

tgaactctat tcaggaattg tcagataggc ctaatgactg gcttttataa tatgagataa 840

tgccgactgt actttttaca gtcggttttc taatgtcact aacctgcccc gttagttgaa 900

ggcattttct gtcaatgttt tcttacaaag aacgctgtga tatactgaaa tttgtccgta 960

tacattttgg aggaatggat atgttaccaa aatacgcgca agtaaaagaa gaaatcagtt 1020

cttggattaa tcaaggcaaa atactgcccg atcaaaaaat ccctaccgaa aacgaattaa 1080

tgcagcaatt cggcgtcagc cggcatacca tccgcaaagc gatcggagac ctcgtatcac 1140

aaggtctgct gtacagcgtg caaggcggag gcacctttgt cgcttcacgc tctgctaagt 1200

cagcgctgca ttccaataaa acgatcggtg ttttgacaac ttacatatca gactatattt 1260

tcccgagcat catcagagga atcgagtcct atttaagcga gcaggggtat tctatgcttt 1320

gtttatggtt gcgttgatgg ttaaatctca aaaaggtgtt gacattcaaa acaaaatatg 1380

gtataatgcc cccaaaatcg caaaaaagtg ttgacaactt aactcagatc tggtataata 1440

gaaacacaga atagtctttt aagtaagtct actctgaatt tttttaaaag gagagggtaa 1500

agaatgcttg atcaacaaac aatcaacatc atcaaagcta cagttcctgt tcttaaagaa 1560

catggcgtta caatcacaac aacattctac aaaaaccttt tcgctaaaca tcctgaagtt 1620

cgtcctcttt tcgatatggg ccgtcaagaa tctcttgaac aacctaaagc tcttgctatg 1680

acagttcttg ctgctgctca aaacatcgaa aaccttcctg ctatccttcc tgctgttaaa 1740

aaaatcgctg ttaaacattg ccaagctggc gttgctgctg ctcattaccc tatcgttggc 1800

caagaacttc ttggcgctat caaagaagtt cttggcgatg ctgctacaga tgatatcctt 1860

gatgcttggg gcaaagctta cggcgttata gcggatgtgt tcatccaagt agaagctgat 1920

ctttacgctc aagctgttga ataagctttt gaaagaggat gagtcaaatc atcctctttt 1980

tcttgtttac aggagcagat tagaggaaa 2009

<210>16

<211>6058

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>16

gtgacagaac cgacaataag cggaataaag attttcatga atgcttttac gagtgtttct 60

cttttcatgc cgagaatgct tccgacgaca ataccggcga taaacaaata tagaaagttt 120

gagttttctg taaattctgt ggtggatttg acgatatcat taggcagcag gtgatagtac 180

acgacagcgg acggaataaa agtagctagg atggccgggc cgccgataga acgaacaatc 240

ggtatcgatt tgccgatttg ggcaaaggta aacccgaaaa acgccatgac ggcaatggat 300

gtcaaaatgt cactttttac atcgtgatgc ataacaaaaa cagtgattaa tataaacagc 360

aaggcataca caggaagcgg tatgatgcct acttttatat tcatggcttt cgcaaaccaa 420

ttctcttttc gaaccccttc gtgaattgta tccgtttgca attgcatgtg tgtttgaagc 480

tctcccattg aaaaacctcc cctattcttg atgcagtgaa attgttcact atgttaagta 540

tactaaaaaa ttgaaattat taatatatta aaaatttact attcaacttt tctcctctta 600

ccggttcaaa tgaaaagagg cattctgact aaaatcggtt taagacggaa tgctgagact 660

cgagtgctgg ggcgggggca agcattttgt tcgcaaggaa cgatgtgttg atgtacgata 720

ataaagggtc atttatccta gcagccgaca taaataagca acaaaataga caaaaatccg 780

tcacatagtg cgggactttt taggtatttt aggctttatt tttgaaatga atcgttgtaa 840

agtacttaat atgaaccagt cagagattgt gtcatttggt cagtctggca atcttgcatc 900

atattggatg actttttgac acatttgtga aatattgagc aatatttttt tcgtctattt 960

tgtgaattac tgatcaaagt ctcggttcta tttgtgaagt agtgagcaaa ttaacagttt 1020

taaccggaaa tggaggagaa agcatgagtg aattggtatt agcccgcata caatttgcat 1080

caacaacgtt gtttcacttc ttgtttgtgc cgatgtctat cgggcttgtg tttatggttg 1140

cgttgatggt taaatctcaa aaaggtgttg acattcaaaa caaaatatgg tataatgccc 1200

ccaaaatcgc aaaaaagtgt tgacaactta actcagatct ggtataatag aaacacagaa 1260

tagtctttta agtaagtcta ctctgaattt ttttaaaagg agagggtaaa gaatgcttga 1320

tcaacaaaca atcaacatca tcaaagctac agttcctgtt cttaaagaac atggcgttac 1380

aatcacaaca acattctaca aaaacctttt cgctaaacat cctgaagttc gtcctctttt 1440

cgatatgggc cgtcaagaat ctcttgaaca acctaaagct cttgctatga cagttcttgc 1500

tgctgctcaa aacatcgaaa accttcctgc tatccttcct gctgttaaaa aaatcgctgt 1560

taaacattgc caagctggcg ttgctgctgc tcattaccct atcgttggcc aagaacttct 1620

tggcgctatc aaagaagttc ttggcgatgc tgctacagat gatatccttg atgcttgggg 1680

caaagcttac ggcgttatag cggatgtgtt catccaagta gaagctgatc tttacgctca 1740

agctgttgaa taagcttttg aaagaggatg agtcaaatca tcctcttttt cttgtttaca 1800

ggagcagatt agaggaaaag ttttcttgat cagctgttcc gattaggccc ccgctttgca 1860

aagaaagagg ggacggggca aatggtgacg ctggcgatgg aaggcatcag ccagttccgc 1920

cgctacctgg agctgtttct gccgaaaatg gtcagcatgg cgattgtgcc tgcggcagtt 1980

gtcatttatg tgttttttca ggatcggaca tcagccatca ttttagtcgc tgctatgccg 2040

attctgatca tctttatgat tctcctcggc cttgtcgcgc agagaaaagc ggatcgtcag 2100

tggaaatcct atcagagact ttccaatcat tttgttgatt ctcttcgcgg gctggagaca 2160

ttgcgtttcc taggtttgag caagtcacac agcaaaaata ttttctatgt gagtgagcgg 2220

tatcgcaagg caacgatgag cacactccgg gtggcgtttt tgtcatcatt cgccctcgat 2280

tttttcacga tgctgtcggt ggcgacagtc gcagtatttc tgggcctgcg cctcattgac 2340

ggcgatattt tgcttggccc tgctttaacg gcgcttattc tggcgcctga gtattttttg 2400

ccggtgcggg aagtggggaa tgattatcat gcaacgctga acggccagga agcaggaaaa 2460

accattcaag agattttgtc gcagcctggt tttaaagaag agacgccgct tcagctcgaa 2520

gcttggtccg atcaggatga gctgaagctg tcaggcgtgt cagtcggccg ttcggtgtct 2580

gatattcatc tctcattcaa aggcaagaaa aaaatcggca ttatcggtgc aagcggcgcc 2640

ggaaaatcaa cattaattga tattctcggc ggatttttag agccggatgg cgggatgatt 2700

gaggttaatg gtacaagccg gtcccatttg caggacggca gctggcagaa gaaccttctt 2760

tacattcccc agcatccgta catttttgat gatacgcttg gcaacaacat tcgcatctac 2820

catccatctt caactaaagc acccattagt tcaacaaacg aaaattggat aaagtgggat 2880

atttttaaaa tatatattta tgttacagta atattgactt ttaaaaaagg attgattcta 2940

atgaagaaag cagacaagta agcctcctaa attcacttta gataaaaatt taggaggcat 3000

atcaaatgaa ctttaataaa attgatttag acaattggaa gagaaaagag atatttaatc 3060

attatttgaa ccaacaaacg acttttagta taaccacaga aattgatatt agtgttttat 3120

accgaaacat aaaacaagaa ggatataaat tttaccctgc atttattttc ttagtgacaa 3180

gggtgataaa ctcaaataca gcttttagaa ctggttacaa tagcgacgga gagttaggtt 3240

attgggataa gttagagcca ctttatacaa tttttgatgg tgtatctaaa acattctctg 3300

gtatttggac tcctgtaaag aatgacttca aagagtttta tgatttatac ctttctgatg 3360

tagagaaata taatggttcg gggaaattgt ttcccaaaac acctatacct gaaaatgctt 3420

tttctctttc tattattcca tggacttcat ttactgggtt taacttaaat atcaataata 3480

atagtaatta ccttctacccattattacag caggaaaatt cattaataaa ggtaattcaa 3540

tatatttacc gctatcttta caggtacatc attctgtttg tgatggttat catgcaggat 3600

tgtttatgaa ctctattcag gaattgtcag ataggcctaa tgactggctt ttataatatg 3660

agataatgcc gactgtactt tttacagtcg gttttctaat gtcactaacc tgccccgtta 3720

gttgaaggca ttttctgtca atgttttctt acaaagaacg ctgtgatata ctgaaatttg 3780

tccgtataca ttttggagga atggatatgt taccaaaata cgcgcaagta aaagaagaaa 3840

tcagttcttg gattaatcaa ggcaaaatac tgcccgatca aaaaatccct accgaaaacg 3900

aattaatgca gcaattcggc gtcagccggc ataccatccg caaagcgatc ggagacctcg 3960

tatcacaagg tctgctgtac agcgtgcaag gcggaggcac ctttgtcgct tcacgctctg 4020

ctaagtcagc gctgcattcc aataaaacga tcggtgtttt gacaacttac atatcagact 4080

atattttccc gagcatcatc agaggaatcg agtcctattt aagcgagcag gggtattcta 4140

tgcttttgac aagcacaaac aacaacccgg acaatgaaag aagaggctta gaaaacctgc 4200

tgtcccagca tattgacgga ctcatcgtag aaccgacaaa aagcgccctt caaaccccaa 4260

acatcggcta ttatctgaac ttggagaaaa acggcattcc ttttgcgatg attaacgcgt 4320

catatgccga gcttgccgcg ccaagtttta ccttggatga tgtgaaaggc gggatgatgg 4380

cggcggagca tttgctttct ctcggccaca cgcatatgat gggtattttt aaagctgatg 4440

acacacaagg cgtgaaacgg atgaacggat ttatacaggc gcaccgggag cgtgagttgt 4500

ttccttctcc ggatatgatc gtgacattta caacggaaga aaaagaatca aaacttctgg 4560

agaaagtaaa agccacactg gagaaaaaca gcaagcacat gccgacagcc attctttgtt 4620

ataacgatga aattgcgctg aaggtgattg atatgctgag ggagatggat cttaaagtgc 4680

cggaggatat gtctattgtc gggtacgatg attcacattt cgcccaaatc tcagaagtga 4740

aactaacctc tgtcaaacat ccgaaatcag tgcttggaaa agcagccgcc aaatatgtca 4800

ttgactgctt agagcataaa aagccgaagc aagaggatgt catatttgag cctgagttga 4860

tcattcgcca gtccgcacga aaactgaatg aataaggaat cacaaccgat gaaaatggct 4920

gccagtgaag gcctatggga agacagcggt gaccctgctg cttggaccgc ttttgcgacg 4980

atcgatacaa aaaatgaaaa aagctcaaat gaaatcaaag ttccttatgc cttgagctac 5040

ttggcttatc agaaattcag cggaagtgtc aaagggatga aaacccttca ggctgagtac 5100

gaaaaaatat acggaaaagg cgactacatt ccgccagtga aaacgacatt ctggagcttc 5160

cgcatcatgg taggagcagg tgttgtcatg attcttgctg cgttaggcgg cctttggtta 5220

aaccgccgta aaaagcttga aaacagcaaa tggtatttgc gcatcatgat cgcgttgatt 5280

tccttcccgt ttcttgcaaa ctccgcgggc tggattatga cagaaatcgg acgtcagcct 5340

tggacggtta tggggttaat gacaaccgct caatctgtgt cgcctaacgt aacagcgggt 5400

tccttgttat tctcaatcat cgcattcggt gtgatgtaca tgattcttgg tgcactgctt 5460

gtcttcttgt ttatccgtga gattaaaaaa ggtgcggagc atgataatca tcatgatgtg 5520

cctgtatcaa cagatccatt tagtcaggag gtataccatg gcatctcttc atgatctttg 5580

gtttatactc gttgctgtat tgtttgtagg attcttcttt ttggaaggct ttgatttcgg 5640

ggtcggcatg gcgacccgtt ttcttggcca taatgaatta gaacgcagag tgctgatcaa 5700

cacgatcggg ccgttctggg acgcgaatga agtgtggctt ttgactggcg caggcgccat 5760

tttcgcggca ttcccaaact ggtatgcaac gatgctgagc ggttattaca ttccgtttgt 5820

catagtgctg cttgcgttaa tgggccgcgg ggtcgcgttt gagttccgcg gcaaggtgga 5880

tcatttaaaa tgggtaaagg tttgggactg ggtcgttttt ttcggcagtc taattcctcc 5940

gtttgtgctt ggtgtgctgt tcacgacatt attccgcggg atgccgattg atgccgacat 6000

gaacattcac gcacatgtat ctgattatat caatgtatat tctatacttg gcggtgtg 6058

Claims

1. Application of vitreoscilla hemoglobin in providing microorganism to express menadione-7 is provided.

2. Recombinant bacillus subtilis containing vitreoscilla hemoglobin gene.

3. A recombinant Bacillus subtilis for improving the secretion of menadione-7 is characterized by containing vitreoscilla hemoglobin genes.

4. The gene modification method for promoting the bacillus subtilis to synthesize menadione-7 is characterized by comprising the following steps of:

construction of starting Strain BSMK _9

(1) Overexpression of menA Gene at the yxlA site on the B.subtilis chromosome

Firstly, using chromosome of B.subtilis 168 as a template, and respectively amplifying fragments U (1115bp), A (1057bp), D (1053bp) and G (806bp) by using primers yxlA-menA-U1/yxlA-menA-U2q, yxlA-menA-1q/yxlA-menA-2, yxlA-menA-D1q/yxlA-menA-D2, yxlA-menA-G1 q/yxlA-menA-G2; amplifying a fragment P (442bp) containing the promoter PlapS by using a primer yxlA-menA-P1/yxlA-menA-P2 and using the plasmid pUC57-1.8k-P1 as a template; amplifying a fragment CR (2069bp) by using a primer yxlA-menA-CR1q/CR2 by using a chromosome of BS168NUm as a template; then, splicing the segment U, P and A into a segment UPA (2614bp) by using a primer yxlA-menA-U1/yxlA-menA-2 through an overlapping PCR method; then the fragment UPA and the fragment D are spliced into a fragment UPAD (3667bp) by using a primer yxlA-menA-U1/yxlA-menA-D2; finally, the fragment UPAD, the fragment CR and the fragment G are spliced into a fragment UPADCRG (6542bp) by using a primer yxlA-menA-U1/yxlA-menA-G2; transforming the UPADCRG fragment into a competent cell of a recipient bacterium BS168NU, and finally obtaining a recombinant strain MK3 with menA gene integrated at a yxlA locus through two-step screening; overexpresses dxs gene at yjoB locus, overexpresses dxr gene at ydeO locus, overexpresses yacM-yacN gene at yqaL locus, overexpresses glpK gene at pksJ locus, overexpresses glpD gene at pksL locus, overexpresses aroG gene at iolI locus, overexpresses pyrG gene at iolE locus, overexpresses hepS gene at yqaQ locus in a similar way as in the case of overexpression of menA gene at yxlA locus;

(2) deletion of dhbB Gene

Using chromosome of B.subtilis 168 as template, respectively amplifying fragments U (1003bp), D (815bp) and G (605bp) by primers dhbB-U1/dhbB-U2, dhbB-D1q/dhbB-D2 and dhbB-G1 q/dhbB-G2; amplifying a fragment CR (2069bp) with a selection box (cat-araR) by using a primer dhbB-CR1q/CR2 by using a chromosome of BS168NUm as a template; firstly, splicing the fragments U and D into UD (1818bp) by overlap PCR by using primers dhbB-U1/dhbB-D2; then, splicing the three fragments UD, GR and G into UDCRG (4492bp) by using a primer dhbB-U1/dhbB-G2 through an overlapping PCR method; transforming the UDCRG fragment into a competent cell of a receptor bacterium MK3-MEP123, and finally screening to obtain a recombinant strain MK3-MEP 123-delta dhbB with a gene dhbB knocked out; the knockout of the mgsA gene and the araM gene is similar to that of dhbB; sequentially overexpressing the 10 genes and knocking out 3 genes to finally obtain a recombinant strain BSMK _ 9;

(II) overexpression of vitreoscilla hemoglobin gene vgb

Firstly, a chromosome of an original bacterium BSMK9 is taken as a template, and primers cyd-vgb-U1/cyd-vgb-U2, cyd-vgb-D1/cyd-vgb-D2 and cyd-vgb-G1q/cyd-vgb-G2 are respectively used for amplifying a fragment U, as shown in SEQ ID No.11, 1149 bp; the amplified fragment D is shown as SEQ ID No.12 and 1028 bp; and an amplified fragment G, represented by SEQ ID No.13, of 1163 bp; using chromosome of BS168NUm as template, amplifying fragment CR with primer cyd-vgb-CR1q/CR2, as shown in SEQ ID No.14, 2069 bp; plasmid pUC57-Simple-VHb is used as a template, and a primer cyd-vgb-1/cyd-vgb-2 is used for amplifying a fragment PV containing a promoter TP2 expression cassette and a vitreoscilla hemoglobin gene vgb, as shown in SEQ ID No.15, 689 bp; then splicing into UPVDCRG 6058bp by an overlapping PCR method; UPVDCRG fragment is used for transforming competent cells of receptor strain BSMK _9, and finally screening is carried out to obtain a recombinant strain BSMK _11 with vgb gene integrated at cyd locus; the sequence of UPVDCRG fragment is shown in SEQ ID No. 16;

the PCR primer sequences were as follows:

。